MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-264H23
Chromosome	9 (Build37)
Map Location	121,322,126 - 121,475,268
singlet/doublet	doublet
Overlap gene	Trak1, Cck
Upstream gene	Myrip, Eif1b, LOC638068, Entpd3, Rpl14, 5830454E08Rik, LOC100040010, Ctnnb1, Ulk4
Downstream gene	Lyzl4, Vipr1, LOC100040063, Sec22c, Deb1, Nktr, Kbtbd5, Hhatl, Ccdc13, Higd1a, Ccbp2, Cyp8b1, C730027P07Rik, C85492, LOC100040121, Snrk, Tmem16k, Abhd5, LOC100040193, LOC100040204
Link	Open Mouse BAC browser

Click to get alignment info.

name	Myrip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245049 MGI:2384407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68969 MGI:1916219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638068 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638068
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 9 Proteins pseudo : _no_value

name	Entpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215446 MGI:1321386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67115 MGI:1914365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830454E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76100 MGI:1923350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	LOC100040010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Ctnnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12387 MGI:88276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ulk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209012 MGI:1921622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Trak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67095 MGI:1914345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12424 MGI:88297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyzl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69032 MGI:1916282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vipr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22354 MGI:109272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Sec22c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215474 MGI:2447871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Deb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26901 MGI:1349474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nktr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18087 MGI:97346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kbtbd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72330 MGI:1919580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hhatl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74770 MGI:1922020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434446 MGI:1920144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56295 MGI:1930666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59289 MGI:1891697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp8b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13124 MGI:1338044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730027P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245050 MGI:3041196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C85492 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215494 MGI:2143424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Snrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20623 MGI:108104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102566 MGI:2143103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67469 MGI:1914719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040193 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Myrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802457 GeneID:245049 MGI:2384407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin VIIA and Rab interacting protein transcript_id : NM_144557.3

name	Eif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803572 GeneID:68969 MGI:1916219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 1B transcript_id : NM_026892.2

name	Entpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380176 GeneID:215446 MGI:1321386
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 3 transcript_id : NM_178676.3

name	Rpl14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373739 GeneID:67115 MGI:1914365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L14 transcript_id : NM_025974.2

name	5830454E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260352 GeneID:76100 MGI:1923350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : RIKEN cDNA 5830454E08 gene transcript_id : XM_001473897.1

name	LOC100040010 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260354 GeneID:100040010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040010 transcript_id : XM_001473936.1

name	Ctnnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560726 GeneID:12387 MGI:88276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), beta 1 transcript_id : NM_007614.2

name	Ulk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260413 GeneID:209012 MGI:1921622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : unc-51-like kinase 4 (C. elegans) transcript_id : XM_001481114.1

name	Trak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517684 GeneID:67095 MGI:1914345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein, kinesin binding 1 transcript_id : NM_175114.3

name	Cck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130260 GeneID:12424 MGI:88297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholecystokinin transcript_id : NM_031161.2

name	Lyzl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982636 GeneID:69032 MGI:1916282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysozyme-like 4 transcript_id : NM_026915.2

name	Vipr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367730 GeneID:22354 MGI:109272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasoactive intestinal peptide receptor 1 transcript_id : NM_011703.3

name	Sec22c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372397 GeneID:215474 MGI:2447871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC22 vesicle trafficking protein-like C (S. cerevisiae) transcript_id : NM_178677.3

name	Deb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982638 GeneID:26901 MGI:1349474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : differentially expressed in B16F10 1 transcript_id : NM_026794.2

name	Nktr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62526129 GeneID:18087 MGI:97346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natural killer tumor recognition sequence transcript_id : NM_010918.2

name	Kbtbd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802237 GeneID:72330 MGI:1919580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch repeat and BTB (POZ) domain containing 5 transcript_id : NM_028202.2

name	Hhatl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312881 GeneID:74770 MGI:1922020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hedgehog acyltransferase-like transcript_id : NM_029095.1

name	Ccdc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702098 GeneID:434446 MGI:1920144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 13 transcript_id : NM_001033784.1

name	Higd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361374 GeneID:56295 MGI:1930666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 1A transcript_id : NM_019814.3

name	Ccbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371177 GeneID:59289 MGI:1891697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine binding protein 2 transcript_id : NM_021609.3

