MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-277G23
Chromosome	9 (Build37)
Map Location	114,739,299 - 114,872,169
singlet/doublet	doublet
Overlap gene	Cmtm8, Gpd1l
Upstream gene	Clasp2, Ubp1, Fbxl2, Susd5, EG665719, 4921528I07Rik, Bcl2a1c, 4930520O04Rik, Crtap, Glb1, Ccr4, Trim71, LOC100043808, Cnot10, LOC665772, Dync1li1, Cmtm6, Cmtm7
Downstream gene	LOC100043813, Osbpl10, LOC100043812, Stt3b, LOC100039567, LOC670467, EG546164, Gadl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Clasp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76499 MGI:1923749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ubp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22221 MGI:104889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fbxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72179 MGI:1919429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Susd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382111 MGI:2685972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs

name	EG665719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665719 MGI:3643335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	4921528I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77049 MGI:1924299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Bcl2a1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12046 MGI:1278327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930520O04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75116 MGI:1922366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Crtap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56693 MGI:1891221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12091 MGI:88151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12773 MGI:107824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636931 MGI:2685973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cnot10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78893 MGI:1926143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 9 Proteins pseudo : _no_value

name	Dync1li1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235661 MGI:2135610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67213 MGI:2447165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102545 MGI:2447166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70031 MGI:2447167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpd1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333433 MGI:1289257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043813 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 497 ESTs, 1 Protein

name	Osbpl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74486 MGI:1921736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Stt3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68292 MGI:1915542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC670467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein pseudo : _no_value

name	EG546164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546164 MGI:3648968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2643 ESTs, 9 Proteins

name	Gadl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73748 MGI:1920998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins

name	Clasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506305 GeneID:76499 MGI:1923749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLIP associating protein 2 transcript_id : NM_001081960.1

name	Clasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506303 GeneID:76499 MGI:1923749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLIP associating protein 2 transcript_id : NM_029633.2

name	Ubp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032031 GeneID:22221 MGI:104889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding protein 1 transcript_id : NM_001083319.1

name	Ubp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031988 GeneID:22221 MGI:104889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding protein 1 transcript_id : NM_013699.2

name	Fbxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363633 GeneID:72179 MGI:1919429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 2 transcript_id : NM_178624.4

name	Susd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386581 GeneID:382111 MGI:2685972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs product : sushi domain containing 5 transcript_id : XM_356198.5

name	EG665719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386582 GeneID:665719 MGI:3643335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : predicted gene, EG665719 transcript_id : XM_978968.1

name	4921528I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386584 GeneID:77049 MGI:1924299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : RIKEN cDNA 4921528I07 gene transcript_id : XM_486266.3

name	Bcl2a1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113679690 GeneID:12046 MGI:1278327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1c transcript_id : NM_007535.2

name	4930520O04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260396 GeneID:75116 MGI:1922366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 4930520O04 gene transcript_id : XM_001481086.1

name	Crtap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910169 GeneID:56693 MGI:1891221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage associated protein transcript_id : NM_019922.1

name	Glb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753189 GeneID:12091 MGI:88151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactosidase, beta 1 transcript_id : NM_009752.1

name	Ccr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857772 GeneID:12773 MGI:107824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 4 transcript_id : NM_009916.1

name	Trim71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948299 GeneID:636931 MGI:2685973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 71 transcript_id : NM_001042503.1

name	LOC100043808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260398 GeneID:100043808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043808 transcript_id : XM_001481088.1

name	Cnot10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387942 GeneID:78893 MGI:1926143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 10 transcript_id : NM_153585.4

name	Dync1li1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130200 GeneID:235661 MGI:2135610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein cytoplasmic 1 light intermediate chain 1 transcript_id : NM_146229.2

name	Cmtm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383888 GeneID:67213 MGI:2447165
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 6 transcript_id : NM_026036.2

name	Cmtm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527197 GeneID:102545 MGI:2447166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 7 transcript_id : NM_133978.1

name	Cmtm8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373686 GeneID:70031 MGI:2447167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 8 transcript_id : NM_027294.2

name	Gpd1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388353 GeneID:333433 MGI:1289257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol-3-phosphate dehydrogenase 1-like transcript_id : NM_175380.4

name	LOC100043813 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260403 GeneID:100043813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 497 ESTs, 1 Protein product : similar to metallopanstimulin transcript_id : XM_001481092.1

