MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-279L04
Chromosome	9 (Build37)
Map Location	20,418,155 - 20,544,806
singlet/doublet	doublet
Overlap gene	5730577I03Rik, Fbxl12, Ubl5, Pin1, Olfm2
Upstream gene	Zfp75, EG624341, LOC665751, Olfr857, Olfr858-ps1, Olfr58, Olfr859, Olfr860, GA_x5J8B7W6RL5-13004417-13003354, Olfr862, Olfr77, EG665823, Olfr863-ps1, Olfr864-ps1, Olfr865-ps1, Olfr866, Olfr867, Olfr868, Olfr869, Olfr870, Olfr871, Olfr872, Olfr39, Olfr873, Olfr18, Zfp560, 4921534A09Rik, EG624824, Zfp26, Zfp426, 5730601F06Rik, 7030419G21Rik, LOC100041205, 2210010B09Rik
Downstream gene	Col5a3, Rdh8, A230050P20Rik, Angptl6, Ppan, Eif3s4, Dnmt1, Edg5, Mrpl4, Icam1, Icam4, Icam5, Glp1, B230118G17Rik, Raver1, Tyk2, Cdc37, Pde4a, Keap1, Edg8, Atg4d, BC021438, Cdkn2d, Ap1m2, Slc44a2, Ilf3, Qtrt1, Dnm2, Tmed1, AB124611, Carm1, Yipf2, 1810026J23Rik, EG666043, Smarca4, Ldlr
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp75 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244713 MGI:107775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624341 MGI:3645477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2105 Proteins

name	LOC665751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Olfr857 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257963 MGI:3030691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr858-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258058 MGI:3030692
definition	gene_synonym : MOR146-6P note : olfactory receptor 858, pseudogene 1 pseudo : _no_value

name	Olfr58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18358 MGI:1333790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258519 MGI:3030693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258521 MGI:3030694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13004417-13003354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257718
definition	note : olfactory receptor GA_x5J8B7W6RL5-13004417-13003354 pseudo : _no_value

name	Olfr862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258555 MGI:3030696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr77 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258336 MGI:2153206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665823 MGI:3643360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 689 ESTs, 16 Proteins

name	Olfr863-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258070 MGI:3030697
definition	gene_synonym : MOR146-5P note : olfactory receptor 863, pseudogene 1 pseudo : _no_value

name	Olfr864-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258071 MGI:3030698
definition	gene_synonym : MOR146-4 note : olfactory receptor 864, pseudogene 1 pseudo : _no_value

name	Olfr865-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404438 MGI:3030699
definition	note : olfactory receptor 865, pseudogene 1 pseudo : _no_value

name	Olfr866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258551 MGI:3030700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257898 MGI:3030701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258552 MGI:3030702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr869 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258550 MGI:3030703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr870 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57251 MGI:3030704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258905 MGI:3030705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr872 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258553 MGI:3030706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258822 MGI:1313142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr873 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258554 MGI:3030707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18315 MGI:109317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434377 MGI:1915280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921534A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320674 MGI:2444504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG624824 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624824 MGI:3647240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22688 MGI:99173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235028 MGI:1920248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730601F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77519 MGI:1924769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 118 ESTs, 2 Proteins

name	7030419G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434378 MGI:3045384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC100041205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 227 ESTs, 2 Proteins pseudo : _no_value

name	2210010B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244721 MGI:1924012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730577I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66662 MGI:1913912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30843 MGI:1354738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ubl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66177 MGI:1913427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23988 MGI:1346036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244723 MGI:3045350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col5a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53867 MGI:1858212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235033 MGI:2685028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230050P20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319278 MGI:2441788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70726 MGI:1917976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppan (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235036 MGI:2178445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53356 MGI:1858258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13433 MGI:94912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14739 MGI:99569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66163 MGI:2137210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Icam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15894 MGI:96392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Icam4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78369 MGI:1925619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Icam5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15898 MGI:109430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100009600 MGI:3696042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	B230118G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68165 MGI:1915415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Raver1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71766 MGI:1919016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54721 MGI:1929470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12539 MGI:109531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18577 MGI:99558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Keap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50868 MGI:1858732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edg8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94226 MGI:2150641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235040 MGI:2444308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215194 MGI:2384899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdkn2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12581 MGI:105387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1m2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11768 MGI:1336974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc44a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68682 MGI:1915932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ilf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16201 MGI:1339973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Qtrt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60507 MGI:1931441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13430 MGI:109547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17083 MGI:106201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AB124611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382062 MGI:3043001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Carm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59035 MGI:1913208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yipf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74766 MGI:1922016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810026J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69773 MGI:1917023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666043 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666043 MGI:3648696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Smarca4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20586 MGI:88192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldlr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16835 MGI:96765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp75 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254382 GeneID:244713 MGI:107775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 75 transcript_id : NM_172918.3

name	EG624341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259839 GeneID:624341 MGI:3645477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2105 Proteins product : predicted gene, EG624341 transcript_id : XM_888877.3

name	Olfr857 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676578 GeneID:257963 MGI:3030691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 857 transcript_id : NM_001012265.1

name	Olfr58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520615 GeneID:18358 MGI:1333790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 58 transcript_id : NM_011001.2

name	Olfr859 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953179 GeneID:258519 MGI:3030693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 859 transcript_id : NM_146526.2

name	Olfr860 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239277 GeneID:258521 MGI:3030694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 860 transcript_id : NM_146528.1

name	Olfr862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129520 GeneID:258555 MGI:3030696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 862 transcript_id : NM_146562.1

name	Olfr77 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328370 GeneID:258336 MGI:2153206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 77 transcript_id : NM_146339.2

name	EG665823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259848 GeneID:665823 MGI:3643360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 689 ESTs, 16 Proteins product : predicted gene, EG665823 transcript_id : XM_979710.2

name	Olfr866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129524 GeneID:258551 MGI:3030700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 866 transcript_id : NM_146558.1

