MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-309J05
Chromosome	9 (Build37)
Map Location	63,271,822 - 63,391,666
singlet/doublet	doublet
Overlap gene	Iqch, LOC621763
Upstream gene	Coro2b, Itga11, EG665478, Fem1b, Cln6, Calml4, Pias1, LOC100039976, Ppia-ps9_818.1, Lbxcor1, Map2k5, 2300009A05Rik
Downstream gene	2310007F21Rik, Smad3, LOC100040009, Smad6, 2600006L11Rik, Lctl, Zwilch, Rpl4, Snapc5, Map2k1, Uchl4, Tipin, Dis3l, Megf11
Link	Open Mouse BAC browser

Click to get alignment info.

name	Coro2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235431 MGI:2444283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319480 MGI:2442114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665478 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665478 MGI:3643729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Fem1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14155 MGI:1335087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cln6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76524 MGI:2159324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75600 MGI:1922850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pias1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56469 MGI:1913125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppia-ps9_818.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606730
definition	note : peptidylprolyl isomerase A (Ppia) pseudogene 9_818.1 pseudo : _no_value

name	Lbxcor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207667 MGI:2443473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23938 MGI:1346345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2300009A05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69478 MGI:1916728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs, 2 Proteins

name	Iqch (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78250 MGI:1925500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins

name	LOC621763 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 46 ESTs, 3 Proteins pseudo : _no_value

name	2310007F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66939 MGI:1914189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smad3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17127 MGI:1201674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040009 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Smad6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17130 MGI:1336883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2600006L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76814 MGI:1924064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Lctl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235435 MGI:2183549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zwilch (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68014 MGI:1915264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67891 MGI:1915141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snapc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330959 MGI:1914282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26395 MGI:1346866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uchl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93841 MGI:1890440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tipin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66131 MGI:1921571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dis3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213550 MGI:2143272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Megf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214058 MGI:1920951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803424 GeneID:235431 MGI:2444283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein, 2B transcript_id : NM_175484.2

name	Itga11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254394 GeneID:319480 MGI:2442114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha 11 transcript_id : NM_176922.4

name	Fem1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402518 GeneID:14155 MGI:1335087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : feminization 1 homolog b (C. elegans) transcript_id : NM_010193.3

name	Cln6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372439 GeneID:76524 MGI:2159324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ceroid-lipofuscinosis, neuronal 6 transcript_id : NM_001033175.2

name	Calml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129956 GeneID:75600 MGI:1922850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin-like 4 transcript_id : NM_138304.2

name	Pias1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361261 GeneID:56469 MGI:1913125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 1 transcript_id : NM_019663.3

name	Lbxcor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383959 GeneID:207667 MGI:2443473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ladybird homeobox 1 homolog (Drosophila) corepressor 1 transcript_id : NM_172446.2

name	Map2k5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130017 GeneID:23938 MGI:1346345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 5 transcript_id : NM_011840.2

name	2300009A05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386166 GeneID:69478 MGI:1916728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein product : RIKEN cDNA 2300009A05 gene, transcript variant 3 transcript_id : XM_898537.2

name	2300009A05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386167 GeneID:69478 MGI:1916728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 1 Protein product : RIKEN cDNA 2300009A05 gene, transcript variant 1 transcript_id : XM_204313.6

name	Iqch (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386168 GeneID:78250 MGI:1925500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins product : IQ motif containing H, transcript variant 1 transcript_id : XM_134960.5

name	Iqch (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260023 GeneID:78250 MGI:1925500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 1 Protein product : IQ motif containing H transcript_id : XM_001475908.1

name	2310007F21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802812 GeneID:66939 MGI:1914189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310007F21 gene transcript_id : NM_025857.2

name	Smad3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801800 GeneID:17127 MGI:1201674
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAD homolog 3 (Drosophila) transcript_id : NM_016769.3

name	Smad6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560672 GeneID:17130 MGI:1336883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAD homolog 6 (Drosophila) transcript_id : NM_008542.2

name	2600006L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260001 GeneID:76814 MGI:1924064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2600006L11 gene transcript_id : XM_001473989.1

name	Lctl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802015 GeneID:235435 MGI:2183549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactase-like transcript_id : NM_145835.2

