MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-310N17
Chromosome	9 (Build37)
Map Location	115,388,514 - 115,518,526
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Ccr4, Trim71, LOC100043808, Cnot10, LOC665772, Dync1li1, Cmtm6, Cmtm7, Cmtm8, Gpd1l, LOC100043813, Osbpl10, LOC100043812, Stt3b, LOC100039567, LOC670467, EG546164
Downstream gene	Gadl1, EG668829, Tgfbr2, LOC100043817, LOC100043819, D730003K21Rik, Rbms3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ccr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12773 MGI:107824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636931 MGI:2685973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cnot10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78893 MGI:1926143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 9 Proteins pseudo : _no_value

name	Dync1li1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235661 MGI:2135610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67213 MGI:2447165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102545 MGI:2447166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70031 MGI:2447167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpd1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333433 MGI:1289257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043813 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 497 ESTs, 1 Protein

name	Osbpl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74486 MGI:1921736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Stt3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68292 MGI:1915542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC670467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein pseudo : _no_value

name	EG546164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546164 MGI:3648968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2643 ESTs, 9 Proteins

name	Gadl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73748 MGI:1920998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins

name	EG668829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668829 MGI:3646182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 896 ESTs

name	Tgfbr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21813 MGI:98729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	D730003K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78580 MGI:1925830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rbms3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207181 MGI:2444477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857772 GeneID:12773 MGI:107824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 4 transcript_id : NM_009916.1

name	Trim71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948299 GeneID:636931 MGI:2685973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 71 transcript_id : NM_001042503.1

name	LOC100043808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260398 GeneID:100043808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043808 transcript_id : XM_001481088.1

name	Cnot10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387942 GeneID:78893 MGI:1926143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 10 transcript_id : NM_153585.4

name	Dync1li1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130200 GeneID:235661 MGI:2135610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein cytoplasmic 1 light intermediate chain 1 transcript_id : NM_146229.2

name	Cmtm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383888 GeneID:67213 MGI:2447165
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 6 transcript_id : NM_026036.2

name	Cmtm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527197 GeneID:102545 MGI:2447166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 7 transcript_id : NM_133978.1

name	Cmtm8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373686 GeneID:70031 MGI:2447167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 8 transcript_id : NM_027294.2

name	Gpd1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388353 GeneID:333433 MGI:1289257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol-3-phosphate dehydrogenase 1-like transcript_id : NM_175380.4

name	LOC100043813 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260403 GeneID:100043813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 497 ESTs, 1 Protein product : similar to metallopanstimulin transcript_id : XM_001481092.1

name	Osbpl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130153 GeneID:74486 MGI:1921736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 10 transcript_id : NM_148958.2

name	LOC100043812 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260401 GeneID:100043812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043812 transcript_id : XM_001481091.1

name	Stt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61651672 GeneID:68292 MGI:1915542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) transcript_id : NM_024222.2

name	LOC100039567 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260337 GeneID:100039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Ubtf protein transcript_id : XM_001473117.1

name	EG546164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260405 GeneID:546164 MGI:3648968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2643 ESTs, 9 Proteins product : predicted gene, EG546164, transcript variant 1 transcript_id : XM_620794.4

name	Gadl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386586 GeneID:73748 MGI:1920998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins product : glutamate decarboxylase-like 1 transcript_id : XM_135211.6

name	EG668829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386656 GeneID:668829 MGI:3646182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 896 ESTs product : predicted gene, EG668829 transcript_id : XM_001005405.1

name	Tgfbr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27363473 GeneID:21813 MGI:98729
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta receptor II transcript_id : NM_009371.2

name	Tgfbr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27363475 GeneID:21813 MGI:98729
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta receptor II transcript_id : NM_029575.2

name	LOC100043817 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260406 GeneID:100043817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043817 transcript_id : XM_001481093.1

name	LOC100043819 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260408 GeneID:100043819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043819 transcript_id : XM_001481094.1

name	D730003K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260410 GeneID:78580 MGI:1925830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA D730003K21 gene transcript_id : XM_001481095.1

name	Rbms3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340984 GeneID:207181 MGI:2444477
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif, single stranded interacting protein transcript_id : NM_178660.2

name	Ccr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857773 CCDS:CCDS23594.1 GeneID:12773 MGI:107824
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : fusin; chemokine (C-C) receptor 4; CC CKR-4; leukocyte-expressed seven-transmembrane-domain receptor product : chemokine (C-C motif) receptor 4 protein_id : NP_034046.1