name	Osbpl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130153 GeneID:74486 MGI:1921736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 10 transcript_id : NM_148958.2

name	LOC100043812 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260401 GeneID:100043812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043812 transcript_id : XM_001481091.1

name	Stt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61651672 GeneID:68292 MGI:1915542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) transcript_id : NM_024222.2

name	LOC100039567 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260337 GeneID:100039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Ubtf protein transcript_id : XM_001473117.1

name	EG546164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260405 GeneID:546164 MGI:3648968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2643 ESTs, 9 Proteins product : predicted gene, EG546164, transcript variant 1 transcript_id : XM_620794.4

name	Gadl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386586 GeneID:73748 MGI:1920998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins product : glutamate decarboxylase-like 1 transcript_id : XM_135211.6

name	Clasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126506306 GeneID:76499 MGI:1923749
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CLASP2alpha; CLASP2gamma product : CLIP-associating protein CLASP2 isoform b protein_id : NP_001075429.1

name	Clasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126506304 GeneID:76499 MGI:1923749
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CLASP2alpha; CLASP2gamma product : CLIP-associating protein CLASP2 isoform a protein_id : NP_083909.2

name	Ubp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032032 GeneID:22221 MGI:104889
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : upstream binding protein 1 isoform a protein_id : NP_001076788.1

name	Ubp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305605 GeneID:22221 MGI:104889
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : upstream binding protein 1 isoform b protein_id : NP_038727.1

name	Fbxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519963 GeneID:72179 MGI:1919429
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 2 protein_id : NP_848739.1

name	Susd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63595304 GeneID:382111 MGI:2685972
definition	codon_start : 1 product : similar to KIAA0527 protein protein_id : XP_356198.3

name	EG665719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386583 GeneID:665719 MGI:3643335
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984062.1

name	4921528I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386585 GeneID:77049 MGI:1924299
definition	codon_start : 1 product : hypothetical protein LOC77049 protein_id : XP_486266.3

name	Bcl2a1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113679691 CCDS:CCDS23591.1 GeneID:12046 MGI:1278327
definition	GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : hematopoietic-specific early-response A1-c protein product : B-cell leukemia/lymphoma 2 related protein A1c protein_id : NP_031561.2

name	4930520O04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260397 GeneID:75116 MGI:1922366
definition	codon_start : 1 product : hypothetical protein LOC75116 protein_id : XP_001481136.1

name	Crtap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910170 CCDS:CCDS23592.1 GeneID:56693 MGI:1891221
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cartilage associated protein protein_id : NP_064306.1

name	Glb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753190 CCDS:CCDS23593.1 GeneID:12091 MGI:88151
definition	GO_component : GO:0009341 - beta-galactosidase complex [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004565 - beta-galactosidase activity [Evidence IDA]; GO:0043169 - cation binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : beta-galactosidase temporal; beta-galactosidase electrophoretic; beta-galactosidase systemic regulator; beta-galactosidase complex product : galactosidase, beta 1 protein_id : NP_033882.1

name	Ccr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857773 CCDS:CCDS23594.1 GeneID:12773 MGI:107824
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : fusin; chemokine (C-C) receptor 4; CC CKR-4; leukocyte-expressed seven-transmembrane-domain receptor product : chemokine (C-C motif) receptor 4 protein_id : NP_034046.1

name	Trim71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948300 GeneID:636931 MGI:2685973
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lin-41 homolog product : tripartite motif-containing 71 protein_id : NP_001035968.1

name	LOC100043808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260399 GeneID:100043808
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481138.1

name	Cnot10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31324571 GeneID:78893 MGI:1926143
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CCR4-NOT transcription complex, subunit 10 protein_id : NP_705813.2

name	Dync1li1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122795 CCDS:CCDS23595.1 GeneID:235661 MGI:2135610
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence ISS]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence ISS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : dynein, cytoplasmic, light intermediate chain 1 protein_id : NP_666341.1

name	Cmtm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313082 CCDS:CCDS23596.1 GeneID:67213 MGI:2447165
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : chemokine-like factor super family 6 product : chemokine-like factor superfamily 6 protein_id : NP_080312.1

name	Cmtm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527198 GeneID:102545 MGI:2447166
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 7 protein_id : NP_598739.1

name	Cmtm8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312514 CCDS:CCDS23597.1 GeneID:70031 MGI:2447167
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 8 protein_id : NP_081570.1