name	Zwilch (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71143133 GeneID:68014 MGI:1915264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Zwilch, kinetochore associated, homolog (Drosophila) transcript_id : NM_026507.3

name	Rpl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374582 GeneID:67891 MGI:1915141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L4 transcript_id : NM_024212.3

name	Snapc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681193 GeneID:330959 MGI:1914282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear RNA activating complex, polypeptide 5 transcript_id : NM_183316.2

name	Map2k1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372689 GeneID:26395 MGI:1346866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 1 transcript_id : NM_008927.3

name	Uchl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809025 GeneID:93841 MGI:1890440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin carboxyl-terminal esterase L4 transcript_id : NM_033607.1

name	Tipin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385283 GeneID:66131 MGI:1921571
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : timeless interacting protein transcript_id : NM_025372.2

name	Dis3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47604967 GeneID:213550 MGI:2143272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIS3 mitotic control homolog (S. cerevisiae)-like transcript_id : NM_001001295.1

name	Dis3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130012 GeneID:213550 MGI:2143272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIS3 mitotic control homolog (S. cerevisiae)-like transcript_id : NM_172519.2

name	Megf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362961 GeneID:214058 MGI:1920951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : multiple EGF-like-domains 11 transcript_id : NM_172522.2

name	Coro2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202047 CCDS:CCDS23264.1 GeneID:235431 MGI:2444283
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] codon_start : 1 note : KIAA0925-like; E130012P22 product : coronin, actin binding protein, 2B protein_id : NP_780693.1

name	Itga11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254395 CCDS:CCDS23265.1 GeneID:319480 MGI:2442114
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006929 - substrate-bound cell migration [Evidence IMP] codon_start : 1 exception : mismatches in translation note : integrin a11 product : integrin alpha 11 protein_id : NP_795896.3

name	Fem1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753840 CCDS:CCDS23266.1 GeneID:14155 MGI:1335087
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : feminization 1 homolog b protein_id : NP_034323.1

name	Cln6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677520 CCDS:CCDS23267.1 GeneID:76524 MGI:2159324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0031987 - locomotion during locomotory behavior [Evidence IMP]; GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : neuronal ceroid lipofuscinosis product : ceroid-lipofuscinosis, neuronal 6 protein_id : NP_001028347.1

name	Calml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956268 GeneID:75600 MGI:1922850
definition	codon_start : 1 product : calmodulin-like 4 protein_id : NP_612177.1

name	Pias1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543478 GeneID:56469 MGI:1913125
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007259 - JAK-STAT cascade [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1 product : protein inhibitor of activated STAT 1 protein_id : NP_062637.2

name	Lbxcor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369603 CCDS:CCDS23268.1 GeneID:207667 MGI:2443473
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transcriptional corepressor Corl1 protein_id : NP_766034.1

name	Map2k5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754624 CCDS:CCDS23269.1 GeneID:23938 MGI:1346345
definition	GO_component : GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IMP] codon_start : 1 note : MAPK/ERK kinese 5; MAPK/ERK kinase 5 product : mitogen activated protein kinase kinase 5 protein_id : NP_035970.1

name	2300009A05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82930191 GeneID:69478 MGI:1916728
definition	codon_start : 1 product : hypothetical protein LOC69478 isoform 3 protein_id : XP_903630.1

name	2300009A05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63589667 GeneID:69478 MGI:1916728
definition	codon_start : 1 product : hypothetical protein LOC69478 isoform 1 protein_id : XP_204313.2

name	Iqch (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260024 GeneID:78250 MGI:1925500
definition	codon_start : 1 product : IQ motif containing H protein_id : XP_001475958.1

name	Iqch (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20890410 GeneID:78250 MGI:1925500
definition	codon_start : 1 product : IQ motif containing H isoform 1 protein_id : XP_134960.1

name	2310007F21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625673 CCDS:CCDS23271.1 GeneID:66939 MGI:1914189
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66939 protein_id : NP_080133.1