name	Trim71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948300 GeneID:636931 MGI:2685973
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lin-41 homolog product : tripartite motif-containing 71 protein_id : NP_001035968.1

name	LOC100043808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260399 GeneID:100043808
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481138.1

name	Cnot10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31324571 GeneID:78893 MGI:1926143
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CCR4-NOT transcription complex, subunit 10 protein_id : NP_705813.2

name	Dync1li1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122795 CCDS:CCDS23595.1 GeneID:235661 MGI:2135610
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence ISS]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence ISS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : dynein, cytoplasmic, light intermediate chain 1 protein_id : NP_666341.1

name	Cmtm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313082 CCDS:CCDS23596.1 GeneID:67213 MGI:2447165
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : chemokine-like factor super family 6 product : chemokine-like factor superfamily 6 protein_id : NP_080312.1

name	Cmtm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527198 GeneID:102545 MGI:2447166
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 7 protein_id : NP_598739.1

name	Cmtm8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312514 CCDS:CCDS23597.1 GeneID:70031 MGI:2447167
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 8 protein_id : NP_081570.1

name	Gpd1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34594657 CCDS:CCDS23598.1 GeneID:333433 MGI:1289257
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0046168 - glycerol-3-phosphate catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycerol-3-phosphate dehydrogenase 1-like protein_id : NP_780589.2

name	LOC100043813 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260404 GeneID:100043813
definition	codon_start : 1 product : similar to metallopanstimulin protein_id : XP_001481142.1

name	Osbpl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507367 GeneID:74486 MGI:1921736
definition	GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol-binding protein-like protein 10 protein_id : NP_683761.1

name	LOC100043812 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260402 GeneID:100043812
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481141.1

name	Stt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61651673 CCDS:CCDS23599.1 GeneID:68292 MGI:1915542
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA] [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0004576 - oligosaccharyl transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006486 - protein amino acid glycosylation [Evidence IEA]; GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] codon_start : 1 product : source of immunodominant MHC-associated peptides protein_id : NP_077184.2

name	LOC100039567 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260338 GeneID:100039567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473167.1

name	EG546164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63594466 GeneID:546164 MGI:3648968
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_620794.1

name	Gadl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386587 GeneID:73748 MGI:1920998
definition	codon_start : 1 product : glutamate decarboxylase-like 1 protein_id : XP_135211.6

name	EG668829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386657 GeneID:668829 MGI:3646182
definition	codon_start : 1 product : similar to ribosomal protein L24 protein_id : XP_001005405.1

name	Tgfbr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27363476 CCDS:CCDS23602.1 GeneID:21813 MGI:98729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; TGF-beta receptor II product : transforming growth factor, beta receptor II isoform 2 protein_id : NP_083851.2

name	Tgfbr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27363474 CCDS:CCDS23601.1 GeneID:21813 MGI:98729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; TGF-beta receptor II product : transforming growth factor, beta receptor II isoform 1 protein_id : NP_033397.2

name	LOC100043817 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260407 GeneID:100043817
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481143.1

name	LOC100043819 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260409 GeneID:100043819
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481144.1

name	D730003K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260411 GeneID:78580 MGI:1925830
definition	codon_start : 1 product : hypothetical protein LOC78580 protein_id : XP_001481145.1

name	Rbms3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520025 GeneID:207181 MGI:2444477
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA-binding protein RBMS3 product : RNA binding motif, single stranded interacting protein 3 protein_id : NP_848775.1

name	LOC665772 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260400 GeneID:665772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 9 Proteins product : similar to ribosomal protein S17 pseudo : _no_value transcript_id : XR_034988.1

name	LOC670467 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260339 GeneID:670467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to glyceraldehyde-3-phosphate-dehydrogenase pseudo : _no_value transcript_id : XR_031057.1

