MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-316O18
Chromosome	9 (Build37)
Map Location	36,577,536 - 36,578,563
singlet/doublet	singlet
Overlap gene	none
Upstream gene	D730048I06Rik, 9230110F15Rik, LOC100041605, 9230113P08Rik, EG546123, LOC100041618, LOC100042485, EG639025, LOC671003, EG434396, A630095E13Rik, Acrv1, Chek1, Stt3a
Downstream gene	Ei24, LOC627681, Fez1, Pknox2, LOC100042545, 1810021J13Rik, Slc37a2, LOC100042561, Ccdc15, Hepacam, Robo4, Robo3, BC024479, Esam1, Vsig2, Nrgn, Spa17, Siae, Tbrg1, Panx3, LOC666881, EG627798, Olfr160, Olfr151, Olfr874
Link	Open Mouse BAC browser

Click to get alignment info.

name	D730048I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68171 MGI:1915421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230110F15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77080 MGI:1924330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100041605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	9230113P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77908 MGI:1925158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	EG546123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546123 MGI:3643162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100041618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042485 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG639025 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639025 MGI:3647831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC671003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG434396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434396 MGI:3647347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630095E13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235973 MGI:3055869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acrv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11451 MGI:104590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chek1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12649 MGI:1202065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stt3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16430 MGI:105124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ei24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13663 MGI:108090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins pseudo : _no_value

name	Fez1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235180 MGI:2670976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pknox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208076 MGI:2445415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1810021J13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66279 MGI:1913529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc37a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56857 MGI:1929693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 244 ESTs, 3 Proteins

name	Ccdc15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245902 MGI:2444488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hepacam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72927 MGI:1920177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Robo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74144 MGI:1921394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Robo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19649 MGI:1343102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 6 Proteins

name	BC024479 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235184 MGI:2384579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Esam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69524 MGI:1916774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vsig2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57276 MGI:1928009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64011 MGI:1927184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 123 ESTs, 2 Proteins

name	Spa17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20686 MGI:1333778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22619 MGI:104803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21376 MGI:1100877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Panx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208098 MGI:1918881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG627798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627798 MGI:3643577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 508 ESTs, 7 Proteins

name	Olfr160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80706 MGI:1931271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406176 MGI:2661338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258882 MGI:3030708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D730048I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301194 GeneID:68171 MGI:1915421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D730048I06 gene transcript_id : NM_026593.3

name	9230110F15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386056 GeneID:77080 MGI:1924330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9230110F15 gene transcript_id : XM_134713.4

name	LOC100041605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259867 GeneID:100041605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041605 transcript_id : XM_001476672.1

name	9230113P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259903 GeneID:77908 MGI:1925158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : RIKEN cDNA 9230113P08 gene transcript_id : XM_001478373.1

name	EG546123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386057 GeneID:546123 MGI:3643162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG546123 transcript_id : XM_620739.3

name	LOC100041618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259869 GeneID:100041618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041618 transcript_id : XM_001476695.1

name	LOC100042485 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259907 GeneID:100042485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to sc328 transcript_id : XM_001478386.1

name	EG639025 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386058 GeneID:639025 MGI:3647831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG639025 transcript_id : XM_986261.1

name	LOC671003 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259871 GeneID:671003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to secreted seminal vesicle Ly-6 protein 1 transcript_id : XM_001476733.1

name	EG434396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381555 GeneID:434396 MGI:3647347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434396 transcript_id : NM_001033783.2

name	A630095E13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485647 GeneID:235973 MGI:3055869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630095E13 gene transcript_id : NM_001033325.2

name	Acrv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326405 GeneID:11451 MGI:104590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acrosomal vesicle protein 1 transcript_id : NM_007391.2

name	Chek1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801678 GeneID:12649 MGI:1202065
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : checkpoint kinase 1 homolog (S. pombe) transcript_id : NM_007691.3

name	Stt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367166 GeneID:16430 MGI:105124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) transcript_id : NM_008408.3

name	Ei24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386127 GeneID:13663 MGI:108090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : etoposide induced 2.4 mRNA transcript_id : NM_007915.2

name	Fez1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349734 GeneID:235180 MGI:2670976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fasciculation and elongation protein zeta 1 (zygin I) transcript_id : NM_183171.2