name	Smad3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543222 CCDS:CCDS23272.1 GeneID:17127 MGI:1201674
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0007182 - common-partner SMAD protein phosphorylation [Evidence IEA]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0048340 - paraxial mesoderm morphogenesis [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0051098 - regulation of binding [Evidence IDA]; GO:0050678 - regulation of epithelial cell proliferation [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0016202 - regulation of striated muscle development [Evidence IDA]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence IDA]; GO:0007183 - SMAD protein heteromerization [Evidence IEA]; GO:0042110 - T cell activation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Smad 3 product : MAD homolog 3 protein_id : NP_058049.2

name	Smad6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560673 CCDS:CCDS23273.1 GeneID:17130 MGI:1336883
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0007182 - common-partner SMAD protein phosphorylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Smad 6 product : MAD homolog 6 protein_id : NP_032568.2

name	2600006L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260002 GeneID:76814 MGI:1924064
definition	codon_start : 1 product : hypothetical protein LOC76814 protein_id : XP_001474039.1

name	Lctl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003882 CCDS:CCDS23274.1 GeneID:235435 MGI:2183549
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA] codon_start : 1 note : Klotho-LPH related product : lactase-like protein_id : NP_665834.1

name	Zwilch (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532956 CCDS:CCDS23275.1 GeneID:68014 MGI:1915264
definition	GO_component : GO:0000776 - kinetochore [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Zwilch protein_id : NP_080783.2

name	Rpl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794450 GeneID:67891 MGI:1915141
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L4 protein_id : NP_077174.1

name	Snapc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113681194 CCDS:CCDS23276.1 GeneID:330959 MGI:1914282
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : small nuclear RNA activating complex, polypeptide 5, 19kDa product : small nuclear RNA activating complex, polypeptide 5 protein_id : NP_899139.2

name	Map2k1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678794 CCDS:CCDS23277.1 GeneID:26395 MGI:1346866
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004708 - MAP kinase kinase activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030216 - keratinocyte differentiation [Evidence IMP]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : protein kinase, mitogen activated, kinase 1, p45; MAP kinase kinase 1 product : mitogen activated protein kinase kinase 1 protein_id : NP_032953.1

name	Uchl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809026 CCDS:CCDS23278.1 GeneID:93841 MGI:1890440
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin carboxyl-terminal esterase L4 protein_id : NP_291085.1

name	Tipin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313608 CCDS:CCDS23279.1 GeneID:66131 MGI:1921571
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : timeless-interacting protein protein_id : NP_079648.1

name	Dis3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47604968 CCDS:CCDS23280.1 GeneID:213550 MGI:2143272
definition	GO_function : GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : DIS3 mitotic control homolog (S. cerevisiae)-like protein_id : NP_001001295.1

name	Dis3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369724 CCDS:CCDS23280.1 GeneID:213550 MGI:2143272
definition	GO_function : GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : DIS3 mitotic control homolog (S. cerevisiae)-like protein_id : NP_766107.1

name	Megf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369722 CCDS:CCDS23281.1 GeneID:214058 MGI:1920951
definition	codon_start : 1 product : MEGF11 protein protein_id : NP_766110.1

name	EG665478 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665478
definition	number : 1 pseudo : _no_value

name	LOC100039976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039976
definition	number : 5 pseudo : _no_value

name	LOC100039976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039976
definition	number : 4 pseudo : _no_value

name	LOC100039976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039976
definition	number : 3 pseudo : _no_value

name	LOC100039976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039976
definition	number : 2 pseudo : _no_value

name	LOC100039976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039976
definition	number : 1 pseudo : _no_value

name	LOC100040009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040009
definition	number : 3 pseudo : _no_value

name	LOC100040009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040009
definition	number : 2 pseudo : _no_value

name	LOC100040009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040009
definition	number : 1 pseudo : _no_value

name	LOC621763 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260025 GeneID:621763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 46 ESTs, 3 Proteins product : similar to DnaJ (Hsp40) homolog, subfamily C, member 17 pseudo : _no_value transcript_id : XR_032501.1