clone name	MSMg01-472C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176M19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-353L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413D20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229M22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-310N17.b	B6Ng01-310N17.g
ACC	GA102723	GA102724
length	954	545
definition	B6Ng01-310N17.b	B6Ng01-310N17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(115,517,573 - 115,518,526)	(115,388,514 - 115,389,058)
sequence	gaattcaataaaataaatatgcagaacaggaagtggttatggtcatctgt gggagtagtaggcctctggtcaccacatgaagctttgaagggaattctac attgtagtgggggaggaggattagatgtacgttagccatgttctttgccc ataattccattggattcagggataaagtcatcctgtagatctcagctttc cagagttgccagtcagtcccaagttgctagacagtatctctacccaacac ctacggccccacctggcagactctatctctggtttctgtttcctcttgct gctaaactctcagcttctcagatgaccagctggaaggggtgcaggttcta gaaagaagaggcatgtgtatctccatgccagtggggaagcaggccagagt gagcatcctccatcctgcacacccagaaacttacaactagtatagctcaa cctggtatgcccttccacgggggacctcattctcttctggtacttctggg cctagccaataaggctgtcctggcccgcatccagactctaaatctaacct ttggggactgccccatgggctgacaatcctacctctggaaaccctgaggt acctcgtggaaagtacacccaacattcaccaaaaccggaggaggcagggt ttctcctctcccttagaaaaccttctgtgatccagagccccagctggctg gcccgtccagaaccgctgccccggctgctcttccccctcttactcattct gtcacccactcagaaggcgctctttctatgaaggcctgctgaagttgtgc tgaaccacaacttcctcctctaaggtgacccttggatctctgacatcccc aagttgttcacagttctccaaacactgagaaatgactgtgctcatgttgc tccagcatcagagctctcccctgaccagctgctgtctaggggtgggggtt gggt	gaattctctcactgtctggagttttctataacatttcattagctttgaca gttcagttttatacaagtgaaatttggtggctcagaagggatgccttttc gcacacagcaggctaggaagtattttcttcctgcattggctcagcaaatg gaatctaatctcgaagtccctgagctgtgttctgaggcccctgatgactt aaactctgatggtgtgagaaattaatcaattcctgccctcgaggtttttc cgttgctgccaccagaccacagggccttctaattgacacgtagccatggg atgccggggcacaagggcatcgccagtgggagtgtgtgagtattagagcc accttaagaggccagactgggttgctggcatgggcatatttgctctttta ggaaaggtgttctctctctctctctctctctctctctctctctctctctc tctctctctctctctctctctctctcctctgtgtgtgtgtgtgtgtgtga gagagagagagagagagagagagagagagagagagagagagagag
quality values	Open. Hide. 49 26 23 41 58 31 21 45 58 62 62 62 54 62 62 62 62 62 62 41 47 62 47 62 62 62 51 41 62 62 49 56 51 56 49 28 45 59 56 59 62 59 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 48 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 62 49 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 59 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 47 56 51 62 62 62 62 56 56 56 56 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 33 42 31 41 39 46 62 47 42 56 56 56 47 56 56 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 47 39 36 48 52 52 62 62 62 62 54 49 45 41 62 52 62 52 50 43 41 47 52 52 52 37 34 29 28 29 40 54 44 38 50 58 54 54 54 54 52 54 54 54 52 46 42 52 52 47 47 52 44 49 52 47 52 54 39 58 58 54 54 54 52 52 47 58 58 48 52 58 52 54 50 46 52 47 48 47 50 52 51 50 49 50 58 45 44 44 44 48 35 58 58 49 45 42 29 58 48 47 49 58 58 51 51 40 58 54 58 39 58 54 49 32 50 50 39 48 41 26 54 51 40 53 51 47 46 54 47 41 40 32 33 29 30 20 24 32 14 26 25 16 50 33 30 17 35 35 39 54 51 41 58 49 40 58 42 39 32 51 32 58 41 40 39 58 51 51 52 42 50 42 32 41 52 50 51 49 35 29 33 36 27 10 44 27 22 35 31 37 29 28 39 42 49 41 28 33 41 49 37 46 50 32 53 39 37 42 37 40 30 17 27 23 32 41 42 45 45 53 53 52 53 40 52 40 31 53 52 40 40 32 45 37 40 28 34 40 52 37 29 31 38 31 37 42 37 41 29 46 30 32 31 31 47 24 28 31 31 29 6 8 11 11 12 31 17 31 32 34 32 33 51 32 31 26 20 21 31 45 35 22 21 21 21 34 41 25 26 29 31 27 12 31 30 45 24 28 31 33 25 37 34 30 33 31 32 12 29 20 15 46 18 25 44 33 25 13 13 23 19 27 15 21 9 23 31 13 18 15 29 17 31 29 29 34 15 42 26 23 25 31 18 24 31 22 46 37 28 11 31 31 17 43 42 31 26 20 4 6 18 25 33 24 21 31 21 24 13 26 29 24 25 23 27 37 41 24 27 31 22 38 21 20 13 25 31 32 25 31 42 27 11 8 7 6 6 9 38 13 36 27 31 19 31 21 29 14 13 11 44 14 33 10 27 38 24 37 48 11 28 31 35 18 34 30 10 29 14 8 10 22 33 20 17 6 8 10 44 40 27 31 17 30 33 31 24 14 19 8 20 6 6	Open. Hide. 62 54 59 49 62 62 62 62 54 59 59 59 59 42 31 34 43 49 54 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 59 59 62 59 59 62 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 56 62 49 49 49 49 54 51 62 59 62 62 62 62 62 62 62 62 49 54 59 62 62 62 54 54 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 59 54 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 49 49 49 49 46 46 49 38 46 49 58 58 58 49 38 38 46 46 38 46 46 38 38 40 58 58 49 58 58 58 58 58 58 49 49 58 58 58 49 58 46 44 54 52 52 40 52 48 41 45 44 46 44 58 58 58 58 58 51 58 54 58 51 58 51 58 50 54 48 44 43 20 25 19 16 10 16 19 30 24 27 15 27 17 21 17 35 24 28 18 28 24 31 27 29 26 28 32 32 31 32 37 27 42 42 19 16 22 22 20 22 28 33 23 20 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_115517573_115518526
seq2: B6Ng01-310N17.b_46_998 (reverse)