name	Pknox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067109 GeneID:208076 MGI:2445415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pbx/knotted 1 homeobox 2 transcript_id : NM_148950.2

name	Pknox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067111 GeneID:208076 MGI:2445415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pbx/knotted 1 homeobox 2 transcript_id : NM_001029838.1

name	LOC100042545 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259909 GeneID:100042545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042545 transcript_id : XM_001478478.1

name	1810021J13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981293 GeneID:66279 MGI:1913529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810021J13 gene transcript_id : NM_025464.2

name	Slc37a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373673 GeneID:56857 MGI:1929693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 37 (glycerol-3-phosphate transporter), member 2 transcript_id : NM_020258.3

name	LOC100042561 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259913 GeneID:100042561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 244 ESTs, 3 Proteins product : similar to SEC61 gamma transcript_id : XM_001478520.1

name	Ccdc15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487468 GeneID:245902 MGI:2444488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 15 transcript_id : NM_001081429.1

name	Hepacam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992944 GeneID:72927 MGI:1920177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatocyte cell adhesion molecule transcript_id : NM_175189.4

name	Robo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27229186 GeneID:74144 MGI:1921394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : roundabout homolog 4 (Drosophila) transcript_id : NM_028783.2

name	Robo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259875 GeneID:19649 MGI:1343102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 6 Proteins product : roundabout homolog 3 (Drosophila) transcript_id : XM_001476840.1

name	BC024479 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734475 GeneID:235184 MGI:2384579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024479 transcript_id : NM_146222.2

name	Esam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801984 GeneID:69524 MGI:1916774
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial cell-specific adhesion molecule transcript_id : NM_027102.2

name	Vsig2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145510 GeneID:57276 MGI:1928009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : V-set and immunoglobulin domain containing 2 transcript_id : NM_020518.2

name	Nrgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259917 GeneID:64011 MGI:1927184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 123 ESTs, 2 Proteins product : neurogranin transcript_id : XM_001478626.1

name	Spa17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755613 GeneID:20686 MGI:1333778
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm autoantigenic protein 17 transcript_id : NM_011449.1

name	Siae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802058 GeneID:22619 MGI:104803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid acetylesterase transcript_id : NM_011734.3

name	Tbrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607162 GeneID:21376 MGI:1100877
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor beta regulated gene 1 transcript_id : NM_025289.2

name	Panx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262154 GeneID:208098 MGI:1918881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pannexin 3 transcript_id : NM_172454.2

name	EG627798 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386060 GeneID:627798 MGI:3643577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 507 ESTs, 7 Proteins product : predicted gene, EG627798 transcript_id : XM_892497.2

name	Olfr160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386471 GeneID:80706 MGI:1931271
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 160 transcript_id : NM_030553.1

name	Olfr151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575898 GeneID:406176 MGI:2661338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 151 transcript_id : NM_207664.1

name	Olfr874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529464 GeneID:258882 MGI:3030708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 874 transcript_id : NM_146882.2

name	D730048I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386080 GeneID:68171 MGI:1915421
definition	codon_start : 1 product : hypothetical protein LOC68171 protein_id : NP_080869.1

name	9230110F15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20884471 GeneID:77080 MGI:1924330
definition	codon_start : 1 product : hypothetical protein LOC77080 protein_id : XP_134713.1

name	LOC100041605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259868 GeneID:100041605
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476722.1

name	9230113P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259904 GeneID:77908 MGI:1925158
definition	codon_start : 1 product : hypothetical protein LOC77908 protein_id : XP_001478423.1

name	EG546123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63586379 GeneID:546123 MGI:3643162
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620739.1

name	LOC100041618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259870 GeneID:100041618
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476745.1

name	LOC100042485 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259908 GeneID:100042485
definition	codon_start : 1 product : similar to sc328 protein_id : XP_001478436.1

name	EG639025 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386059 GeneID:639025 MGI:3647831
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991355.1

name	LOC671003 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259872 GeneID:671003
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476783.1

name	EG434396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702097 GeneID:434396 MGI:3647347
definition	codon_start : 1 product : hypothetical protein LOC434396 protein_id : NP_001028955.1