name	Cyp8b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981807 GeneID:13124 MGI:1338044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 8, subfamily b, polypeptide 1 transcript_id : NM_010012.2

name	C730027P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386694 GeneID:245050 MGI:3041196
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730027P07 gene transcript_id : NM_177743.3

name	C85492 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593062 GeneID:215494 MGI:2143424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C85492 transcript_id : NM_153540.3

name	LOC100040121 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260356 GeneID:100040121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040121 transcript_id : XM_001474116.1

name	Snrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526941 GeneID:20623 MGI:108104
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF related kinase transcript_id : NM_133741.1

name	Tmem16k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802585 GeneID:102566 MGI:2143103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16K transcript_id : NM_133979.2

name	Abhd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88703067 GeneID:67469 MGI:1914719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 5 transcript_id : NM_026179.2

name	Myrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362371 CCDS:CCDS23627.1 GeneID:245049 MGI:2384407
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017022 - myosin binding [Evidence ISS] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0017137 - Rab GTPase binding [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0030050 - vesicle transport along actin filament [Evidence TAS] codon_start : 1 note : exophilin 8; rab effector MYRIP product : myosin VIIA and Rab interacting protein protein_id : NP_653140.1

name	Eif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312159 CCDS:CCDS23628.1 GeneID:68969 MGI:1916219
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : translation factor sui1 homolog protein_id : NP_081168.1

name	Entpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520059 CCDS:CCDS23629.1 GeneID:215446 MGI:1321386
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0009134 - nucleoside diphosphate catabolism [Evidence IDA]; GO:0009143 - nucleoside triphosphate catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : CD39 antigen-like 3 product : ectonucleoside triphosphate diphosphohydrolase 3 protein_id : NP_848791.1

name	Rpl14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385472 GeneID:67115 MGI:1914365
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L14 protein_id : NP_080250.1

name	5830454E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260353 GeneID:76100 MGI:1923350
definition	codon_start : 1 product : hypothetical protein LOC76100 protein_id : XP_001473947.1

name	LOC100040010 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260355 GeneID:100040010
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473986.1

name	Ctnnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671684 CCDS:CCDS23630.1 GeneID:12387 MGI:88276
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0045177 - apical part of cell [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016328 - lateral plasma membrane [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0031528 - microvillus membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0045294 - alpha-catenin binding [Evidence IPI]; GO:0005488 - binding [Evidence IEA]; GO:0045296 - cadherin binding [Evidence IPI]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045453 - bone resorption [Evidence IMP] [Evidence IGI]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0001709 - cell fate determination [Evidence IMP]; GO:0001708 - cell fate specification [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0000904 - cellular morphogenesis during differentiation [Evidence IMP]; GO:0050875 - cellular physiological process [Evidence IDA]; GO:0009950 - dorsal/ventral axis specification [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0007398 - ectoderm development [Evidence IMP]; GO:0035117 - embryonic arm morphogenesis [Evidence IDA]; GO:0042733 - embryonic digit morphogenesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001706 - endoderm formation [Evidence IMP]; GO:0001711 - endodermal cell fate commitment [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IDA]; GO:0030324 - lung development [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045671 - negative regulation of osteoclast differentiation [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0030316 - osteoclast differentiation [Evidence IMP]; GO:0031016 - pancreas development [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0030858 - positive regulation of epithelial cell differentiation [Evidence IMP]; GO:0045669 - positive regulation of osteoblast differentiation [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IGI] [Evidence IDA]; GO:0009954 - proximal/distal pattern formation [Evidence IMP]; GO:0045595 - regulation of cell differentiation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0045667 - regulation of osteoblast differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0050808 - synapse organization and biogenesis [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0048489 - synaptic vesicle transport [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 note : cadherin associated protein; beta-catenin; beta catenin; catenin beta; catenin (cadherin-associated protein), beta 1, 88kDa product : catenin (cadherin associated protein), beta 1, 88kDa protein_id : NP_031640.1

name	Ulk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260414 GeneID:209012 MGI:1921622
definition	codon_start : 1 product : unc-51-like kinase 4 protein_id : XP_001481164.1

name	Trak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517685 GeneID:67095 MGI:1914345
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence IDA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS]; GO:0006605 - protein targeting [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : trafficking protein, kinesin binding 1 protein_id : NP_780323.2