name	Olfr867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801283 GeneID:257898 MGI:3030701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 867 transcript_id : NM_001011748.1

name	Olfr868 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129518 GeneID:258552 MGI:3030702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 868 transcript_id : NM_146559.1

name	Olfr869 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170039 GeneID:258550 MGI:3030703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 869 transcript_id : NM_146557.1

name	Olfr870 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380660 GeneID:57251 MGI:3030704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 870 transcript_id : NM_146904.1

name	Olfr871 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129076 GeneID:258905 MGI:3030705
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 871 transcript_id : NM_146903.1

name	Olfr872 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170047 GeneID:258553 MGI:3030706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 872 transcript_id : NM_146560.1

name	Olfr39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129206 GeneID:258822 MGI:1313142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 39 transcript_id : NM_146825.1

name	Olfr873 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170043 GeneID:258554 MGI:3030707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 873 transcript_id : NM_146561.1

name	Olfr18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032326 GeneID:18315 MGI:109317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 18 transcript_id : NM_146563.1

name	Zfp560 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131087 GeneID:434377 MGI:1915280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 560 transcript_id : NM_001004190.3

name	4921534A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259843 GeneID:320674 MGI:2444504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4921534A09 gene transcript_id : XM_001474893.1

name	Zfp26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801412 GeneID:22688 MGI:99173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 26 transcript_id : NM_011753.2

name	Zfp426 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803273 GeneID:235028 MGI:1920248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 426 transcript_id : NM_146221.3

name	5730601F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259854 GeneID:77519 MGI:1924769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 118 ESTs, 2 Proteins product : RIKEN cDNA 5730601F06 gene transcript_id : XM_001475072.1

name	7030419G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259859 GeneID:434378 MGI:3045384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 7030419G21 gene transcript_id : XM_001475117.1

name	2210010B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938302 GeneID:244721 MGI:1924012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010B09 gene transcript_id : NM_172919.2

name	5730577I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378287 GeneID:66662 MGI:1913912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730577I03 gene transcript_id : NM_175110.4

name	Fbxl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57164956 GeneID:30843 MGI:1354738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 12 transcript_id : NM_001002846.1

name	Fbxl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57164954 GeneID:30843 MGI:1354738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 12 transcript_id : NM_013911.2

name	Ubl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801752 GeneID:66177 MGI:1913427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 5 transcript_id : NM_025401.3

name	Pin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543480 GeneID:23988 MGI:1346036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 transcript_id : NM_023371.2

name	Olfm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343362 GeneID:244723 MGI:3045350
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 2 transcript_id : NM_173777.2

name	Col5a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130822 GeneID:53867 MGI:1858212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type V, alpha 3 transcript_id : NM_016919.2

name	Rdh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71892411 GeneID:235033 MGI:2685028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 8 transcript_id : NM_001030290.1

name	A230050P20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28316793 GeneID:319278 MGI:2441788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230050P20 gene transcript_id : NM_175687.1

name	Angptl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130083 GeneID:70726 MGI:1917976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 6 transcript_id : NM_145154.2

name	Ppan (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704227 GeneID:235036 MGI:2178445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peter pan homolog (Drosophila) transcript_id : NM_145610.1

name	Eif3s4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131193 GeneID:53356 MGI:1858258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 4 (delta) transcript_id : NM_016876.3

name	Dnmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347401 GeneID:13433 MGI:94912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase (cytosine-5) 1 transcript_id : NM_010066.3

name	Edg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353436 GeneID:14739 MGI:99569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation, sphingolipid G-protein-coupled receptor, 5 transcript_id : NM_010333.3

name	Mrpl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508436 GeneID:66163 MGI:2137210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L4 transcript_id : NM_023167.2

name	Icam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30172560 GeneID:15894 MGI:96392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intercellular adhesion molecule transcript_id : NM_010493.2

name	Icam4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625821 GeneID:78369 MGI:1925619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intercellular adhesion molecule 4, Landsteiner-Wiener blood group transcript_id : NM_023892.2

name	Icam5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680336 GeneID:15898 MGI:109430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intercellular adhesion molecule 5, telencephalin transcript_id : NM_008319.1

name	Glp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259861 GeneID:100009600 MGI:3696042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : GATA-like 1 transcript_id : XM_001475715.1

name	B230118G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378689 GeneID:68165 MGI:1915415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230118G17 gene transcript_id : NM_001039824.2

name	Raver1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064853 GeneID:71766 MGI:1919016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleoprotein, PTB-binding 1 transcript_id : NM_027911.3

name	Tyk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922606 GeneID:54721 MGI:1929470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase 2 transcript_id : NM_018793.2

name	Cdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802152 GeneID:12539 MGI:109531
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 37 homolog (S. cerevisiae) transcript_id : NM_016742.3

name	Pde4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130753 GeneID:18577 MGI:99558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4A, cAMP specific transcript_id : NM_183408.2

name	Pde4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386992 GeneID:18577 MGI:99558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4A, cAMP specific transcript_id : NM_019798.3

name	Keap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387056 GeneID:50868 MGI:1858732
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like ECH-associated protein 1 transcript_id : NM_016679.3

name	Edg8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716488 GeneID:94226 MGI:2150641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 transcript_id : NM_053190.1

name	Atg4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368974 GeneID:235040 MGI:2444308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 4D (yeast) transcript_id : NM_153583.9

name	BC021438 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347239 GeneID:215194 MGI:2384899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021438 transcript_id : NM_145416.2

name	Cdkn2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981843 GeneID:12581 MGI:105387
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) transcript_id : NM_009878.2

name	Ap1m2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753071 GeneID:11768 MGI:1336974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-1, mu 2 subunit transcript_id : NM_009678.1

name	Slc44a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130134 GeneID:68682 MGI:1915932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 44, member 2 transcript_id : NM_152808.2