name	A630095E13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776588 CCDS:CCDS22970.1 GeneID:235973 MGI:3055869
definition	codon_start : 1 product : secreted seminal vesicle Ly-6 protein 1 protein_id : NP_001028497.1

name	Acrv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326406 CCDS:CCDS22971.1 GeneID:11451 MGI:104590
definition	GO_component : GO:0001669 - acrosome [Evidence IDA] codon_start : 1 note : acrosomal vesicle protein 1 (MGD\|MGI:104590 GB\|NM_007391, evidence: BLASTN, 99%, match=1065); putative; acrosomal protein SP-10 product : acrosomal vesicle protein 1 protein_id : NP_031417.2

name	Chek1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542385 CCDS:CCDS22972.1 GeneID:12649 MGI:1202065
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0000077 - DNA damage checkpoint [Evidence IDA] [Evidence IMP]; GO:0006281 - DNA repair [Evidence IDA]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA] codon_start : 1 note : rad27 homolog product : checkpoint kinase 1 homolog protein_id : NP_031717.2

name	Stt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560680 GeneID:16430 MGI:105124
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA]; GO:0004576 - oligosaccharyl transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : intergral membrane protein 1 protein_id : NP_032434.2

name	Ei24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681289 CCDS:CCDS22973.1 GeneID:13663 MGI:108090
definition	codon_start : 1 product : etoposide induced 2.4 protein_id : NP_031941.1

name	Fez1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147207 GeneID:235180 MGI:2670976
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0043015 - gamma-tubulin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : fasciculation and elongation protein zeta 1 (zygin I) protein_id : NP_898994.1

name	Pknox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067112 CCDS:CCDS22974.1 GeneID:208076 MGI:2445415
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0003785 - actin monomer binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : homeodomain containing transcription factor PREP2 product : Pbx/knotted 1 homeobox 2 protein_id : NP_001025009.1

name	Pknox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067110 CCDS:CCDS22974.1 GeneID:208076 MGI:2445415
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0003785 - actin monomer binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : homeodomain containing transcription factor PREP2 product : Pbx/knotted 1 homeobox 2 protein_id : NP_683752.2

name	LOC100042545 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259910 GeneID:100042545
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478528.1

name	1810021J13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384878 CCDS:CCDS22975.1 GeneID:66279 MGI:1913529
definition	codon_start : 1 product : hypothetical protein LOC66279 protein_id : NP_079740.1

name	Slc37a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560349 GeneID:56857 MGI:1929693
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015169 - glycerol-3-phosphate transporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006072 - glycerol-3-phosphate metabolism [Evidence ISS]; GO:0015794 - glycerol-3-phosphate transport [Evidence ISS]; GO:0006127 - glycerophosphate shuttle [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cAMP inducible 2 protein; cAMP inducible gene 2; solute carrier family 37 (glycerol-3-phosphate transporter), member 1 product : solute carrier family 37 (glycerol-3-phosphate transporter), member 2 protein_id : NP_064654.2

name	LOC100042561 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259914 GeneID:100042561
definition	codon_start : 1 product : similar to SEC61 gamma protein_id : XP_001478570.1

name	Ccdc15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487469 GeneID:245902 MGI:2444488
definition	codon_start : 1 product : coiled-coil domain containing 15 protein_id : NP_001074898.1

name	Hepacam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56790921 CCDS:CCDS22976.1 GeneID:72927 MGI:1920177
definition	codon_start : 1 product : hepatocyte cell adhesion molecule protein_id : NP_780398.2

name	Robo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229187 CCDS:CCDS22977.1 GeneID:74144 MGI:1921394
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA] codon_start : 1 note : Magic roundabout product : roundabout homolog 4 protein_id : NP_083059.2

name	Robo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259876 GeneID:19649 MGI:1343102
definition	codon_start : 1 product : roundabout homolog 3 protein_id : XP_001476890.1

name	BC024479 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734476 CCDS:CCDS22978.1 GeneID:235184 MGI:2384579
definition	codon_start : 1 product : hypothetical protein LOC235184 protein_id : NP_666334.2

name	Esam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094995 CCDS:CCDS22979.1 GeneID:69524 MGI:1916774
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence TAS]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence IDA]; GO:0007156 - homophilic cell adhesion [Evidence IDA] codon_start : 1 product : endothelial cell-selective adhesion molecule protein_id : NP_081378.1