name	Gpd1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34594657 CCDS:CCDS23598.1 GeneID:333433 MGI:1289257
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0046168 - glycerol-3-phosphate catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycerol-3-phosphate dehydrogenase 1-like protein_id : NP_780589.2

name	LOC100043813 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260404 GeneID:100043813
definition	codon_start : 1 product : similar to metallopanstimulin protein_id : XP_001481142.1

name	Osbpl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507367 GeneID:74486 MGI:1921736
definition	GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol-binding protein-like protein 10 protein_id : NP_683761.1

name	LOC100043812 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260402 GeneID:100043812
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481141.1

name	Stt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61651673 CCDS:CCDS23599.1 GeneID:68292 MGI:1915542
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA] [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0004576 - oligosaccharyl transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006486 - protein amino acid glycosylation [Evidence IEA]; GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] codon_start : 1 product : source of immunodominant MHC-associated peptides protein_id : NP_077184.2

name	LOC100039567 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260338 GeneID:100039567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473167.1

name	EG546164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63594466 GeneID:546164 MGI:3648968
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_620794.1

name	Gadl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386587 GeneID:73748 MGI:1920998
definition	codon_start : 1 product : glutamate decarboxylase-like 1 protein_id : XP_135211.6

name	LOC665772 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260400 GeneID:665772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 9 Proteins product : similar to ribosomal protein S17 pseudo : _no_value transcript_id : XR_034988.1

name	LOC670467 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260339 GeneID:670467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to glyceraldehyde-3-phosphate-dehydrogenase pseudo : _no_value transcript_id : XR_031057.1