name	Cck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624301 CCDS:CCDS23631.1 GeneID:12424 MGI:88297
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0042755 - eating behavior [Evidence IDA]; GO:0001764 - neuron migration [Evidence IDA] codon_start : 1 product : cholecystokinin protein_id : NP_112438.1

name	Lyzl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312181 CCDS:CCDS23632.1 GeneID:69032 MGI:1916282
definition	GO_function : GO:0003796 - lysozyme activity [Evidence IEA] GO_process : GO:0016998 - cell wall catabolism [Evidence IEA] codon_start : 1 product : lysozyme-like protein 4 protein_id : NP_081191.1

name	Vipr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543948 CCDS:CCDS23633.1 GeneID:22354 MGI:109272
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004999 - vasoactive intestinal polypeptide receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : VIP receptor subtype 1 product : vasoactive intestinal peptide receptor 1 protein_id : NP_035833.2

name	Sec22c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520061 CCDS:CCDS23634.1 GeneID:215474 MGI:2447871
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SEC22 vesicle trafficking protein-like 3 protein_id : NP_848792.1

name	Deb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312078 GeneID:26901 MGI:1349474
definition	codon_start : 1 note : Band 47B product : differentially expressed in B16F10 1 protein_id : NP_081070.1

name	Nktr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526130 CCDS:CCDS23636.1 GeneID:18087 MGI:97346
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cyclophilin-related protein; natural killer tumor recognition protein product : natural killer tumor recognition protein_id : NP_035048.3

name	Kbtbd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625935 CCDS:CCDS23637.1 GeneID:72330 MGI:1919580
definition	codon_start : 1 product : kelch repeat and BTB (POZ) domain containing 5 protein_id : NP_082478.1

name	Hhatl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312882 CCDS:CCDS23638.1 GeneID:74770 MGI:1922020
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : Gup1, glycerol uptake/transporter homolog protein_id : NP_083371.1

name	Ccdc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702099 CCDS:CCDS23639.1 GeneID:434446 MGI:1920144
definition	codon_start : 1 product : coiled-coil domain containing 13 protein_id : NP_001028956.1

name	Higd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789977 GeneID:56295 MGI:1930666
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypoxia induced gene 1 protein_id : NP_062788.1

name	Ccbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542483 CCDS:CCDS23640.1 GeneID:59289 MGI:1891697
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : D6 beta-chemokine receptor product : chemokine binding protein 2 protein_id : NP_067622.2

name	Cyp8b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981808 CCDS:CCDS23641.1 GeneID:13124 MGI:1338044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 8b1, sterol 12 alpha-hydrolase; sterol 12-alpha-hydrolase product : cytochrome P450, family 8, subfamily b, polypeptide 1 protein_id : NP_034142.2

name	C730027P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244228 GeneID:245050 MGI:3041196
definition	codon_start : 1 product : hypothetical protein LOC245050 protein_id : NP_808411.1

name	C85492 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593063 CCDS:CCDS23643.1 GeneID:215494 MGI:2143424
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase protein_id : NP_705768.3

name	LOC100040121 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260357 GeneID:100040121
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474166.1

name	Snrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526942 CCDS:CCDS23644.1 GeneID:20623 MGI:108104
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SNF related kinase protein_id : NP_598502.1

name	Tmem16k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794236 CCDS:CCDS23645.1 GeneID:102566 MGI:2143103
definition	codon_start : 1 product : hypothetical protein LOC102566 protein_id : NP_598740.1

name	Abhd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385690 CCDS:CCDS23646.1 GeneID:67469 MGI:1914719
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005811 - lipid particle [Evidence IDA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : abhydrolase domain containing 5 protein_id : NP_080455.1