name	Vsig2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145511 CCDS:CCDS22980.1 GeneID:57276 MGI:1928009
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : CTM product : cortical thymocyte receptor (X. laevis CTX) like protein_id : NP_065264.2

name	Nrgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259918 GeneID:64011 MGI:1927184
definition	codon_start : 1 product : neurogranin protein_id : XP_001478676.1

name	Spa17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755614 CCDS:CCDS22982.1 GeneID:20686 MGI:1333778
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : band 34 product : sperm autoantigenic protein 17 protein_id : NP_035579.1

name	Siae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560532 CCDS:CCDS22983.1 GeneID:22619 MGI:104803
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA]; GO:0001681 - sialate O-acetylesterase activity [Evidence IEA] codon_start : 1 note : clone 165 product : yolk sac gene 2 protein_id : NP_035864.2

name	Tbrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476294 GeneID:21376 MGI:1100877
definition	codon_start : 1 product : transforming growth factor beta regulated gene 1 protein_id : NP_079565.1

name	Panx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262155 CCDS:CCDS22984.1 GeneID:208098 MGI:1918881
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : pannexin 3 protein_id : NP_766042.2

name	EG627798 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82929887 GeneID:627798 MGI:3643577
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897590.1

name	Olfr160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386472 GeneID:80706 MGI:1931271
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor 7b; GA_x6K02T2PVTD-31389446-31388517; olfactory receptor MOR171-3 product : olfactory receptor 160 protein_id : NP_085030.1

name	Olfr151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575899 GeneID:406176 MGI:2661338
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-31408136-31407207; M71 odorant receptor product : olfactory receptor 151 protein_id : NP_997547.1

name	Olfr874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529465 CCDS:CCDS22986.1 GeneID:258882 MGI:3030708
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31428850-31429782; olfactory receptor MOR161-2; odorant receptor K22 product : olfactory receptor 874 protein_id : NP_667093.2

name	LOC666881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666881
definition	number : 1 pseudo : _no_value

name	LOC666881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666881
definition	number : 2 pseudo : _no_value

name	LOC627681 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259873 GeneID:627681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins product : similar to nucleolar protein 5A pseudo : _no_value transcript_id : XR_032917.1