clone name	MSMg01-316C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473E07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440C10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309N03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-309J05.b	B6Ng01-309J05.g
ACC	GA101783	GA101784
length	1,076	1,094
definition	B6Ng01-309J05.b	B6Ng01-309J05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(63,390,595 - 63,391,666)	(63,271,822 - 63,272,916)
sequence	gaattctttgcatagttttcccccagtattaacaaagtagaatattatag tatgatatcatcatcaggttgtattgaggataagacagggccttgttcat ggtaggcaagcactctcccactgaggtatatgctagtccccagccaggat actggtccactcaagactggaatatttctatcaccacatggatagaaccc accaacttccttccatacgcctttagtccctggcatccagaaatctgttc ttcattgtataactttgtaacttcaaaaccctcacatgaacaacctagta gaggatggaacctttggggtttgtatttttccgagaatcctccagcttgt agctcctcttttaagttacagtctgacatttccatgcacacatacaatat gctttggtcatatacacttctgttattattcttttgtcccccatgccctg cccttcccccttccttttccataccaatagttaactccctttgatcattc atatcttctccctatcctagcttctcctacatatgtgaaaaataggaaat ccttgtctttataggaaataagctgattccattaatcttctagcaaatgg tgtaattttattcttctttatgtcttagtaggacccatttgtgtgtgtgt gtttaaatctattatctcttagtaggcagctaagctgattcaaggagaaa taggcgtatctctagtaaactgatcccgagttctttgtttaaacatgaag aagtgatatggctgaatcatatagaacttctgtttaattattcttgagga attccacactaatttccatagtgtctggtctaatttatatctccacagtt gtgaataggggctcctttttcctccctggatcctgactcactgtgagtca ctgtgtgtcttttcctctgtgtacgggccacgggtccttgattgggaaac cctctcctcagttcaatttcccgaccgtttcacccgagcatttcctcctt tgttgtcaaccttttggagttctttatacgctctcaacatggaacctcct tattggatgagcagcagcagagatga	gaattccctactagttcataccacctctcataatgggcaactagagacca agcttctaccacatgagccactgggacatacactcaaactgaatcaaacc atcgcagatcacttggtaactgagcattggtgaaacactgggccttgcat agggagacacatttgtagaccccactgccccaacccaaagattctggttt tgttaatttgggtagagcccaggaatctgttgtctcaggaatatgaaagt ctagtgtagacactggtaaagaaacacaaatgactttgcaaaattagcga ctcttaagttcaaattgactttgactattacttggtttcaaaaaaaaaaa aaaaaaaaagagagatactggtagtcagtagttagaaagggtgggcttgt ccttgcactttgcagtgtgaaagttcagaagcaccagtttgctctaattt gttcattttagaaaaaataaattattaattaattaattcatgtcaatctt ctcagtcatggtgtacaaaaaccagtgatcagtgtcttaggtcttaaatc attttgaagagtgacacattataattaaaggggctaaatgctaacttaag taaaaaaaaaacaatgaagttttacttgagatttctatttaagagaaaaa caacgtatgatttcccatttgagtccttagatatatgtgattcatttaaa caaggcagaggcctaggctgggagttgtatcaggacaggccatcagctct tttcagcagttgtctcctgcattctagaacttgggagattttggatcttt agaggccacatggagacttaaaagggttaatggtgaaaggaccacctcac tgtggagaaatggggtgggtggatatcccacatagatgttaggagtttga tctgcttctcgtaaacacacactatttcttgggtctgaagagtctgggtt tagaagctaggctcccctggaatcactaaaccaaacatgcattatgtgag tacaagttaagtaccatcataattaagttacgtctagatttggcttccat tgtgcacgtttagttcactcaacatcgaagagtcctgttgctca
quality values	Open. Hide. 47 26 33 26 58 58 58 58 62 62 41 42 62 45 62 62 62 62 62 62 62 62 62 54 47 62 47 62 54 54 56 56 53 51 30 38 34 56 59 59 62 62 62 62 59 62 62 62 59 62 62 62 59 62 59 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 62 54 54 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 36 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 45 49 58 58 58 58 58 58 58 42 58 58 53 52 51 54 52 58 58 58 58 58 58 53 58 50 58 52 58 49 44 58 45 47 58 51 58 58 46 58 58 58 58 54 58 58 58 58 58 58 58 49 51 54 58 43 58 58 50 58 32 54 51 41 58 51 36 58 51 50 54 58 58 58 54 58 52 58 54 58 53 58 51 53 52 58 52 52 58 58 50 51 47 51 53 53 52 50 58 58 58 51 51 58 31 52 53 33 44 31 51 53 54 52 49 54 39 54 54 51 46 31 54 49 42 44 34 49 54 40 54 54 37 49 52 41 51 52 53 52 51 50 54 53 54 51 