name	Ilf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607429 GeneID:16201 MGI:1339973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin enhancer binding factor 3 transcript_id : NM_010561.2

name	Ilf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607431 GeneID:16201 MGI:1339973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin enhancer binding factor 3 transcript_id : NM_001042707.1

name	Ilf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607433 GeneID:16201 MGI:1339973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin enhancer binding factor 3 transcript_id : NM_001042708.1

name	Ilf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607435 GeneID:16201 MGI:1339973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin enhancer binding factor 3 transcript_id : NM_001042709.1

name	Qtrt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11230787 GeneID:60507 MGI:1931441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : queuine tRNA-ribosyltransferase 1 transcript_id : NM_021888.1

name	Dnm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299636 GeneID:13430 MGI:109547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 2 transcript_id : NM_001039520.1

name	Tmed1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802999 GeneID:17083 MGI:106201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 domain containing 1 transcript_id : NM_010744.3

name	AB124611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45504366 GeneID:382062 MGI:3043001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AB124611 transcript_id : NM_206536.1

name	Carm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802093 GeneID:59035 MGI:1913208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coactivator-associated arginine methyltransferase 1 transcript_id : NM_021531.3

name	Yipf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19923858 GeneID:74766 MGI:1922016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 domain family, member 2 transcript_id : NM_138303.1

name	1810026J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475995 GeneID:69773 MGI:1917023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810026J23 gene transcript_id : NM_178619.3

name	Smarca4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253778 GeneID:20586 MGI:88192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 transcript_id : NM_011417.2

name	Ldlr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195699 GeneID:16835 MGI:96765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor transcript_id : NM_010700.2

name	Zfp75 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254383 CCDS:CCDS22862.1 GeneID:244713 MGI:107775
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 75 protein_id : NP_766506.3

name	EG624341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259840 GeneID:624341 MGI:3645477
definition	codon_start : 1 product : similar to olfactory receptor Olr1158 protein_id : XP_893970.3

name	Olfr857 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676579 GeneID:257963 MGI:3030691
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13452606-13453535; GA_x5J8B7W6RL5-13162713-13162216; olfactory receptor MOR146-8P product : olfactory receptor 857 protein_id : NP_001012265.1

name	Olfr58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828657 CCDS:CCDS22863.1 GeneID:18358 MGI:1333790
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR146-7P; GA_x6K02T2PVTD-13523015-13523944 product : olfactory receptor 58 protein_id : NP_035131.1

name	Olfr859 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953180 CCDS:CCDS22864.1 GeneID:258519 MGI:3030693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13548326-13549255; MOR146-10_p; olfactory receptor MOR146-3 product : olfactory receptor 859 protein_id : NP_666737.2

name	Olfr860 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239278 CCDS:CCDS22865.1 GeneID:258521 MGI:3030694
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13586614-13585661; olfactory receptor MOR146-2 product : olfactory receptor 860 protein_id : NP_666739.1

name	Olfr862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129521 CCDS:CCDS22866.1 GeneID:258555 MGI:3030696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13624132-13623212; olfactory receptor MOR146-1 product : olfactory receptor 862 protein_id : NP_666773.1

name	Olfr77 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129623 CCDS:CCDS22867.1 GeneID:258336 MGI:2153206
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR143-1; GA_x6K02T2PVTD-13660026-13660964 product : olfactory receptor 77 protein_id : NP_666451.1

name	EG665823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386017 GeneID:665823 MGI:3643360
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_984804.1

name	Olfr866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129525 CCDS:CCDS22868.1 GeneID:258551 MGI:3030700
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13768406-13767468; olfactory receptor MOR145-5 product : olfactory receptor 866 protein_id : NP_666769.1

name	Olfr867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801284 CCDS:CCDS22869.1 GeneID:257898 MGI:3030701
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13795933-13794938; olfactory receptor MOR143-2 product : olfactory receptor 867 protein_id : NP_001011748.1

name	Olfr868 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129519 CCDS:CCDS22870.1 GeneID:258552 MGI:3030702
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13841888-13842802; olfactory receptor MOR145-4 product : olfactory receptor 868 protein_id : NP_666770.1

name	Olfr869 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170040 CCDS:CCDS22871.1 GeneID:258550 MGI:3030703
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13878275-13879204; olfactory receptor MOR145-6 product : olfactory receptor 869 protein_id : NP_666768.1

name	Olfr870 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380661 CCDS:CCDS22872.1 GeneID:57251 MGI:3030704
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR141-1; GA_x6K02T2PVTD-13912679-13911744; olfactory receptor 72 product : olfactory receptor 870 protein_id : NP_667115.1

name	Olfr871 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129077 CCDS:CCDS22873.1 GeneID:258905 MGI:3030705
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-13952555-13953490; olfactory receptor MOR141-2 product : olfactory receptor 871 protein_id : NP_667114.1

name	Olfr872 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170048 CCDS:CCDS22874.1 GeneID:258553 MGI:3030706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13999915-14000844; olfactory receptor MOR145-3 product : olfactory receptor 872 protein_id : NP_666771.1

name	Olfr39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129207 CCDS:CCDS22875.1 GeneID:258822 MGI:1313142
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14025733-14026668 product : olfactory receptor 39 protein_id : NP_667036.1

name	Olfr873 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170044 CCDS:CCDS22876.1 GeneID:258554 MGI:3030707
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14040245-14041204; olfactory receptor MOR145-2 product : olfactory receptor 873 protein_id : NP_666772.1

name	Olfr18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032327 GeneID:18315 MGI:109317
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14054886-14053957 product : olfactory receptor 18 protein_id : NP_666774.1

name	Zfp560 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677614 CCDS:CCDS22877.1 GeneID:434377 MGI:1915280
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 560 protein_id : NP_001004190.2

name	4921534A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259844 GeneID:320674 MGI:2444504
definition	codon_start : 1 product : hypothetical protein LOC320674 protein_id : XP_001474943.1