clone name	MSMg01-288C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-126N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-186H07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-143K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-211D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-316O18.b	B6Ng01-316O18.g
ACC	GA107197	GA107198
length	1,043	1,158
definition	B6Ng01-316O18.b	B6Ng01-316O18.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	atatgtaatctgttggctgacttattcctaattttcccattctgagttga tttgtaatacaattttgtgcacatcttttgtgcacatcttttgtgcatat cttttgtaaatatcttcactgacaattacagattagctataattataact agctagtctgctatcaaaaattcatcctgctctcttttgttttgtatttg agaagagacaaggtctcactatggttctcactgacctagaactctccgtg tagaccacatagcctacaactcatagaaatcttcctgtctctgctcctca ccatgccaccatgtccgctctccttattaattaattaattgaatttaaga tttatttatggtctggagagatggctcagatgttaatagtactgacttct cttccagaggtcctaagttcaattcccagcaaccacatggtggctcacaa ccatctgtaatgagattggatgccctcctctggtgtgtctgaagatagct acagtgtactcatatacataaaataaataaatattttttttaaatttaat tatttattttgtttgcttttatttcgagacagggtttctctgtatagccc tggctgtcctggaactcctttgtagaccaggctggccttgaactcagaga tccgccctgcctctgcctcccaagtgctgggattaaaggcgtaaaatatt tatttattatgtataaattgttctgcctgcaggccagaagagggcatctg accttattataggtggttgtgagccaccatgtgggaattgaactcaggac atctggacgagcagacagatttagccatctctccagggatctctctctcc cccaccccgtctcctttttgttaaaaggaatattactcctaaaaaacgac gactttactttaatcacttagaatcctaaaaggtagtgtctttttagaaa cagggttctattaaaaaaaaacagagccttcaataatcttcctatttttc cccccctcaacggccctttttatttccatttttagggtgcatg	gaattctcacctgaggaataccgaatggcagagaagcacttgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaactggacatagtactaccagatgatccagcaatacctctcctgggc atatatccagaagatgccccaacaggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacctagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa gaaactcacacaatatgtactcactgataagtggatattagccccaaacc taggatacccaagatatatgatataatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtggacactatgcccctccttagatttgggaa caaaacacccatggaaagagttacagagacaaagtttggagctgagatga aaggatggaccatgtagagactgccatatccagggatccaccccataatc agcatccaaacgctgacaccattgcatacactagcaagattttattgaaa ggacccagatgtagctgtctcttgtgagactatgcccggggccctagcaa acacagaagtggatgctcacagtcagctaatggatgaatcatagggctcc caatggagagctagagaaagtagccaaggagctaaagggatctacaccta tagtgacacattatggactaaccagtacccgagctctgacttcttagctg catatatatcaaaggattgcttagtcaggcatcactgaaagaaaagccaa tgactgccactaaatgccagttacaggactcaaggccaaaaggggccatt gggtgtgg
quality values	Open. Hide. 30 58 54 58 62 62 52 62 47 62 62 54 62 62 62 47 62 62 62 25 39 62 54 35 14 10 6 6 8 11 10 35 45 49 46 46 56 59 44 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 43 34 46 23 32 28 28 34 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 54 62 59 62 62 62 62 62 59 59 59 62 62 62 59 62 59 59 59 50 43 54 56 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 62 62 62 39 62 54 62 62 62 54 42 62 62 62 62 62 62 62 62 54 62 62 42 35 9 24 35 43 52 42 62 62 62 62 62 62 62 62 62 62 62 54 39 49 52 37 52 52 52 54 42 58 54 58 58 54 58 58 58 58 54 58 35 34 42 42 54 54 54 54 58 52 58 32 58 50 49 37 15 21 20 30 42 58 52 58 37 58 58 58 54 42 54 54 46 42 58 31 42 50 32 37 31 19 52 42 54 58 58 54 53 45 39 50 37 25 29 38 58 52 54 52 42 53 53 50 54 58 58 51 41 23 49 25 58 49 50 48 28 32 41 51 49 47 37 41 53 58 58 49 49 46 58 45 45 