52 42 53 53 54 51 34 47 54 42 39 52 54 54 32 53 28 54 39 41 51 54 51 53 33 54 41 32 54 51 52 32 33 49 54 51 27 51 54 33 42 47 34 29 32 34 51 51 31 53 42 46 33 32 45 40 45 42 42 52 32 53 46 32 33 41 45 32 51 30 49 34 35 41 32 40 40 35 46 45 42 41 40 42 18 51 37 43 25 41 39 45 31 35 32 42 31 42 31 34 51 51 31 31 31 36 43 31 25 46 25 45 23 46 51 26 35 23 27 31 28 48 37 29 31 31 30 31 32 31 31 25 32 31 31 34 36 42 30 32 35 33 37 32 17 46 46 37 31 38 31 32 27 47 47 47 32 19 35 31 31 48 38 31 31 18 15 21 36 37 29 35 34 22 37 34 31 31 32 41 27 32 37 31 36 32 31 26 30 38 25 38 32 32 17 22 37 48 48 37 19 30 20 29 24 31 16 26 20 27 9 25 43 22 32 26 29 32 36 48 29 26 30 33 25 31 32 33 21 37 15 39 9 30 36 25 10 37 17 9 16 29 15 26 24 22 27 15 18 22 31 20 22 16 43 17 19 40 32 26 34 12 24 23 23 48 31 21 21 24 39 30 19 33 18 30 23 21 47 25 9 19 13 10 15 18 47 24 17 19 8 21 13 16 14 11 9 15 14 40 30 9 28 24 27 11 24 14 14 11 40 18 6 8 15 27 25 28 27 24 19 23 11 13 20 24 10 9 9 27 9 20 16 27 24 32 16 9 11 12 18 6 18 13 15 16 20 9 25 11 3 3 5 11 11 11 5 7 4 5 11 11 15	Open. Hide. 62 47 39 47 62 62 62 62 54 62 54 47 35 38 56 59 59 35 59 59 62 59 59 62 62 62 62 62 46 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 59 59 62 62 62 62 62 54 49 49 42 49 62 59 59 62 62 62 59 59 62 62 59 62 59 59 59 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 50 62 50 49 46 43 62 62 43 62 62 62 62 62 62 62 62 62 62 56 62 56 56 56 56 46 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 56 62 56 62 62 62 62 62 62 56 56 51 38 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 54 56 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 43 43 47 62 52 62 62 62 62 62 62 62 62 62 62 62 62 52 62 52 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 47 54 52 58 54 58 58 47 58 54 58 58 58 58 58 58 54 58 52 54 58 54 54 58 58 58 58 54 54 58 58 58 58 58 58 46 58 52 49 58 54 48 54 58 54 58 58 54 52 54 58 44 44 48 58 52 58 58 58 58 54 58 52 58 52 58 58 52 51 41 58 58 58 51 51 51 51 50 50 58 58 58 58 58 47 51 51 47 40 42 50 51 58 58 58 40 58 58 47 49 52 48 58 58 50 46 26 39 39 58 58 50 53 52 48 58 46 37 54 37 51 23 58 58 58 58 46 50 26 42 51 49 50 53 51 50 46 39 44 42 50 58 50 40 52 58 50 50 51 37 40 40 50 49 54 51 38 52 37 50 42 50 53 58 53 58 51 37 44 50 32 47 58 34 22 58 53 47 32 52 45 54 49 49 26 46 12 30 39 42 40 35 19 54 38 42 45 54 47 28 18 33 39 49 37 37 40 39 42 17 49 24 25 33 19 49 35 40 26 43 42 32 29 37 42 32 45 54 54 42 40 32 35 45 40 31 40 42 53 32 35 33 37 45 35 52 31 28 31 34 32 31 40 28 53 34 31 30 33 45 52 32 35 19 35 13 51 53 35 34 32 29 28 32 34 51 46 31 25 37 32 29 26 32 17 31 16 25 30 46 34 23 30 25 29 27 20 51 46 30 38 47 42 25 32 28 32 28 32 27 10 17 18 48 9 25 13 31 21 42 29 41 30 31 34 30 31 32 38 25 30 21 42 22 42 48 26 23 31 46 46 37 15 36 46 30 24 25 24 7 13 25 27 33 37 26 17 12 23 31 25 6 26 21 37 14 17 10 5 6 27 10 15 24 8 7 5 14 24 19 38 31 27 31 10 10 22 20 31 11 44 13 13 8 15 18 18 17 19 27 19 11 38 14 19 7 11 32 36 20 19 22 30 32 23 19 7 32 11 27 18 13 23 31 8 8 13 12 4 8 31 31 8 22 31 24 19 21 23 15 16 39 39 18 15 10 17 13 14 6 6 6 6 10 11 28 8 30 9 6 6 14 16 7 7 8 22 20 38 13 8 6 9 11 6 13 3 7 8 7 5 11 8 14 5 7 9 7 23 14 19 10 11 21 10 12 18 23 24 15 20 6 15 7 14 13 8 6 3 5 6 4 10 8 5 7 9 11 3 13 5 11 10 9 12 4 7 6 12 8 16 6 18 9 5 2 3 16 23 9 12 17 4 5 17 5 7 4 16 8 7 21 6 4 18 22 8 6 3 4 18 22 13 17 11 1 2 2 3 4 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_63390595_63391666
seq2: B6Ng01-309J05.b_45_1120 (reverse)