seq1  CCCAACCCCCACCCCTAGACAGCAGCTGGTCAGGGGAGGGCTCTGATGCT  50
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CCCAACCCCCACCCCTAGACAGCAGCTGGTCAGGGGAGAGCTCTGATGCT  50

seq1  GGGGC-ACATGAGCACAGTCATTTCTCAGTGTTTGGAGAACTGTGGAACA  99
      || || |||||||||||||||||||||||||||||||||||||| |||||
seq2  GGAGCAACATGAGCACAGTCATTTCTCAGTGTTTGGAGAACTGT-GAACA  99

seq1  ACTTGGGGATGTCAGAGATCCAAGGGTCACCTTAGAGGAGGAAGTTGTGG  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGGGATGTCAGAGATCCAAGGGTCACCTTAGAGGAGGAAGTTGTGG  149

seq1  TTCAGCACAACTTCAGCAGGCCTTCATAGAAAGAGCGCCTTCCTGAGTGG  199
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TTCAGCACAACTTCAGCAGGCCTTCATAGAAAGAGCGCCTT-CTGAGTGG  198

seq1  GTGACAGAATGAGTAAGAGGGGGAAGAGCAGCCGGGGCAGCGGTTCTGGA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACAGAATGAGTAAGAGGGGGAAGAGCAGCCGGGGCAGCGGTTCTGGA  248

seq1  CGGGCCAGCCAGCTGGGGCTCTGGATCACAGAAGGTTTTCTAAGGGAGAG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGCCAGCCAGCTGGGGCTCTGGATCACAGAAGGTTTTCTAAGGGAGAG  298

seq1  GAGAAACCCTGCCTCCTCCGGTTTTGGTGAATGTTGGGTGTACTTTCCAC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAACCCTGCCTCCTCCGGTTTTGGTGAATGTTGGGTGTACTTTCCAC  348

seq1  GAGGTACCTCAGGGTTTCCAGAGGTAGGATTGTCAGCCCATGGGGCAGTC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTACCTCAGGGTTTCCAGAGGTAGGATTGTCAGCCCATGGGGCAGTC  398

seq1  CCCAAAGGTTAGATTTAGAGTCTGGATGCGGGCCAGGACAGCCTTATTGG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAAGGTTAGATTTAGAGTCTGGATGCGGGCCAGGACAGCCTTATTGG  448

seq1  CTAGGCCCAGAAGTACCAGAAGAGAATGAGGTCCCCCGTGGAAGGGCATA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGCCCAGAAGTACCAGAAGAGAATGAGGTCCCCCGTGGAAGGGCATA  498

seq1  CCAGGTTGAGCTATACTAGTTGTAAGTTTCTGGGTGTGCAGGATGGAGGA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTTGAGCTATACTAGTTGTAAGTTTCTGGGTGTGCAGGATGGAGGA  548