clone name	MSMg01-151N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176M19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-353L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413D20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125G24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-277G23.b	B6Ng01-277G23.g
ACC	GA077956	GA077957
length	1,116	543
definition	B6Ng01-277G23.b	B6Ng01-277G23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,871,054 - 114,872,169)	(114,739,299 - 114,739,847)
sequence	gaattcaaggccatccccacctacatagggagttcaaggtcagactggga tatatgagaccttgcttaagaaaaagaaaaaaagaaggaaggtaagaagg aaaggaaaagaaaaactacagaaggattccactcccttctgtgtcaaagg aatgaacatacagaccaagaacttggtcaaactcaacaaggaccttatta tagcccattggcggccctgggaatctttatctttccacattggaagacac aggacctgcaagtgagctcagcaggtgaacttaccaccaagctggacagc tcagtttcactgaccctggggacccacttgatgaaaggagagaaatttag gtataaattttttgcagcctatttttaataatggttcaaccgtccctcca tcccacaacagcaaaagtagtggaagagaaaagttattaggatgtggggg aagtgaacctgacctggtcaacaatagttctttgggacagagctcgatct ttgacagcagttcagtcctttagcaaacaccagattcaactctgtggcta cagaccagctctctcggcaggcagacaccaggcccgaaccagcagctgtc gttcaatcctgaagaaaccatcaagctcaccaatggacctgaggtgaggc ctcagaactggcaagctgctgcaggaacctcacgagcagttcttgggcaa gtttctctcaatggcagagtgaccagagttgagctcaacaatgctatgta aggcgaaccaatacacgtgtgtcattagcaaagaataacgaggcggagca aaccaaaccaatgctcagtgctcgtttcccactgtctgtgggggtcatag ctatactccttcatcatgagtcctttcatgggtctgctatacccaaacat cctttcacctgtgagccccagcaaaacaacatttgacataattaactttc cacttcaaggactgtctcccatagtgtcctctgatagacacacacaacta aatagaataataactttttatatttatttttccccaaaagtttcagctat tgagggcataaatgaacactagaagcccagttccttggggttgaagcctg gccttgtgtccatcca	tgttccgttctacctcctctcccagttcctaaaaaaaaaaaaatatatat atatatatagttattttattaatattattgttattattgttattccgaag gagtgtttttatgtagcaaacgatgaccttgaactctgaggccctcttcc tctgcttgcatctccgagctgcaccaccctgctaggcctaaggtacccat tgctaaaggcatgccagaaaagccctcaggcaactgcactacatctccag cacacccctgccttcttttcaagattaaacaattctctctaaccacagga ctggaaaacggcaccatggaaacgctagctacctattcaataagtaaata aataaataactaatgccagcaggtgaaaaggttgcctgcagtttgggagc agcactaaatgagttcacccagaccagtagctcctccaaatgggagggac aaagagaggacgctggagactcgacctccagtgctcactgtgtgggcctg gtgagatggagcagtgccgaaaaccatcctgagggggtggaga
quality values	Open. Hide. 49 26 24 29 58 34 28 34 54 58 52 39 26 54 52 62 62 42 30 62 62 54 62 54 47 62 62 62 62 62 39 51 51 38 39 18 21 30 49 36 44 47 56 49 47 62 49 62 62 43 59 62 62 62 59 62 62 62 59 62 62 62 59 59 62 62 59 62 62 62 49 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 49 62 62 62 62 47 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 46 62 54 62 62 62 54 62 62 62 49 47 62 62 62 62 62 62 52 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 54 58 58 52 58 58 58 58 54 58 58 58 58 58 58 58 54 54 58 58 54 54 58 58 54 41 46 54 54 46 52 54 54 52 48 58 52 58 58 54 54 58 54 54 49 48 54 58 54 35 52 54 58 54 58 58 58 58 58 54 58 52 52 54 54 45 54 54 54 52 54 58 52 54 54 58 58 52 45 52 52 42 58 50 54 53 58 40 50 49 51 50 52 52 46 47 47 50 53 54 48 48 50 50 50 51 50 58 51 58 58 58 49 54 58 43 34 42 49 49 48 50 51 58 41 24 58 43 33 49 54 42 58 52 40 50 51 58 58 53 50 41 49 50 51 50 58 50 38 50 50 48 49 39 26 51 50 51 46 31 51 32 44 50 50 46 28 58 42 31 43 49 54 41 41 51 50 50 51 50 50 50 51 41 41 19 58 39 37 40 25 43 42 50 50 31 53 21 50 52 39 50 50 42 39 50 43 26 38 35 32 39 37 52 54 47 52 52 45 53 37 19 51 40 49 49 24 45 35 54 22 39 49 33 28 44 27 35 49 31 42 52 42 51 16 38 49 39 29 32 39 29 54 40 47 42 42 42 39 52 41 39 22 17 54 23 27 37 51 34 31 21 40 52 40 40 37 52 40 37 40 32 46 31 29 32 40 34 35 32 31 53 51 41 27 47 38 32 45 31 34 28 53 31 52 34 31 22 27 8 34 32 45 53 29 32 33 47 29 19 33 22 28 31 42 33 31 31 34 31 30 45 24 45 30 29 38 51 31 32 45 29 28 29 30 40 26 31 30 45 32 34 51 51 51 36 22 24 31 34 43 31 38 36 31 31 29 30 27 18 31 23 15 31 26 34 38 31 31 43 37 25 36 32 38 36 48 28 29 29 24 32 46 31 21 26 24 30 29 29 31 38 32 38 41 30 17 39 25 18 21 32 21 29 32 48 37 26 19 24 21 32 43 31 31 35 15 33 38 28 26 32 24 20 24 48 44 32 31 18 14 25 13 17 47 33 17 31 23 19 31 20 30 30 30 18 24 19 32 48 31 7 6 14 19 22 34 19 34 12 10 14 32 24 26 26 26 22 29 22 39 18 14 24 34 6 6 6 15 37 19 31 32 22 24 18 9 10 9 29 9 9 9 6 6 7 8 7 30 20 21 21 34 12 10 10 12 21 23 6 4 5 8 14 24 24 26 33 30 28 11 22 15 12 7 28 6 5 9 34 34 30 15 11 25 22 14 11 27 34 21 10 11 24 9 12 18 10 9 5 3 7 22 7 4 8 28 21 4 6 12 10 28 21 8 9 19 16 12 8 17 13 6 3 8 23 4 2 15 6 3 3 2 8 22 15 5 9 17 27 26 3 3 2 5 16 22 4 7 6 10 12 8 7 6 16 7 8 7 9 8 25 10 16 20 16 23 9	Open. Hide. 59 59 62 62 45 43 32 28 31 45 40 45 33 49 49 54 54 62 62 62 62 62 54 49 59 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 54 54 54 56 62 54 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 54 43 56 62 56 59 59 59 54 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 59 59 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 48 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 46 38 52 48 49 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 52 58 58 58 52 58 48 58 48 58 49 42 54 58 58 58 58 45 23 39 38 58 58 52 54 54 58 58 58 58 54 52 58 58 58 58 54 52 58 58 58 54 58 58 58 52 39 43 52 54 45 58 48 54 54 48 58 48 58 58 58 51 58 58 50 58 58 53 54 47 58 58 58 42 45 58 44 51 50 47 47 45 45 58 49 58 58 58 50 49 44 16 9 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_114871054_114872169
seq2: B6Ng01-277G23.b_48_1163 (reverse)