seq1  TCATCTCTGCTGGCTGCTCATCCAAT-AGGAGGTT-CATGTTGAGAGCGT  48
      ||||||||||| |||||||||||||| |||||||| ||||||||||||||
seq2  TCATCTCTGCT-GCTGCTCATCCAATAAGGAGGTTCCATGTTGAGAGCGT  49

seq1  ATAAAGAACTCC-AAAGGTTGACAACAAAGGAGGAAATGCTCGGGTGAAA  97
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  ATAAAGAACTCCAAAAGGTTGACAACAAAGGAGGAAATGCTCGGGTGAAA  99

seq1  CGGTCGGG-AATTGAACTGAGGAGAGGGTTT-CCAATCAAGGACCCGTGG  145
      |||||||| |||||||||||||||||||||| ||||||||||||||||||
seq2  CGGTCGGGAAATTGAACTGAGGAGAGGGTTTCCCAATCAAGGACCCGTGG  149

seq1  CCCGTACACAGAGGAAAAGACACACAGTGACTCACAGTGAGTCAGGATCC  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGTACACAGAGGAAAAGACACACAGTGACTCACAGTGAGTCAGGATCC  199

seq1  AGGGAGGAAAAAGGAGCCCCTATTCACAACTGTGGAGATATAAATTAGAC  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGGAAAAAGGAGCCCCTATTCACAACTGTGGAGATATAAATTAGAC  249

seq1  CAGACACTATGGAAATTAGTGTGGAATTCCTCAAGAATAATTAAACAGAA  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACACTATGGAAATTAGTGTGGAATTCCTCAAGAATAATTAAACAGAA  299

seq1  GTTCTATATGATTCAGCCATATCACTTCTTCATGTTTAAACAAAGAACTC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTATATGATTCAGCCATATCACTTCTTCATGTTTAAACAAAGAACTC  349

seq1  GGGATCAGTTTACTAGAGATACGCCTATTTCTCCTTGAATCAGCTTAGCT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATCAGTTTACTAGAGATACGCCTATTTCTCCTTGAATCAGCTTAGCT  399

seq1  GCCTACTAAGAGATAATAGATTTAAACACACACACACAAATGGGTCCTAC  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTACTAAGAGATAATAGATTTAAACACACACACACAAATGGGTCCTAC  449

seq1  TAAGACATAAAGAAGAATAAAATTACACCATTTGCTAGAAGATTAATGGA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGACATAAAGAAGAATAAAATTACACCATTTGCTAGAAGATTAATGGA  499