name	Zfp26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249206 GeneID:22688 MGI:99173
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 81, related sequence 1 product : zinc finger protein 26 protein_id : NP_035883.1

name	Zfp426 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122781 GeneID:235028 MGI:1920248
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 68, related sequence 1 product : zinc finger protein 426 protein_id : NP_666333.1

name	5730601F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259855 GeneID:77519 MGI:1924769
definition	codon_start : 1 product : hypothetical protein LOC77519 protein_id : XP_001475122.1

name	7030419G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259860 GeneID:434378 MGI:3045384
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475167.1

name	2210010B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938303 CCDS:CCDS22878.1 GeneID:244721 MGI:1924012
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger product : hypothetical protein LOC244721 protein_id : NP_766507.2

name	5730577I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424713 GeneID:66662 MGI:1913912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66662 protein_id : NP_780319.1

name	Fbxl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57164955 CCDS:CCDS22880.1 GeneID:30843 MGI:1354738
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IPI] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1; F-box protein containing leucine repeats 12 product : F-box and leucine-rich repeat protein 12 isoform a protein_id : NP_038939.2

name	Fbxl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57164957 CCDS:CCDS22881.1 GeneID:30843 MGI:1354738
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IPI] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2; F-box protein containing leucine repeats 12 product : F-box and leucine-rich repeat protein 12 isoform b protein_id : NP_001002846.1

name	Ubl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384784 GeneID:66177 MGI:1913427
definition	GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-like 5 protein_id : NP_079677.1

name	Pin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963653 CCDS:CCDS22882.1 GeneID:23988 MGI:1346036
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP] codon_start : 1 product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 protein_id : NP_075860.1

name	Olfm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424647 GeneID:244723 MGI:3045350
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : olfactomedin 2 protein_id : NP_776138.1

name	Col5a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393173 CCDS:CCDS22883.1 GeneID:53867 MGI:1858212
definition	GO_component : GO:0005588 - collagen type V [Evidence IDA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence ISS] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence ISS]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : Pro-alpha3(V) product : procollagen, type V, alpha 3 protein_id : NP_058615.1

name	Rdh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892412 CCDS:CCDS22884.1 GeneID:235033 MGI:2685028
definition	GO_function : GO:0004745 - retinol dehydrogenase activity [Evidence IDA] GO_process : GO:0042572 - retinol metabolism [Evidence IDA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 product : retinol dehydrogenase 8 protein_id : NP_001025461.1

name	A230050P20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316794 CCDS:CCDS22885.1 GeneID:319278 MGI:2441788
definition	codon_start : 1 product : hypothetical protein LOC319278 protein_id : NP_783618.1

name	Angptl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699062 CCDS:CCDS22886.1 GeneID:70726 MGI:1917976
definition	GO_component : GO:0030141 - secretory granule [Evidence IDA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : Angiopoietin-related growth factor product : angiopoietin-related protein 5 protein_id : NP_660136.1

name	Ppan (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704228 CCDS:CCDS22887.1 GeneID:235036 MGI:2178445
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001560 - regulation of cell growth by extracellular stimulus [Evidence ISS] codon_start : 1 exception : mismatches in translation note : second-step splicing factor 1; suppressor of sterile four 1 product : peter pan homolog protein_id : NP_663585.1

name	Eif3s4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980808 GeneID:53356 MGI:1858258
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : translation initiation factor eIF3-p44; eiF3 delta; eukaryotic translation initiation factor 3, subunit 4 (delta, 44 kDa) product : eukaryotic translation initiation factor 3, subunit 4 (delta) protein_id : NP_058572.2

name	Dnmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347402 GeneID:13433 MGI:94912
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IDA] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IDA] GO_process : GO:0006306 - DNA methylation [Evidence IDA]; GO:0016458 - gene silencing [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : DNA methyltransferase (cytosine-5) 1 protein_id : NP_034196.3

name	Edg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45433562 CCDS:CCDS22888.1 GeneID:14739 MGI:99569
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007610 - behavior [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : lysophospholipid receptor B2; G-protein coupled receptor 13 product : endothelial differentiation, sphingolipid G-protein-coupled receptor, 5 protein_id : NP_034463.2

name	Mrpl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508437 GeneID:66163 MGI:2137210
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L4 protein_id : NP_075656.2

name	Icam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21389311 CCDS:CCDS22889.1 GeneID:15894 MGI:96392
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA]; GO:0016337 - cell-cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0030155 - regulation of cell adhesion [Evidence IDA] codon_start : 1 product : intercellular adhesion molecule protein_id : NP_034623.1

name	Icam4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963855 CCDS:CCDS22890.1 GeneID:78369 MGI:1925619
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : LW glycoprotein protein_id : NP_076381.1

name	Icam5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680337 CCDS:CCDS22891.1 GeneID:15898 MGI:109430
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : intercellular adhesion molecule 3 product : intercellular adhesion molecule 5, telencephalin protein_id : NP_032345.1

name	Glp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259862 GeneID:100009600 MGI:3696042
definition	codon_start : 1 product : similar to GATA-like protein 1 protein_id : XP_001475765.1

name	B230118G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90017457 CCDS:CCDS22892.1 GeneID:68165 MGI:1915415
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68165 protein_id : NP_001034913.1

name	Raver1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789209 GeneID:71766 MGI:1919016
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : Raver1 protein_id : NP_082187.1

name	Tyk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922607 GeneID:54721 MGI:1929470
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004718 - Janus kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : tyrosine kinase TYK2 product : tyrosine kinase 2 protein_id : NP_061263.2

name	Cdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949018 CCDS:CCDS22894.1 GeneID:12539 MGI:109531
definition	GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : cell division cycle 37 homolog protein_id : NP_058022.1