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 1 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 2 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 3 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 4 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 5 pseudo : _no_value

name	LOC100040193 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040193
definition	number : 1 pseudo : _no_value

name	LOC100040193 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040193
definition	number : 2 pseudo : _no_value

name	LOC100040204 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040204
definition	number : 2 pseudo : _no_value

name	LOC100040204 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040204
definition	number : 1 pseudo : _no_value

name	LOC638068 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260351 GeneID:638068
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 9 Proteins product : similar to Interleukin-1 receptor-associated kinase 2d pseudo : _no_value transcript_id : XR_031411.1

clone name	MSMg01-440O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153C14
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-222K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-264H23.b	B6Ng01-264H23.g
ACC	GA068386	GA068387
length	1,085	794
definition	B6Ng01-264H23.b	B6Ng01-264H23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(121,322,126 - 121,323,166)	(121,474,475 - 121,475,268)
sequence	gaattcatacagttgaatccttcttaacagtctgctttacgggaaccttt atcaccgtcgttccccagctgatgagttctgaattcggcagttgaatcct tctcaacagtctgtgttacgggaacctttataaacgtgatccgcagttct ggttctgaaatgaagtatccctcctgcgccagtccggagttttttctcgt cccgggttttcggcaccaattgttattcgatgcgttctcacgaccggcca ggaagaacacaacaaccagaatcttctacggcaaagctttattgcttaca tcttatggggccagagtgtaagaagcaagagagagagaaaacgaaacccc tttcctctttaaagagaacaacaattgcctaggacgcatcactccctgat tggctgcagcccatggccgagctgacgttcacgggaaaaacagagtacaa gtagtcgtaaatacccttggcacatgcgcagattatttgtttaccaactt agaacacaggatgtcagcgccatcttgtgacggcgaatgtgggggcggct tcccacagaatgcatccacgcgtacccagatttcacagtctaaactctga gctaagcagtgttattcactttcattgggtaaagttttgttagtagcttc ttctttttttttttttttttaatttttgacagattctcttgtagtccagg ctggccttaaatttgctttgtagtcaaggaagaccttgaacctggtcctc ctgcctccacctacagagggctaagactacagtgccaatgtcataagtga ggtcaccaggaaatgaccctccatgatgggccaacggtgctctgtgacaa ccagagagcatggcagccagactgaatcagacccaagctgaaggaggatg agtccgtcagccactacaaggagggccagaggacagcacctctctgtgga gaggggaaaggcagatggagcaagtcttagcgtctggaccctgatgaaaa tacacaggatttgatctttcacgcgcttttctgtaaccagcctatgtcag agaactcgcagagccttgctagtctgggcggtgca	gaattcacatggcaggggttgtgtgctcattctttgaatgggattttttt tcttgatttcttttcagataattcacctcatttaaaaggaaagagtttat cttttcagctccactgggatatcagccatgggcttgttacctggagcctt tatggggtgaaggacatttcagagattttctttaaattatttttatttta ttttacatgttagggtgttttggttgcatgcatgtagtgcttgaggaagc cagaagagggcgtcagatctcctggaactagagttacagactattgtgag atgccatatgggtgctgggagtcaagcctaagtgttcgggagcggacagt gatcttaatctcggagccattaatttatgcgggactttgctgaatacctt tagtctctgctagattcccctgtggtcttggccctttggttaacactaat tttacctcttaaactcttggtcgtgggatgagaaacacttgatcagggaa aaggtctgtttactgtacagtgctgctgggtttgccttgctgggatttag ttgttgatttttgcatctgggtcaatcagggttatcatcctacaattttg ttttatgtttttatagcatccttccctggctttgatatcaaagccatttc cctgataacagatattttcagattcttttgcaggggaattttaagacttt ggaaaatgtatttgatcagacccagcaacacaagcactgagttctgggcc tttcccttctctctctctctctctctctctctctctctctctct