seq1  TGGATGG-CACAA-GCCAGGCTTCAAACCCCAGGGACCTTGGGCTTCTAG  48
      ||||||| ||||| |||||||||||| ||| ||| ||  |||||||||||
seq2  TGGATGGACACAAGGCCAGGCTTCAACCCCAAGGAAC--TGGGCTTCTAG  48

seq1  TGTTCATTTATGCCCTCAATAAGCTTGAACTTTTGGGGAAAAAT-AATAT  97
      |||||||||||||||||||| ||||  ||||||||||||||||| |||||
seq2  TGTTCATTTATGCCCTCAAT-AGCTGAAACTTTTGGGGAAAAATAAATAT  97

seq1  -AAAAGTTA-TATTCTATTTAGTTGTGTGTGTCTATCAGAGGACAACTAT  145
       |||||||| |||||||||||||||||||||||||||||||||| |||||
seq2  AAAAAGTTATTATTCTATTTAGTTGTGTGTGTCTATCAGAGGAC-ACTAT  146

seq1  GGGAGACAGTCCTTTGAAGTGGAAAGTTAATTATGTCAAATGTTGTTTTG  195
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  GGGAGACAGTCC-TTGAAGTGGAAAGTTAATTATGTCAAATGTTGTTTTG  195

seq1  CTGGGGCTCACAGGTGAAAGGATGTTTGGGTATAGCAGACCCATGAAAGG  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGCTCACAGGTGAAAGGATGTTTGGGTATAGCAGACCCATGAAAGG  245

seq1  ACTCATGATGAAGGAGTATAGCTATGACCCCCACAGACAGTGGGAAACGA  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATGATGAAGGAGTATAGCTATGACCCCCACAGACAGTGGGAAACGA  295

seq1  GCACTGAGCATTGGTTTGGTTTGCTCCGCCTCGTTATTCTTTGCTAATGA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGAGCATTGGTTTGGTTTGCTCCGCCTCGTTATTCTTTGCTAATGA  345

seq1  CACACGTGTATTGGTTCGCCTTACATAGCATTGTTGAGCTCAACTCTGGT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACGTGTATTGGTTCGCCTTACATAGCATTGTTGAGCTCAACTCTGGT  395

seq1  CACTCTGCCATTGAGAGAAACTTGCCCAAGAACTGCTCGTGAGGTTCCTG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTGCCATTGAGAGAAACTTGCCCAAGAACTGCTCGTGAGGTTCCTG  445

seq1  CAGCAGCTTGCCAGTTCTGAGGCCTCACCTCAGGTCCATTGGTGAGCTTG  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGCTTGCCAGTTCTGAGGCCTCACCTCAGGTCCATTGGTGAGCTTG  495

seq1  ATGGTTTCTTCAGGATTGAACGACAGCTGCTGGTTCGGGCCTGGTGTCTG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTTTCTTCAGGATTGAACGACAGCTGCTGGTTCGGGCCTGGTGTCTG  545

seq1  CCTGCCGAGAGAGCTGGTCTGTAGCCACAGAGTTGAATCTGGTGTTTGCT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCGAGAGAGCTGGTCTGTAGCCACAGAGTTGAATCTGGTGTTTGCT  595

seq1  AAAGGACTGAACTGCTGTCAAAGATCGAGCTCTGTCCCAAAGAACTATTG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGACTGAACTGCTGTCAAAGATCGAGCTCTGTCCCAAAGAACTATTG  645

seq1  TTGACCAGGTCAGGTTCACTTCCCCCACATCCTAATAACTTTTCTCTTCC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACCAGGTCAGGTTCACTTCCCCCACATCCTAATAACTTTTCTCTTCC  695

seq1  ACTACTTTTGCTGTTGTGGGATGGAGGGACGGTTGAACCATTATTAAAAA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACTTTTGCTGTTGTGGGATGGAGGGACGGTTGAACCATTATTAAAAA  745

seq1  TAGGCTGCAAAAAATTTATACCTAAATTTCTCTCCTTTCATCAAGTGGGT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCTGCAAAAAATTTATACCTAAATTTCTCTCCTTTCATCAAGTGGGT  795