name	Pde4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41282015 CCDS:CCDS22895.1 GeneID:18577 MGI:99558
definition	GO_function : GO:0004115 - 3',5'-cyclic-AMP phosphodiesterase activity [Evidence ISS]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; dunce; cyclic AMP specific phosphodiesterase PDE4A5A product : phosphodiesterase 4A, cAMP specific isoform 5 protein_id : NP_899668.1

name	Pde4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938035 CCDS:CCDS22896.1 GeneID:18577 MGI:99558
definition	GO_function : GO:0004115 - 3',5'-cyclic-AMP phosphodiesterase activity [Evidence ISS]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; dunce; cyclic AMP specific phosphodiesterase PDE4A5A product : phosphodiesterase 4A, cAMP specific isoform 1 protein_id : NP_062772.2

name	Keap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710044 CCDS:CCDS22897.1 GeneID:50868 MGI:1858732
definition	GO_component : GO:0005737 - cytoplasm [Evidence IPI]; GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IMP] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0045604 - regulation of epidermal cell differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ring canal protein; NRF2 cytosolic inhibitor product : kelch-like ECH-associated protein 1 protein_id : NP_057888.1

name	Edg8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716489 CCDS:CCDS22898.1 GeneID:94226 MGI:2150641
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : sphingosine-1-phosphate receptor LPB4 product : endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 protein_id : NP_444420.1

name	Atg4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29135261 CCDS:CCDS22899.1 GeneID:235040 MGI:2444308
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0005875 - microtubule associated complex [Evidence ISS] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence ISS]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0000045 - autophagic vacuole formation [Evidence ISS]; GO:0006914 - autophagy [Evidence ISS] [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006612 - protein targeting to membrane [Evidence ISS]; GO:0006623 - protein targeting to vacuole [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : cysteine protease involved in autophagy APG4-D; autophagy-related 4D-like; AUT-like 4, cysteine endopeptidase; APG4 (ATG4) autophagy-related homolog D product : APG4-D protein protein_id : NP_705811.8

name	BC021438 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703830 GeneID:215194 MGI:2384899
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC215194 protein_id : NP_663391.1

name	Cdkn2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981844 CCDS:CCDS22901.1 GeneID:12581 MGI:105387
definition	GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 product : cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) protein_id : NP_034008.2

name	Ap1m2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753072 CCDS:CCDS22902.1 GeneID:11768 MGI:1336974
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : adaptor-related protein complex AP-1, mu 2 subunit product : adaptor protein complex AP-1, mu 2 subunit protein_id : NP_033808.1

name	Slc44a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779895 CCDS:CCDS22903.1 GeneID:68682 MGI:1915932
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 44, member 2 protein_id : NP_690021.1

name	Ilf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607430 GeneID:16201 MGI:1339973
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006479 - protein amino acid methylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; nuclear factor 90; snoRNA MBII-26 product : interleukin enhancer binding factor 3 isoform 1 protein_id : NP_034691.2

name	Ilf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607432 GeneID:16201 MGI:1339973
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006479 - protein amino acid methylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; nuclear factor 90; snoRNA MBII-26 product : interleukin enhancer binding factor 3 isoform 2 protein_id : NP_001036172.1

name	Ilf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607434 GeneID:16201 MGI:1339973
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006479 - protein amino acid methylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; nuclear factor 90; snoRNA MBII-26 product : interleukin enhancer binding factor 3 isoform 3 protein_id : NP_001036173.1

name	Ilf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607436 GeneID:16201 MGI:1339973
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006479 - protein amino acid methylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; nuclear factor 90; snoRNA MBII-26 product : interleukin enhancer binding factor 3 isoform 4 protein_id : NP_001036174.1

name	Qtrt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230788 GeneID:60507 MGI:1931441
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008479 - queuine tRNA-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008616 - queuosine biosynthesis [Evidence IEA]; GO:0006400 - tRNA modification [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : tRNA-guanine transglycosylase protein_id : NP_068688.1

name	Dnm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299637 GeneID:13430 MGI:109547
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : dynamin 2 protein_id : NP_001034609.1

name	Tmed1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362703 CCDS:CCDS22904.1 GeneID:17083 MGI:106201
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : lymphocyte antigen 84 ligand; interleukin 1 receptor-like 1 ligand product : transmembrane emp24 domain containing 1 protein_id : NP_034874.2

name	AB124611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45504367 CCDS:CCDS22905.1 GeneID:382062 MGI:3043001
definition	codon_start : 1 note : HIDE1 product : hypothetical protein LOC382062 protein_id : NP_996259.1

name	Carm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50511310 CCDS:CCDS22906.1 GeneID:59035 MGI:1913208
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008469 - histone-arginine N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008276 - protein methyltransferase activity [Evidence IDA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0016571 - histone methylation [Evidence IDA]; GO:0006479 - protein amino acid methylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : methylates histone 3 note : protein arginine methyltransferase; protein arginine N-methyltransferase 4 product : coactivator-associated arginine methyltransferase 1 protein_id : NP_067506.2

name	Yipf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923859 CCDS:CCDS22907.1 GeneID:74766 MGI:1922016
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Yip1 domain family, member 2 protein_id : NP_612176.1

name	1810026J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519953 CCDS:CCDS22908.1 GeneID:69773 MGI:1917023
definition	codon_start : 1 product : hypothetical protein LOC69773 protein_id : NP_848734.1

name	Smarca4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253779 CCDS:CCDS22909.1 GeneID:20586 MGI:88192
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016514 - SWI/SNF complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence TAS]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0001832 - blastocyst growth [Evidence IMP]; GO:0001835 - blastocyst hatching [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007403 - glial cell fate determination [Evidence IMP]; GO:0030902 - hindbrain development [Evidence IMP]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006334 - nucleosome assembly [Evidence TAS] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 protein_id : NP_035547.2

name	Ldlr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195700 CCDS:CCDS22910.1 GeneID:16835 MGI:96765
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0005768 - endosome [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0008034 - lipoprotein binding [Evidence ISS]; GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA] [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006897 - endocytosis [Evidence IEA] [Evidence ISS]; GO:0006629 - lipid metabolism [Evidence ISS] [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : low density lipoprotein receptor protein_id : NP_034830.2