quality values	Open. Hide. 58 33 27 35 58 31 14 54 54 54 41 62 62 62 62 54 39 47 62 62 62 62 62 62 62 62 62 39 37 62 62 42 31 43 36 32 38 59 45 43 50 62 62 43 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 59 59 48 43 62 56 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 45 54 58 54 58 58 58 58 58 54 58 58 54 58 58 58 58 58 52 58 54 48 49 58 58 58 58 58 58 58 54 51 58 54 58 58 58 49 54 58 58 47 58 58 58 58 58 58 52 54 54 54 58 58 54 54 58 58 58 58 58 58 58 36 30 58 51 36 58 47 58 53 51 52 58 51 58 50 45 46 54 50 53 58 58 45 51 52 58 54 51 58 58 48 50 58 41 41 58 58 58 58 51 58 47 38 50 50 51 52 58 58 54 52 51 51 53 53 58 58 58 58 58 58 58 58 58 58 58 58 49 49 58 39 47 50 24 49 58 58 49 49 47 31 40 36 32 16 54 41 53 52 50 44 51 32 33 13 35 49 35 29 35 50 42 24 40 54 22 38 49 44 40 49 46 40 54 44 40 47 54 54 40 39 34 37 39 53 41 45 47 29 44 38 44 17 32 23 30 28 44 33 51 47 39 46 42 51 51 35 40 53 39 32 46 31 52 26 46 15 21 41 28 34 37 37 35 33 23 31 31 13 49 51 26 32 40 47 27 33 26 34 34 35 25 30 31 45 30 51 19 35 27 33 31 32 33 45 45 31 36 32 35 32 32 46 26 31 18 18 31 31 21 28 24 46 27 26 35 31 30 41 31 36 18 21 23 38 38 38 32 42 46 35 10 27 14 21 21 13 25 9 29 29 27 31 33 30 15 21 32 14 7 9 26 29 10 25 34 21 29 22 31 31 24 33 31 9 14 21 33 32 17 20 26 18 20 18 32 30 33 28 23 6 25 14 38 26 9 19 27 27 25 22 21 30 11 37 23 13 37 32 27 21 25 16 34 28 29 16 20 32 21 27 21 28 19 19 21 19 21 13 11 15 10 30 20 36 19 14 19 14 14 33 9 7 17 20 18 7 20 14 27 9 28 27 27 20 27 24 16 14 6 7 5 6 6 19 47 15 14 33 21 8 20 9 9 20 25 13 28 27 27 15 17 22 7 8 16 27 13 27 26 10 19 20 20 21 11 15 21 16 6 11 13 15 8 3 7 8 20 30 30 10 9 3 3 6 11 2 5 3 6 5 27 3 3 1 14 3 3 20 17 6 6 20 5 10 15 6 14 21 28 10 7 4 6 6 7 24 11 9 11 9 7 6 13 9 16 15 20 21 7 5 23 3 1 5 1 3 6 5 19 6 4 15 4 3 1 2 5 19 11 22 6 4 3 4 4 3 12 9 10 9 8 4 4 4 2	Open. Hide. 62 59 51 59 62 59 43 62 59 62 62 59 44 40 32 42 54 54 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 59 59 59 62 62 62 62 62 62 59 62 62 54 49 54 62 62 62 59 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 59 62 62 62 62 59 59 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 54 62 62 59 56 62 54 33 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 42 49 54 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 32 62 62 56 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 45 58 58 58 58 58 58 58 58 47 41 44 54 58 58 58 58 58 58 54 58 58 58 58 58 58 54 47 58 54 54 58 52 46 58 58 58 58 51 51 58 41 58 58 58 51 52 49 42 54 58 58 58 58 58 58 58 58 51 52 46 51 49 58 58 58 53 53 50 39 51 58 58 49 51 51 58 51 46 58 58 48 58 58 52 58 58 39 49 39 35 41 41 39 39 58 58 51 50 44 42 41 58 44 44 58 44 49 58 53 50 53 51 50 52 39 36 35 35 39 54 54 54 41 32 32 54 49 51 53 54 54 54 54 52 49 42 31 54 54 54 54 34 27 49 49 35 42 46 45 51 23 54 51 41 53 38 51 51 54 44 40 53 31 52 42 54 51 44 30 33 33 47 40 53 37 44 42 32 40 53 32 35 40 32 47 35 53 53 53 40 41 34 29 52 32 51 36 42 32 35 53 53 31 39 31 52 34 25 51 51 41 44 40 27 30 30 46 45 45 33 29 20 33 46 32 33 27 20 23 29 33 38 30 27 30 46 25 29 26 24 25 20 20 22 14 9 10 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_121322126_121323166
seq2: B6Ng01-264H23.b_102_1128