seq1  ATCAGCTTATTTCCTATAAAGACAAGGATTTCCTATTTTTCACATATGTA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCTTATTTCCTATAAAGACAAGGATTTCCTATTTTTCACATATGTA  549

seq1  GGAGAAGCTAGGATAGGGAGAAGATATGAATGATCAAAGGGAGTTAACTA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAAGCTAGGATAGGGAGAAGATATGAATGATCAAAGGGAGTTAACTA  599

seq1  TTGGTATGGAAAAGGAAGGGGGAAGGGCAGGGCATGGGGGACAAAAGAAT  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTATGGAAAAGGAAGGGGGAAGGGCAGGGCATGGGGGACAAAAGAAT  649

seq1  AATAACAGAAGTGTATATGACCAAAGCATATTGTATGTGTGCATGGAAAT  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAACAGAAGTGTATATGACCAAAGCATATTGTATGTGTGCATGGAAAT  699

seq1  GTCAGACTGTAACTTAAAAGAGGAGCTACAAGCTGGAGGATTCTCGGAAA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGACTGTAACTTAAAAGAGGAGCTACAAGCTGGAGGATTCTCGGAAA  749

seq1  AATACAAACCCCAAAGGTTCCATCCTCTACTAGGTTGTTCATGTGAGGGT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACAAACCCCAAAGGTTCCATCCTCTACTAGGTTGTTCATGTGAGGGT  799

seq1  TTTGAAGTTACAAAGTTATACAATGAAGAACAGATTTCTGGATGCCAGGG  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAAGTTACAAAGTTATACAATGAAGAACAGATTTCTGGATGCCAGGG  849

seq1  ACTAAAGGCGTATGGAAGGAAGTTGGTGGGTTCTATCCATGTGGTGATAG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAAGGCGTATGGAAGGAAGTTGGTGGGTTCTATCCATGTGGTGATAG  899

seq1  AAATATTCCAGTCTTGAGTGGACCAGTATCCTGGCTGGGGACTAGCATAT  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATTCCAGTCTTGAGTGGACCAGTATCCTGGCTGGGGACTAGCATAT  949

seq1  ACCTCAGTGGGAGAGTGCTTGCCTACCATGAACAAGGCCCTGTCTTATCC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCAGTGGGAGAGTGCTTGCCTACCATGAACAAGGCCCTGTCTTATCC  999

seq1  TCAATACAACCTGATGATGATATCATACTATAATATTCTACTTTGTTAAT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATACAACCTGATGATGATATCATACTATAATATTCTACTTTGTTAAT  1049

seq1  ACTGGGGGAAAACTATGCAAAGAATTC  1072
      |||||||||||||||||||||||||||
seq2  ACTGGGGGAAAACTATGCAAAGAATTC  1076

seq1: chr9_63271822_63272916
seq2: B6Ng01-309J05.g_67_1160

seq1  GAATTCCCTACTAGTTCATACCACCTCTCATAATGGGCAACTAGAGACCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTACTAGTTCATACCACCTCTCATAATGGGCAACTAGAGACCA  50

seq1  AGCTTCTACCACATGAGCCACTGGGACATACACTCAAACTGAATCAAACC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTCTACCACATGAGCCACTGGGACATACACTCAAACTGAATCAAACC  100

seq1  ATCGCAGATCACTTGGTAACTGAGCATTGGTGAAACACTGGGCCTTGCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGCAGATCACTTGGTAACTGAGCATTGGTGAAACACTGGGCCTTGCAT  150

seq1  AGGGAGACACATTTGTAGACCCCACTGCCCCAACCCAAAGATTCTGGTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGACACATTTGTAGACCCCACTGCCCCAACCCAAAGATTCTGGTTT  200

seq1  TGTTAATTTGGGTAGAGCCCAGGAATCTGTTGTCTCAGGAATATGAAAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAATTTGGGTAGAGCCCAGGAATCTGTTGTCTCAGGAATATGAAAGT  250

seq1  CTAGTGTAGACACTGGTAAAGAAACACAAATGACTTTGCAAAATTAGCGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGTGTAGACACTGGTAAAGAAACACAAATGACTTTGCAAAATTAGCGA  300