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 6 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 5 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 4 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 3 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 2 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 1 pseudo : _no_value

name	LOC665751 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259841 GeneID:665751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP2 isoform alpha pseudo : _no_value transcript_id : XR_031834.1

name	LOC100041205 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259858 GeneID:100041205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 227 ESTs, 2 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_032078.1

name	EG666043 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:130490510 GeneID:666043 MGI:3648696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666043 pseudo : _no_value transcript_id : NR_003372.1

clone name	MSMg01-509I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-486D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-057K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-278L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052A06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-439I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-279L04.b	B6Ng01-279L04.g
ACC	GA079615	GA079616
length	1,140	613
definition	B6Ng01-279L04.b	B6Ng01-279L04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(20,543,684 - 20,544,806)	(20,418,155 - 20,418,766)
sequence	gaattcactctgtagacctggctgtcctcgaagtcacagaactctgccag cctcagcccccgtagtgctaggattaaaggcgtgcgccaccaccctctgg ctttattttgtttttaaattttaatcacatttatttatttaggaagggga gagttcttagcttggtgcccacaggaagtcagagatgtcaaggttagacg acaacttcgggggtcagttctctctttcactgtttggaactcaggtcttc aggtttggcgccaagctaccttagtctctgaatcttctcacctgcatcac ttcgtgttgttgagagaggatctttcactggcctggagcttaccaagtac gggactgggtatggtcaccctagggctgacagattttctcacatccagag aaccaagaatccacactaagcacagggtggcagcagccccaatacgcttg gtacatctgtgcctcaggctagtctaagaggaagcaggaaacacctgagt ggagctaagagattgggtgaggtgtgtttggaaagctgttcacctgaaca ccagtaaacttagagtctctggctcctgccccgctcctccccaccccgtt cctcccccccccacgcccgtgtgtaggtatgtgtatgttagcatgtatgt ggccaagtgtgcatctgaaggccagaggttggcatctgtggtcttcctag gttgctttctattgtatgttttggcgtgatctgtccacgtacttggaaca tgctgctctggttagtctagcagggcagctctctctgaagttcctattcc caccatgtgagtgctgaggttctacgcagcccacgcccacctgacattta cacgggctttggggaatcagaactcaggtcttcatacttcatgtggcaag cacttttacccactgaaccatttcattttattttacccgagtgtgagcgt gtgtcttgattctggccggccagaaggacagcgtgcaagaagtttgttct ctctcttaccattatggggtctaggctaggactcagtcggcagtcttagc agcaatctcctttactctgctaggcatcctgcaagccctgtaccaccagt ctatgaatctgtactactggatgccaagtccttacttaga	gaattcataggtagaaaattaacacaaatgagaattatttagagaaatgg cattctctttacaaaagaaatctgtctttgatattttaatatggtgaata ctgtcaatttttgcttaaaagtttgggtttcatcacaaaacttgaagtgc cagggtgggggaatactagggggtcatcgacccactcagaggaaagggga atgggaatggggaaggattatgggcagcggggaccaggacaggcgaagtg agcaggatgtaaagtgaacaagtaaaaatatataattttataaaacaaaa caaataaataaaaaccctaacgacctcaaaataaatgtgggagagtgaga gagagagagagagagagagagagagagagagagagagagatatactttcc taaaacttgattttccaagtccatggatgggcttacatgtttcagaagcc tgtctaatgtatgataaagcaaaaaatgactgtcaatagacatatttcta catgggttcaatgaaaatatgcaccagtggcatgggcaatagatttattg atctctcaatgtaaaatctacaaaaatatgattgaataatacttttggaa aaattgagtacag
quality values	Open. Hide. 9 10 4 8 12 10 8 30 41 52 48 62 44 56 39 47 47 62 62 38 62 62 62 62 62 62 62 62 62 22 32 27 21 36 45 29 34 24 27 43 62 62 62 62 62 62 62 59 46 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 54 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 43 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 42 62 62 62 62 62 62 54 62 62 52 62 49 47 42 62 62 62 62 62 62 62 46 62 52 58 58 58 58 58 58 58 58 58 58 58 47 54 58 58 58 58 58 46 54 58 58 58 58 54 54 52 54 58 54 54 54 58 58 58 54 58 58 54 49 58 54 58 54 58 54 54 58 58 54 58 54 58 54 58 54 58 58 58 52 54 45 52 58 54 54 54 54 49 52 54 58 58 58 58 58 46 51 58 49 58 58 54 58 58 47 58 58 58 50 58 35 58 54 58 49 54 58 54 58 58 51 41 58 52 41 42 51 54 58 50 50 54 58 51 40 58 50 50 51 54 58 53 53 53 58 54 58 30 29 46 28 49 51 50 54 52 51 48 29 49 50 49 49 43 26 40 46 27 50 39 35 39 9 58 35 48 50 54 40 50 50 52 50 58 50 43 58 34 53 51 58 51 50 35 43 17 58 37 15 47 32 58 33 33 41 39 52 50 49 54 39 40 38 51 31 58 54 50 49 54 42 49 53 45 33 32 32 51 51 40 45 38 34 39 49 44 26 38 54 30 26 54 36 53 38 37 47 52 45 39 45 42 45 38 52 45 46 19 36 30 24 41 40 32 39 32 42 28 9 42 25 30 42 25 52 53 32 52 47 47 33 37 38 41 33 13 37 46 21 38 29 19 30 53 25 51 47 31 28 17 19 25 34 32 34 46 18 40 45 31 40 29 27 24 53 26 32 31 31 32 53 29 32 26 9 30 39 36 26 14 14 30 30 22 23 12 14 34 30 31 8 22 42 30 24 16 15 12 31 6 33 11 22 13 46 30 29 42 46 11 30 43 28 30 26 16 31 32 28 30 29 18 17 46 28 31 44 26 31 9 10 14 25 12 41 10 10 27 42 36 33 31 30 38 28 30 26 32 8 6 46 48 7 10 19 9 12 18 21 30 27 11 16 8 6 14 22 46 44 18 22 26 48 48 18 31 22 36 36 24 23 31 38 31 8 38 13 24 19 14 16 19 15 31 21 18 27 19 23 24 16 16 6 9 31 13 48 25 29 16 33 8 16 20 21 14 23 22 6 11 11 22 11 17 5 13 17 22 21 15 18 7 8 7 7 7 28 10 18 36 7 17 4 11 33 16 31 22 33 9 28 10 33 29 24 24 23 18 8 10 6 30 14 27 7 6 5 14 13 9 11 6 5 8 8 5 34 14 27 24 6 5 3 7 7 5 24 6 5 3 4 12 24 11 5 9 11 16 12 12 9 15 12 10 8 25 13 19 21 10 9 10 6 7 18 7 8 18 5 6 21 6 13 5 6 15 9 9 4 5 11 17 25 17 11 4 16 5 4 7 8 1 3 13 4 3 2 6 13 3 8 8 15 11 4 5 8 5 15 10 16 21 21 16 17 14 3 6 6 9 14 8 7 5 3 7 18 4 7 5 5 3 6 2 1 2	Open. Hide. 62 47 31 47 62 47 47 62 54 62 62 62 56 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 46 62 62 62 62 54 42 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 59 62 59 62 59 62 59 62 62 59 59 62 59 59 59 59 56 62 56 62 59 62 62 59 62 56 59 56 46 50 56 45 36 38 44 43 43 39 50 43 43 40 40 51 43 51 46 43 43 38 34 28 36 17 13 13 24 19 16 22 34 45 43 24 37 30 39 39 30 45 59 50 44 43 43 24 16 56 24 10 27 22 32 42 32 42 39 37 37 39 51 24 30 29 36 31 32 37 38 50 37 24 22 14 17 16 10 10 14 11 10 10 31 56 31 33 31 21 27 42 18 39 31 23 31 30 39 27 38 30 31 37 47 27 34 33 28 20 22 22 28 21 32 28 28 32 43 32 28 56 31 30 20 13 9 20 20 20 15 17 23 18 27 42 23 14 35 35 24 31 35 27 24 9 21 24 33 26 27 27 33 43 33 43 35 31 34 19 32 30 28 21 43 15 6 27 32 22 33 28 21 21 21 17 33 17 13 23 17 20 27 23 27 21 16 27 33 25 27 26 25 16 15 24 30 42 24 18 22 19 12 10 12 16 16 18 10 13 12 5 17 23 30 29 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_20543684_20544806
seq2: B6Ng01-279L04.b_59_1186 (reverse)