seq1  CGTTCCCCAGCTGATGAGTTCTGAATTCGGCAGTTGAATCCTTCTCAACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTCCCCAGCTGATGAGTTCTGAATTCGGCAGTTGAATCCTTCTCAACA  50

seq1  GTCTGTGTTACGGGAACCTTTATAAACGTGATCCGCAGTTCTGGTTCTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGTGTTACGGGAACCTTTATAAACGTGATCCGCAGTTCTGGTTCTGA  100

seq1  AATGAAGTATCCCTCCTGCGCCAGTCCGGAGTTTTTTCTCGTCCCGGGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGTATCCCTCCTGCGCCAGTCCGGAGTTTTTTCTCGTCCCGGGTT  150

seq1  TTCGGCACCAATTGTTATTCGATGCGTTCTCACGACCGGCCAGGAAGAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGGCACCAATTGTTATTCGATGCGTTCTCACGACCGGCCAGGAAGAAC  200

seq1  ACAACAACCAGAATCTTCTACGGCAAAGCTTTATTGCTTACATCTTATGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACAACCAGAATCTTCTACGGCAAAGCTTTATTGCTTACATCTTATGG  250

seq1  GGCCAGAGTGTAAGAAGCAAGAGAGAGAGAAAACGAAACCCCTTTCCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGAGTGTAAGAAGCAAGAGAGAGAGAAAACGAAACCCCTTTCCTCT  300

seq1  TTAAAGAGAACAACAATTGCCTAGGACGCATCACTCCCTGATTGGCTGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGAGAACAACAATTGCCTAGGACGCATCACTCCCTGATTGGCTGCA  350

seq1  GCCCATGGCCGAGCTGACGTTCACGGGAAAAACAGAGTACAAGTAGTCGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCATGGCCGAGCTGACGTTCACGGGAAAAACAGAGTACAAGTAGTCGT  400

seq1  AAATACCCTTGGCACATGCGCAGATTATTTGTTTACCAACTTAGAACACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACCCTTGGCACATGCGCAGATTATTTGTTTACCAACTTAGAACACA  450

seq1  GGATGTCAGCGCCATCTTGTGACGGCGAATGTGGGGGCGGCTTCCCACAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGTCAGCGCCATCTTGTGACGGCGAATGTGGGGGCGGCTTCCCACAG  500

seq1  AATGCATCCACGCGTACCCAGATTTCACAGTCTAAACTCTGAGCTAAGCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCATCCACGCGTACCCAGATTTCACAGTCTAAACTCTGAGCTAAGCA  550

seq1  GTGTTATTCACTTTCATTGGGTAAAGTTTTGTTAGTAGCTTCTTCTTTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTATTCACTTTCATTGGGTAAAGTTTTGTTAGTAGCTTCTTCTTTTT  600

seq1  TTTTTTTTTTTTAATTTTTGACAGATTCTCTTGTAGTCCAGGCTGGCCTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTTTTAATTTTTGACAGATTCTCTTGTAGTCCAGGCTGGCCTT  650

seq1  AAATTTGCTTTGTAGTCAAGGAAGACCTTGAACCTGGTCCTCCTGCCTCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTTGCTTTGTAGTCAAGGAAGACCTTGAACCTGGTCCTCCTGCCTCC  700

seq1  ACCTACAGAGGGCTAAGACTACAGTGCCAATGTCATAAGTGAGGTCACCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTACAGAGGGCTAAGACTACAGTGCCAATGTCATAAGTGAGGTCACCA  750

seq1  GGAAATGACCCTCCATGATGGGCCAACGGTGCTCTGTGAC-ACCAGAGAG  799
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GGAAATGACCCTCCATGATGGGCCAACGGTGCTCTGTGACAACCAGAGAG  800

seq1  CATGGCAGCCAGACTGAATCAGACCCAAGCTGAAGGAGGATGAGTCCCGT  849
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CATGGCAGCCAGACTGAATCAGACCCAAGCTGAAGGAGGATGAGT-CCGT  849

seq1  CAGCCACTACAAGGAGGGCCAGAGGACAGCACCTCTCTGTGGAGA-GGGA  898
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CAGCCACTACAAGGAGGGCCAGAGGACAGCACCTCTCTGTGGAGAGGGGA  899

seq1  AAGGCAGATGGAGCAAGTCTTAGCGTCTGGGACCCTGGATGAAAATACAC  948
      |||||||||||||||||||||||||||| ||||||| |||||||||||||
seq2  AAGGCAGATGGAGCAAGTCTTAGCGTCT-GGACCCT-GATGAAAATACAC  947