41 25 38 47 48 40 32 39 21 51 51 51 32 37 40 49 50 50 37 16 48 50 50 50 32 17 21 36 52 32 16 42 16 19 41 21 51 51 28 39 35 23 23 39 41 27 32 40 26 33 34 48 31 31 31 10 43 28 41 25 22 32 39 39 50 40 32 50 35 29 36 41 35 31 33 40 50 49 52 34 22 32 33 47 41 34 31 30 32 16 7 29 32 32 31 39 45 39 20 33 30 20 19 32 10 40 42 22 51 28 28 29 34 11 54 11 51 12 19 26 32 34 34 42 31 30 14 29 21 16 38 21 32 23 25 37 53 40 53 42 37 35 29 32 31 21 21 26 31 40 42 41 32 32 33 32 23 12 14 49 51 51 9 12 17 32 8 47 47 22 11 17 38 15 14 9 9 35 18 20 30 33 31 37 22 45 45 37 51 9 32 23 42 31 9 31 28 22 51 45 24 26 33 32 27 23 19 32 33 21 30 42 23 28 19 33 30 22 38 25 29 23 32 25 6 10 20 12 9 25 22 31 26 15 23 26 46 33 9 14 24 39 37 25 16 11 11 35 14 21 26 31 29 31 33 14 31 31 41 13 18 19 7 29 6 10 6 13 32 7 14 24 30 31 5 5 15 7 21 30 41 25 17 12 8 5 7 7 20 42 44 41 9 14 42 42 33 27 36 13 8 6 21 17 32 16 14 5 21 9 33 32 36 32 13 4 6 13 8 22 15 6 32 22 21 9 9 4 4 18 25 5 15 10 5 6 5	Open. Hide. 62 35 43 47 62 62 62 47 51 47 22 23 21 11 13 21 21 21 21 30 43 62 59 62 62 62 62 62 59 59 59 59 59 59 62 59 62 62 59 62 62 59 59 62 62 62 62 62 59 62 62 62 59 62 56 59 59 59 56 43 43 54 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 35 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 54 32 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 54 58 58 54 54 58 58 58 58 45 54 58 58 58 58 58 58 58 58 58 58 58 58 42 42 58 58 58 58 58 52 58 54 54 54 58 58 58 58 58 52 58 52 58 58 54 58 58 54 58 58 58 52 58 54 58 51 58 58 58 58 58 58 58 58 58 58 50 49 58 58 45 51 50 58 50 58 58 51 51 39 47 51 58 54 53 58 58 58 58 52 58 58 54 54 58 51 58 58 37 52 53 53 58 58 35 58 54 58 50 52 53 42 51 54 58 39 50 51 58 50 53 58 58 51 49 51 33 58 53 53 38 51 34 58 58 58 41 43 50 53 51 50 51 40 58 43 39 58 40 41 58 58 49 40 46 39 53 58 58 49 41 53 53 42 58 44 49 37 39 53 53 53 53 54 54 38 54 51 52 54 39 39 52 42 28 35 16 54 53 53 54 40 47 49 45 31 54 54 40 38 41 50 54 51 40 40 47 54 46 54 49 42 49 26 42 53 40 52 39 52 54 19 34 32 24 54 53 34 53 54 51 52 45 54 22 53 42 32 46 19 31 30 40 53 52 52 31 39 32 28 52 36 17 14 53 34 31 42 37 40 32 53 33 34 32 32 53 32 40 23 32 36 41 31 45 31 31 46 36 16 23 30 30 32 23 32 40 42 31 43 31 31 31 30 26 38 36 31 32 34 33 34 51 30 31 32 43 31 31 33 28 24 31 46 26 37 38 43 36 31 30 31 34 26 31 32 31 29 43 30 30 31 36 31 48 47 32 31 43 31 38 19 46 33 16 36 15 15 47 32 29 21 27 15 31 32 22 19 32 38 31 31 36 34 30 32 16 30 30 30 28 12 7 6 31 22 31 32 22 44 13 32 48 44 24 7 44 19 33 31 21 28 20 48 35 21 23 30 29 31 38 42 16 22 25 19 23 19 38 34 33 31 18 31 21 31 32 33 31 17 32 34 18 26 19 21 26 6 9 29 22 34 23 23 15 27 10 13 37 22 27 32 14 43 26 5 11 26 18 26 9 7 4 5 12 30 18 10 18 18 32 47 22 18 28 23 16 18 21 9 10 24 9 27 9 24 28 13 38 21 21 34 21 7 20 16 22 12 8 32 16 27 14 18 22 11 22 10 9 3 5 12 6 5 21 8 17 20 11 7 24 7 16 16 15 15 18 20 16 21 11 18 29 15 13 8 7 19 8 6 7 11 10 8 8 6 9 8 7 6 16 23 13 15 21 16 13 6 16 8 10 13 21 14 21 28 25 5 7 25 8 6 10 3 3 8 18 8 11 21 16 9 6 18 11 19 11 5 6 4 2 5 13 6 6 4 15 10 7 12 2 7 4 5 14 9 8 4 3 3 5 4 11 3 3 1 3 5 7 4 3 8 6 5 4 6 14 13 4 15 3 3 2 1 7 4 4 17 17 5 4 8 3 20 6 14 28 26 22 3 3 17 6 7 3 2 3 5 6 4 6 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_36577536_36578563
seq2: B6Ng01-316O18.b_57_1099 (reverse)