seq1  TGCTCACTCTGGCCTGCTTCCCCACTGGCATGGAGATACACATGCCTCTT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCACTCTGGCCTGCTTCCCCACTGGCATGGAGATACACATGCCTCTT  598

seq1  CTTTCTAGAACCTGCACCCCTTCCAGCTGGTCATCTGAGAAGCTGAGAGT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTAGAACCTGCACCCCTTCCAGCTGGTCATCTGAGAAGCTGAGAGT  648

seq1  TTAGCAGCAAGAGGAAACAGAAACCAGAGATAGAGTCTGCCAGGTGGGGC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCAGCAAGAGGAAACAGAAACCAGAGATAGAGTCTGCCAGGTGGGGC  698

seq1  CGTAGGTGTTGGGTAGAGATACTGTCTAGCAACTTGGGACTGACTGGCAA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTAGGTGTTGGGTAGAGATACTGTCTAGCAACTTGGGACTGACTGGCAA  748

seq1  CTCTGGAAAGCTGAGATCTACAGGATGACTTTATCCCTGAATCCAATGGA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGAAAGCTGAGATCTACAGGATGACTTTATCCCTGAATCCAATGGA  798

seq1  ATTATGGGCAAAGAACATGGCTAACGTACATCTAATCCTCCTCCCCCACT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATGGGCAAAGAACATGGCTAACGTACATCTAATCCTCCTCCCCCACT  848

seq1  ACAATGTAGAATTCCCTTCAAAGCTTCATGTGGTGACCAGAGGCCTACTA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATGTAGAATTCCCTTCAAAGCTTCATGTGGTGACCAGAGGCCTACTA  898

seq1  CTCCCACAGATGACCATAACCACTTCCTGTTCTGCATATTTATTTTATTG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCACAGATGACCATAACCACTTCCTGTTCTGCATATTTATTTTATTG  948

seq1  AATTC  954
      |||||
seq2  AATTC  953

seq1: chr9_115388514_115389058
seq2: B6Ng01-310N17.g_68_612

seq1  GAATTCTCTCACTGTCTGGAGTTTTCTATAACATTTCATTAGCTTTGACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTCACTGTCTGGAGTTTTCTATAACATTTCATTAGCTTTGACA  50

seq1  GTTCAGTTTTATACAAGTGAAATTTGGTGGCTCAGAAGGGATGCCTTTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAGTTTTATACAAGTGAAATTTGGTGGCTCAGAAGGGATGCCTTTTC  100

seq1  GCACACAGCAGGCTAGGAAGTATTTTCTTCCTGCATTGGCTCAGCAAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACACAGCAGGCTAGGAAGTATTTTCTTCCTGCATTGGCTCAGCAAATG  150

seq1  GAATCTAATCTCGAAGTCCCTGAGCTGTGTTCTGAGGCCCCTGATGACTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCTAATCTCGAAGTCCCTGAGCTGTGTTCTGAGGCCCCTGATGACTT  200

seq1  AAACTCTGATGGTGTGAGAAATTAATCAATTCCTGCCCTCGAGGTTTTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCTGATGGTGTGAGAAATTAATCAATTCCTGCCCTCGAGGTTTTTC  250

seq1  CGTTGCTGCCACCAGACCACAGGGCCTTCTAATTGACACGTAGCCATGGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTGCTGCCACCAGACCACAGGGCCTTCTAATTGACACGTAGCCATGGG  300

seq1  ATGCCGGGGCACAAGGGCATCGCCAGTGGGAGTGTGTGAGTATTAGAGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCGGGGCACAAGGGCATCGCCAGTGGGAGTGTGTGAGTATTAGAGCC  350

seq1  ACCTTAAGAGGCCAGACTGGGTTGCTGGCATGGGCATATTTGCTCTTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTAAGAGGCCAGACTGGGTTGCTGGCATGGGCATATTTGCTCTTTTA  400

seq1  GGAAAGGTGTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGGTGTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC  450

seq1  TCTCTCTCTCTCTCTCTCTCTCTCTCCTCTGTGTGTGTGTGTGTGTGTGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTCTCTCTCTCTCTCTCTCTCCTCTGTGTGTGTGTGTGTGTGTGA  500

seq1  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG  545
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG  545

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information