seq1  AGGGATTTTGGTTCCTTTTCACGCGGCTTTTCTGTAAACACAGCTATGTC  998
      | ||||||  | ||  |||||||| |||||||||||| ||   |||||| 
seq2  A-GGATTT--GATC--TTTCACGC-GCTTTTCTGTAACCA-GCCTATGT-  989

seq1  CAGAGAAATTCGCAGAGCCTCTGCTTAGTTCTGGGGCGGTGCA  1041
      ||||| || ||||||||||| ||| ||| ||| ||||||||||
seq2  CAGAG-AACTCGCAGAGCCT-TGC-TAG-TCT-GGGCGGTGCA  1027

seq1: chr9_121474475_121475268
seq2: B6Ng01-264H23.g_67_860 (reverse)

seq1  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGGGAAAGGCCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGGGAAAGGCCCA  50

seq1  GAACTCAGTGCTTGTGTTGCTGGGTCTGATCAAATACATTTTCCAAAGTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCAGTGCTTGTGTTGCTGGGTCTGATCAAATACATTTTCCAAAGTC  100

seq1  TTAAAATTCCCCTGCAAAAGAATCTGAAAATATCTGTTATCAGGGAAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAATTCCCCTGCAAAAGAATCTGAAAATATCTGTTATCAGGGAAATG  150

seq1  GCTTTGATATCAAAGCCAGGGAAGGATGCTATAAAAACATAAAACAAAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTGATATCAAAGCCAGGGAAGGATGCTATAAAAACATAAAACAAAAT  200

seq1  TGTAGGATGATAACCCTGATTGACCCAGATGCAAAAATCAACAACTAAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGGATGATAACCCTGATTGACCCAGATGCAAAAATCAACAACTAAAT  250

seq1  CCCAGCAAGGCAAACCCAGCAGCACTGTACAGTAAACAGACCTTTTCCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCAAGGCAAACCCAGCAGCACTGTACAGTAAACAGACCTTTTCCCT  300

seq1  GATCAAGTGTTTCTCATCCCACGACCAAGAGTTTAAGAGGTAAAATTAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCAAGTGTTTCTCATCCCACGACCAAGAGTTTAAGAGGTAAAATTAGT  350

seq1  GTTAACCAAAGGGCCAAGACCACAGGGGAATCTAGCAGAGACTAAAGGTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAACCAAAGGGCCAAGACCACAGGGGAATCTAGCAGAGACTAAAGGTA  400

seq1  TTCAGCAAAGTCCCGCATAAATTAATGGCTCCGAGATTAAGATCACTGTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCAAAGTCCCGCATAAATTAATGGCTCCGAGATTAAGATCACTGTC  450

seq1  CGCTCCCGAACACTTAGGCTTGACTCCCAGCACCCATATGGCATCTCACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTCCCGAACACTTAGGCTTGACTCCCAGCACCCATATGGCATCTCACA  500

seq1  ATAGTCTGTAACTCTAGTTCCAGGAGATCTGACGCCCTCTTCTGGCTTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTCTGTAACTCTAGTTCCAGGAGATCTGACGCCCTCTTCTGGCTTCC  550

seq1  TCAAGCACTACATGCATGCAACCAAAACACCCTAACATGTAAAATAAAAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGCACTACATGCATGCAACCAAAACACCCTAACATGTAAAATAAAAT  600

seq1  AAAAATAATTTAAAGAAAATCTCTGAAATGTCCTTCACCCCATAAAGGCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATAATTTAAAGAAAATCTCTGAAATGTCCTTCACCCCATAAAGGCT  650

seq1  CCAGGTAACAAGCCCATGGCTGATATCCCAGTGGAGCTGAAAAGATAAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTAACAAGCCCATGGCTGATATCCCAGTGGAGCTGAAAAGATAAAC  700

seq1  TCTTTCCTTTTAAATGAGGTGAATTATCTGAAAAGAAATCAAGAAAAAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCCTTTTAAATGAGGTGAATTATCTGAAAAGAAATCAAGAAAAAAA  750

seq1  ATCCCATTCAAAGAATGAGCACACAACCCCTGCCATGTGAATTC  794
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCATTCAAAGAATGAGCACACAACCCCTGCCATGTGAATTC  794

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information