seq1  CATGCACCCTAAAA--GGGAATAAAAAAGACCGTTGAGGGGGG--AAAAT  46
      ||||||||||||||  || |||||||| | |||||||||||||  |||||
seq2  CATGCACCCTAAAAATGGAAATAAAAAGGGCCGTTGAGGGGGGGAAAAAT  50

seq1  ATGAAGATTATTGAAAGCTCTG--TTTTTTTAATAGAA-CCTGTTTCT-A  92
      | ||||||||||||| ||||||  |||||||||||||| ||||||||| |
seq2  AGGAAGATTATTGAAGGCTCTGTTTTTTTTTAATAGAACCCTGTTTCTAA  100

seq1  AAAGACACTACC-TTTAGGATTCTAAGTGATTAAAGTAAAGTCGTCG-TT  140
      |||||||||||| |||||||||||||||||||||||||||||||||| ||
seq2  AAAGACACTACCTTTTAGGATTCTAAGTGATTAAAGTAAAGTCGTCGTTT  150

seq1  TTTAGGAGTAATATTCCTTTTAAC-AAAAGGAGACGGGGTGGGGGAGAGA  189
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TTTAGGAGTAATATTCCTTTTAACAAAAAGGAGACGGGGTGGGGGAGAGA  200

seq1  GAGAT-CCTGGAGAGATGGCT-AATCTGTCTGCTCGTCCAGATGTCCTGA  237
      ||||| ||||||||||||||| ||||||||||||||||||||||||||||
seq2  GAGATCCCTGGAGAGATGGCTAAATCTGTCTGCTCGTCCAGATGTCCTGA  250

seq1  GTTCAATTCCCACATGGTGGCTCACAACCACCTATAATAAGGTCAGATGC  287
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAATTCCCACATGGTGGCTCACAACCACCTATAATAAGGTCAGATGC  300

seq1  CCTCTTCTGGCCTGCAGGCAGAACAATTTATACATAATAAATAAATATTT  337
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTCTGGCCTGCAGGCAGAACAATTTATACATAATAAATAAATATTT  350

seq1  TACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCA-GGCGGATCTCTGA  386
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGGCGGATCTCTGA  400

seq1  GTTCAAGGCCAGCCTGGTCTACAAAGGAGTTCCAGGACAGCCAGGGCTAT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAAGGCCAGCCTGGTCTACAAAGGAGTTCCAGGACAGCCAGGGCTAT  450

seq1  ACAGAGAAACCCTGTCTCGAAATAAAAGCAAACAAAATAAATAATTAAAT  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAGAAACCCTGTCTCGAAATAAAAGCAAACAAAATAAATAATTAAAT  500

seq1  TTAAAAAAAATATTTATTTATTTTATGTATATGAGTACACTGTAGCTATC  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAAAAATATTTATTTATTTTATGTATATGAGTACACTGTAGCTATC  550

seq1  TTCAGACACACCAGAGGAGGGCATCCAATCTCATTACAGATGGTTGTGAG  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGACACACCAGAGGAGGGCATCCAATCTCATTACAGATGGTTGTGAG  600

seq1  CCACCATGTGGTTGCTGGGAATTGAACTTAGGACCTCTGGAAGAGAAGTC  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCATGTGGTTGCTGGGAATTGAACTTAGGACCTCTGGAAGAGAAGTC  650

seq1  AGTACTATTAACATCTGAGCCATCTCTCCAGACCATAAATAAATCTTAAA  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACTATTAACATCTGAGCCATCTCTCCAGACCATAAATAAATCTTAAA  700

seq1  TTCAATTAATTAATTAATAAGGAGAGCGGACATGGTGGCATGGTGAGGAG  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAATTAATTAATTAATAAGGAGAGCGGACATGGTGGCATGGTGAGGAG  750

seq1  CAGAGACAGGAAGATTTCTATGAGTTGTAGGCTATGTGGTCTACACGGAG  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGACAGGAAGATTTCTATGAGTTGTAGGCTATGTGGTCTACACGGAG  800

seq1  AGTTCTAGGTCAGTGAGAACCATAGTGAGACCTTGTCTCTTCTCAAATAC  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCTAGGTCAGTGAGAACCATAGTGAGACCTTGTCTCTTCTCAAATAC  850

seq1  AAAACAAAAGAGAGCAGGATGAATTTTTGATAGCAGACTAGCTAGTTATA  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAAAAGAGAGCAGGATGAATTTTTGATAGCAGACTAGCTAGTTATA  900

seq1  ATTATAGCTAATCTGTAATTGTCAGTGAAGATATTTACAAAAGATATGCA  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATAGCTAATCTGTAATTGTCAGTGAAGATATTTACAAAAGATATGCA  950

seq1  CAAAAGATGTGCACAAAAGATGTGCACAAAATTGTATTACAAATCAACTC  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGATGTGCACAAAAGATGTGCACAAAATTGTATTACAAATCAACTC  1000

seq1  AGAATGGGAAAATTA-CAATAAGTCAGCCAACAGATTACATAT  1028
      |||||||||||||||  ||||||||||||||||||||||||||
seq2  AGAATGGGAAAATTAGGAATAAGTCAGCCAACAGATTACATAT  1043

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information