seq1  CCCCAGGGTCAGTGAAACTGAGCTGTCCAGCTTGGTGGTAAGTTCACCTG  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGGGTCAGTGAAACTGAGCTGTCCAGCTTGGTGGTAAGTTCACCTG  845

seq1  CTGAGCTCACTTGCAGGTCCTGTGTCTTCCAATGTGGAAAGATAAAGATT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGCTCACTTGCAGGTCCTGTGTCTTCCAATGTGGAAAGATAAAGATT  895

seq1  CCCAGGGCCGCCAATGGGCTATAATAAGGTCCTTGTTGAGTTTGACCAAG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGGCCGCCAATGGGCTATAATAAGGTCCTTGTTGAGTTTGACCAAG  945

seq1  TTCTTGGTCTGTATGTTCATTCCTTTGACACAGAAGGGAGTGGAATCCTT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTGGTCTGTATGTTCATTCCTTTGACACAGAAGGGAGTGGAATCCTT  995

seq1  CTGTAGTTTTTCTTTTCCTTTCCTTCTTACCTTCCTTCTTTTTTTCTTTT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAGTTTTTCTTTTCCTTTCCTTCTTACCTTCCTTCTTTTTTTCTTTT  1045

seq1  TCTTAAGCAAGGTCTCATATATCCCAGTCTGACCTTGAACTCCCTATGTA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAAGCAAGGTCTCATATATCCCAGTCTGACCTTGAACTCCCTATGTA  1095

seq1  GGTGGGGATGGCCTTGAATTC  1116
      |||||||||||||||||||||
seq2  GGTGGGGATGGCCTTGAATTC  1116

seq1: chr9_114739299_114739847
seq2: B6Ng01-277G23.g_64_612

seq1  GAATTCTGTTCCGTTCTACCTCCTCTCCCAGTTCCTAAAAAAAAAAAAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTTCCGTTCTACCTCCTCTCCCAGTTCCTAAAAAAAAAAAAAT  50

seq1  ATATATATATATATAGTTATTTTATTAATATTATTGTTATTATTGTTATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATATATATATAGTTATTTTATTAATATTATTGTTATTATTGTTATT  100

seq1  CCGAAGGAGTGTTTTTATGTAGCAAACGATGACCTTGAACTCTGAGGCCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGAAGGAGTGTTTTTATGTAGCAAACGATGACCTTGAACTCTGAGGCCC  150

seq1  TCTTCCTCTGCTTGCATCTCCGAGCTGCACCACCCTGCTAGGCCTAAGGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTCTGCTTGCATCTCCGAGCTGCACCACCCTGCTAGGCCTAAGGT  200

seq1  ACCCATTGCTAAAGGCATGCCAGAAAAGCCCTCAGGCAACTGCACTACAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCATTGCTAAAGGCATGCCAGAAAAGCCCTCAGGCAACTGCACTACAT  250

seq1  CTCCAGCACACCCCTGCCTTCTTTTCAAGATTAAACAATTCTCTCTAACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGCACACCCCTGCCTTCTTTTCAAGATTAAACAATTCTCTCTAACC  300

seq1  ACAGGACTGGAAAACGGCACCATGGAAACGCTAGCTACCTATTCAATAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGACTGGAAAACGGCACCATGGAAACGCTAGCTACCTATTCAATAAG  350

seq1  TAAATAAATAAATAACTAATGCCAGCAGGTGAAAAGGTTGCCTGCAGTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATAAATAAATAACTAATGCCAGCAGGTGAAAAGGTTGCCTGCAGTTT  400

seq1  GGGAGCAGCACTAAATGAGTTCACCCAGACCAGTAGCTCCTCCAAATGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGCAGCACTAAATGAGTTCACCCAGACCAGTAGCTCCTCCAAATGGG  450

seq1  AGGGACAAAGAGAGGACGCTGGAGACTCGACCTCCAGTGCTCACTGTGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACAAAGAGAGGACGCTGGAGACTCGACCTCCAGTGCTCACTGTGTG  500

seq1  GGCCTGGTGAGATGGAGCAGTGCCGAAAACCATCCTGAGGGGGTGGAGA  549
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGGTGAGATGGAGCAGTGCCGAAAACCATCCTGAGGGGGTGGAGA  549

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information