seq1  TCTAAGT-AGGACTTGGCATCCAGTAGTACAGATCATTAGAACTGTGTGT  49
      ||||||| ||||||||||||||||||||||||||   ||| |||| ||| 
seq2  TCTAAGTAAGGACTTGGCATCCAGTAGTACAGATTCATAG-ACTG-GTGG  48

seq1  AAAGGGGCTGGCAAGATGGCTTAGCAG-GTAAAGGAGATTGCTGCTAAGA  98
       |  ||||| ||| ||| || |||||| ||||||||||||||||||||||
seq2  TACAGGGCTTGCAGGAT-GCCTAGCAGAGTAAAGGAGATTGCTGCTAAGA  97

seq1  CTGGCGACCTGAGTTCTAGCCCTAGAACCCAT-ATGGTAAGAGGAGAGAA  147
      ||| ||| |||||| |||| |||||| ||||| ||||||||| |||||||
seq2  CTGCCGA-CTGAGTCCTAG-CCTAGACCCCATAATGGTAAGA-GAGAGAA  144

seq1  CCAAC-TCCTGCACGCTGTCC-TCTGGCC-GCCAGAATC-AGACACACGC  193
      | ||| || |||||||||||| ||||||| ||||||||| ||||||||||
seq2  CAAACTTCTTGCACGCTGTCCTTCTGGCCGGCCAGAATCAAGACACACGC  194

seq1  TCACACTCGGGTAAA--TAAATGAAATGGTTCAGTGGGT-AAAGTGCTTG  240
      |||||||||||||||   ||||||||||||||||||||| ||||||||||
seq2  TCACACTCGGGTAAAATAAAATGAAATGGTTCAGTGGGTAAAAGTGCTTG  244

seq1  CCACATGAAGTATGAAGACCTGAGTTCTGATT-CCCAAAGCCCGTGTAAA  289
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  CCACATGAAGTATGAAGACCTGAGTTCTGATTCCCCAAAGCCCGTGTAAA  294

seq1  TGTCAGGTGGGCGTGGGCTGCGTAGAACCTCAGCACTCACATGGTGGGAA  339
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAGGTGGGCGTGGGCTGCGTAGAACCTCAGCACTCACATGGTGGGAA  344

seq1  TAGGAACTTCAGAGAGAGCTGCCCTGCTAGACTAACCAGAGCAGCATGTT  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGAACTTCAGAGAGAGCTGCCCTGCTAGACTAACCAGAGCAGCATGTT  394

seq1  CCAAGTACGTGGACAGATCACGCCAAAACATACAATAGAAAGCAACCTAG  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGTACGTGGACAGATCACGCCAAAACATACAATAGAAAGCAACCTAG  444

seq1  GAAGACCACAGATGCCAACCTCTGGCCTTCAGATGCACACTTGGCCACAT  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGACCACAGATGCCAACCTCTGGCCTTCAGATGCACACTTGGCCACAT  494