seq1  CTCTTAAGTTCAAATTGACTTTGACTATTACTTGGTTTCAAAAAAAAAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTAAGTTCAAATTGACTTTGACTATTACTTGGTTTCAAAAAAAAAAA  350

seq1  AAAAAAAAAGAGAGATACTGGTAGTCAGTAGTTAGAAAGGGTGGGCTTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAGAGAGATACTGGTAGTCAGTAGTTAGAAAGGGTGGGCTTGT  400

seq1  CCTTGCACTTTGCAGTGTGAAAGTTCAGAAGCACCAGTTTGCTCTAATTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGCACTTTGCAGTGTGAAAGTTCAGAAGCACCAGTTTGCTCTAATTT  450

seq1  GTTCATTTTAGAAAAAATAAATTATTAATTAATTAATTCATGTCAATCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCATTTTAGAAAAAATAAATTATTAATTAATTAATTCATGTCAATCTT  500

seq1  CTCAGTCATGGTGTACAAAAACCAGTGATCAGTGTCTTAGGTCTTAAATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGTCATGGTGTACAAAAACCAGTGATCAGTGTCTTAGGTCTTAAATC  550

seq1  ATTTTGAAGAGTGACACATTATAATTAAAGGGGCTAAATGCTAACTTAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTGAAGAGTGACACATTATAATTAAAGGGGCTAAATGCTAACTTAAG  600

seq1  TAAAAAAAAAACAATGAAGTTTTACTTGAGATTTCTATTTAAGAGAAAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAAAAAAACAATGAAGTTTTACTTGAGATTTCTATTTAAGAGAAAAA  650

seq1  CAACGTATGATTTCCCATTTGAGTCCTTAGATATATGTGATTCATTTAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACGTATGATTTCCCATTTGAGTCCTTAGATATATGTGATTCATTTAAA  700

seq1  CAAGGCAGAGGCCTAGGCTGGGAGTTGTATCAGGACAGGCCATCAGCTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGCAGAGGCCTAGGCTGGGAGTTGTATCAGGACAGGCCATCAGCTCT  750

seq1  TTTCAGCAGTTGTCTCCTGCATTCTAGAACTTGGGAGATTTTGGATCTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAGCAGTTGTCTCCTGCATTCTAGAACTTGGGAGATTTTGGATCTTT  800

seq1  AGAGGCCACATGGAGACTTAAAAGGGTTAATGGTG-AAGGACCACCTCAC  849
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  AGAGGCCACATGGAGACTTAAAAGGGTTAATGGTGAAAGGACCACCTCAC  850

seq1  TGTGGAGAAATGGGGTGGGTGGATATCCCACATAGATGTTAGGAGTTTTG  899
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  TGTGGAGAAATGGGGTGGGTGGATATCCCACATAGATGTTAGGAG-TTTG  899

seq1  TTCTGCTTCTCGTTAACACACACTA-TTCTTGGGTCTG-AGAGTCTGGTT  947
       |||||||||||| ||||||||||| |||||||||||| ||||||||| |
seq2  ATCTGCTTCTCGTAAACACACACTATTTCTTGGGTCTGAAGAGTCTGGGT  949

seq1  TTAGAAGCTAGGCTCCCCTGGAATCACT-AACCAGACATGCATTATGTGA  996
      |||||||||||||||||||||||||||| ||||| |||||||||||||| 
seq2  TTAGAAGCTAGGCTCCCCTGGAATCACTAAACCAAACATGCATTATGTG-  998

seq1  AGTACAAG-TAAGTA-CATCATAAATTAGTTACAGTCTAGATTTTGGTTC  1044
      |||||||| |||||| |||||||| | |||||| |||||||||| | |||
seq2  AGTACAAGTTAAGTACCATCATAATTAAGTTAC-GTCTAGATTTGGCTTC  1047

seq1  CATTGTG-ACGTTTTAGTTTCACCTCCAACATCAGAGAGCCCTGTTGTCT  1093
      ||||||| ||| ||||| |||||   |||||||  |||| ||||||| ||
seq2  CATTGTGCACG-TTTAG-TTCAC--TCAACATCGAAGAGTCCTGTTG-CT  1092

seq1  CA  1095
      ||
seq2  CA  1094

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information