seq1  ACATGCTAACATACACATACCTACACACGGGCGTGGGGGGGGGAGGAACG  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGCTAACATACACATACCTACACACGGGCGTGGGGGGGGGAGGAACG  544

seq1  GGGTGGGGAGGAGCGGGGCAGGAGCCAGAGACTCTAAGTTTACTGGTGTT  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGGGGAGGAGCGGGGCAGGAGCCAGAGACTCTAAGTTTACTGGTGTT  594

seq1  CAGGTGAACAGCTTTCCAAACACACCTCACCCAATCTCTTAGCTCCACTC  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTGAACAGCTTTCCAAACACACCTCACCCAATCTCTTAGCTCCACTC  644

seq1  AGGTGTTTCCTGCTTCCTCTTAGACTAGCCTGAGGCACAGATGTACCAAG  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTTTCCTGCTTCCTCTTAGACTAGCCTGAGGCACAGATGTACCAAG  694

seq1  CGTATTGGGGCTGCTGCCACCCTGTGCTTAGTGTGGATTCTTGGTTCTCT  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTATTGGGGCTGCTGCCACCCTGTGCTTAGTGTGGATTCTTGGTTCTCT  744

seq1  GGATGTGAGAAAATCTGTCAGCCCTAGGGTGACCATACCCAGTCCCGTAC  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGTGAGAAAATCTGTCAGCCCTAGGGTGACCATACCCAGTCCCGTAC  794

seq1  TTGGTAAGCTCCAGGCCAGTGAAAGATCCTCTCTCAACAACACGAAGTGA  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTAAGCTCCAGGCCAGTGAAAGATCCTCTCTCAACAACACGAAGTGA  844

seq1  TGCAGGTGAGAAGATTCAGAGACTAAGGTAGCTTGGCGCCAAACCTGAAG  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGGTGAGAAGATTCAGAGACTAAGGTAGCTTGGCGCCAAACCTGAAG  894

seq1  ACCTGAGTTCCAAACAGTGAAAGAGAGAACTGACCCCCGAAGTTGTCGTC  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGAGTTCCAAACAGTGAAAGAGAGAACTGACCCCCGAAGTTGTCGTC  944

seq1  TAACCTTGACATCTCTGACTTCCTGTGGGCACCAAGCTAAGAACTCTCCC  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCTTGACATCTCTGACTTCCTGTGGGCACCAAGCTAAGAACTCTCCC  994

seq1  CTTCCTAAATAAATAAATGTGATTAAAATTTAAAAACAAAATAAAGCCAG  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTAAATAAATAAATGTGATTAAAATTTAAAAACAAAATAAAGCCAG  1044

seq1  AGGGTGGTGGCGCACGCCTTTAATCCTAGCACTACGGGGGCTGAGGCTGG  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGGTGGCGCACGCCTTTAATCCTAGCACTACGGGGGCTGAGGCTGG  1094

seq1  CAGAGTTCTGTGACTTCGAGGACAGCCAGGTCTA  1123
      ||||||||||||||||||||||||||||||||||
seq2  CAGAGTTCTGTGACTTCGAGGACAGCCAGGTCTA  1128

seq1: chr9_20418155_20418766
seq2: B6Ng01-279L04.g_63_675

seq1  GAATTCATAGGTAGAAAATTAACACAAATGAGAATTATTTAGAGAAATGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATAGGTAGAAAATTAACACAAATGAGAATTATTTAGAGAAATGG  50

seq1  CATTCTCTTTACAAAAGAAATCTGTCTTTGATATTTTAATATGGTGAATA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTCTTTACAAAAGAAATCTGTCTTTGATATTTTAATATGGTGAATA  100

seq1  CTGTCAATTTTTGCTTAAAAGTTTGGGTTTCATCACAAAACTTGAAGTGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCAATTTTTGCTTAAAAGTTTGGGTTTCATCACAAAACTTGAAGTGC  150

seq1  CAGGGTGGGGGAATACTAGGGGGTCATCGACCCACTCAGAGGAAAGGGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTGGGGGAATACTAGGGGGTCATCGACCCACTCAGAGGAAAGGGGA  200

seq1  ATGGGAATGGGGAAGGATTATGGGCAGCGGGGACCAGGACAGGCGAAGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGAATGGGGAAGGATTATGGGCAGCGGGGACCAGGACAGGCGAAGTG  250

seq1  AGCAGGATGTAAAGTGAACAAGTAAAAATATATAATTTTATAAAACAAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGATGTAAAGTGAACAAGTAAAAATATATAATTTTATAAAACAAAA  300

seq1  CAAATAAATAAAAACCCTAACGACCTCAAAATAAATGTGGGAGAGTGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATAAATAAAAACCCTAACGACCTCAAAATAAATGTGGGAGAGTGAGA  350

seq1  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGATATACTTTCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGATATACTTTCC  400

seq1  TAAAACTTGATTTTCCAAGTCCATGGATGGGCTTACATGTTTCAGAAGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACTTGATTTTCCAAGTCCATGGATGGGCTTACATGTTTCAGAAGCC  450

seq1  TGTCTAATGTATGATAAAGCAAAAAATAACTGTCAATAGACATATTTCTA  500
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  TGTCTAATGTATGATAAAGCAAAAAATGACTGTCAATAGACATATTTCTA  500

seq1  CATGGGTTCAATGAAAATATGCACCAGTGGCATGGGCAATAGATTTATTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGTTCAATGAAAATATGCACCAGTGGCATGGGCAATAGATTTATTG  550

seq1  ATCTCTCAATGTAAAATCTACAAAAATATGATTGAATAATAC-TTTGGAT  599
      |||||||||||||||||||||||||||||||||||||||||| |||||| 
seq2  ATCTCTCAATGTAAAATCTACAAAAATATGATTGAATAATACTTTTGGAA  600

seq1  AAATTGAGTACAG  612
      |||||||||||||
seq2  AAATTGAGTACAG  613

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information