MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-320L18
Chromosome	9 (Build37)
Map Location	43,528,022 - 43,684,362
singlet/doublet	doublet
Overlap gene	Pvrl1, LOC100042548
Upstream gene	Grik4, Arhgef12, LOC545339, Tmem136, Pou2f3, LOC628726, Oaf, D630033O11Rik, Trim29, LOC384931
Downstream gene	Thy1, Usp2, Mfrp, Rnf26, LOC100042569, Mcam, Cbl, BC038167, Pdzd3, Nlrx1, Abcg4, Mizf, Tmem24, Dpagt1, H2afx, Hmbs, Vps11, LOC100043172, Hyou1, LOC100043178, Slc37a4, Trappc4, Rps25, Ccdc84, Foxr1, Upk2, Bcl9l, Blr1, Ddx6, LOC667406, LOC100042660, Treh, Phldb1, Arcn1, 1500035H01Rik, Tmem25, BC021608, Mll1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Grik4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110637 MGI:95817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69632 MGI:1916882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545339 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 217 ESTs, 3 Proteins

name	Tmem136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235300 MGI:2685030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pou2f3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18988 MGI:102565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Oaf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102644 MGI:94852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630033O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235302 MGI:2685434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Trim29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72169 MGI:1919419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Pvrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58235 MGI:1926483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042548 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	Thy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21838 MGI:98747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53376 MGI:1858178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mfrp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259172 MGI:2385957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rnf26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213211 MGI:2388131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Mcam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84004 MGI:1933966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12402 MGI:88279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270150 MGI:2448587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170761 MGI:2429554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270151 MGI:2429611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192663 MGI:1890594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mizf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102423 MGI:2429620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71764 MGI:1919014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpagt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13478 MGI:1196396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2afx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15270 MGI:102688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmbs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15288 MGI:96112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71732 MGI:1918982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043172 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 402 ESTs, 32 Proteins pseudo : _no_value

name	Hyou1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12282 MGI:108030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	Slc37a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14385 MGI:1316650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60409 MGI:1926211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75617 MGI:1922867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382073 MGI:2685960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382074 MGI:2685961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22269 MGI:98913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl9l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80288 MGI:1933114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12145 MGI:103567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13209 MGI:104976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100042660 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Treh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58866 MGI:1926230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phldb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102693 MGI:2143230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arcn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213827 MGI:2387591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500035H01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76568 MGI:1923818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71687 MGI:1918937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021608 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192653 MGI:2384760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mll1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214162 MGI:96995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grik4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802216 GeneID:110637 MGI:95817
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 4 transcript_id : NM_175481.3

name	Arhgef12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046272 GeneID:69632 MGI:1916882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 12 transcript_id : NM_027144.2

name	LOC545339 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94386061 GeneID:545339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 216 ESTs, 3 Proteins product : similar to SP140 nuclear body protein family member, transcript variant 4 transcript_id : XM_901143.2

name	Tmem136 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802939 GeneID:235300 MGI:2685030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 136 transcript_id : NM_001034863.2

name	Pou2f3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226248 GeneID:18988 MGI:102565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 3 transcript_id : NM_011139.2

name	Oaf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130610 GeneID:102644 MGI:94852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OAF homolog (Drosophila) transcript_id : NM_178644.3

name	D630033O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259945 GeneID:235302 MGI:2685434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA D630033O11 gene transcript_id : XM_001479244.1

name	Trim29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789214 GeneID:72169 MGI:1919419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 29 transcript_id : NM_023655.1

name	Pvrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254533 GeneID:58235 MGI:1926483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poliovirus receptor-related 1 transcript_id : NM_021424.2

name	LOC100042548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259911 GeneID:100042548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : similar to HVEC cell-cell adhesion molecule/herpesvirus receptor; HveC; PRR; PRR1; HigR; nectin-1 transcript_id : XM_001478419.1

name	Thy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134152684 GeneID:21838 MGI:98747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymus cell antigen 1, theta transcript_id : NM_009382.3

name	Usp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052497 GeneID:53376 MGI:1858178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 2 transcript_id : NM_198092.2

name	Usp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052501 GeneID:53376 MGI:1858178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 2 transcript_id : NM_016808.2

name	Usp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052525 GeneID:53376 MGI:1858178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 2 transcript_id : NM_198091.2

name	Mfrp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95147557 GeneID:259172 MGI:2385957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : membrane-type frizzled-related protein transcript_id : NM_147126.2

name	Rnf26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262132 GeneID:213211 MGI:2388131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 26 transcript_id : NM_153762.3

name	LOC100042569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259915 GeneID:100042569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042569 transcript_id : XM_001478439.1

name	Mcam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746443 GeneID:84004 MGI:1933966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma cell adhesion molecule transcript_id : NM_023061.1

name	Cbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80978931 GeneID:12402 MGI:88279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Casitas B-lineage lymphoma transcript_id : NM_007619.2

name	BC038167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486952 GeneID:270150 MGI:2448587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038167 transcript_id : NM_001081369.1

name	Pdzd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875383 GeneID:170761 MGI:2429554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 3 transcript_id : NM_133226.1

name	Nlrx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341501 GeneID:270151 MGI:2429611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family member X1 transcript_id : NM_178420.2

name	Abcg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144926010 GeneID:192663 MGI:1890594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family G (WHITE), member 4 transcript_id : NM_138955.3

name	Mizf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385795 GeneID:102423 MGI:2429620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MBD2-interacting zinc finger transcript_id : NM_172162.2

name	Tmem24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900514 GeneID:71764 MGI:1919014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 24 transcript_id : NM_027909.2

name	Dpagt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982408 GeneID:13478 MGI:1196396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichyl-phosphate (UDP-N-acetylglucosamine) acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase) transcript_id : NM_007875.2

name	H2afx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981698 GeneID:15270 MGI:102688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2A histone family, member X transcript_id : NM_010436.2

name	Hmbs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794511 GeneID:15288 MGI:96112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxymethylbilane synthase transcript_id : NM_013551.1

name	Vps11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037258 GeneID:71732 MGI:1918982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 11 (yeast) transcript_id : NM_027889.1

name	Hyou1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542332 GeneID:12282 MGI:108030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxia up-regulated 1 transcript_id : NM_021395.2

name	LOC100043178 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259948 GeneID:100043178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : hypothetical protein LOC100043178 transcript_id : XM_001479485.1

name	Slc37a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592075 GeneID:14385 MGI:1316650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 37 (glucose-6-phosphate transporter), member 4 transcript_id : NM_008063.2

name	Trappc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982682 GeneID:60409 MGI:1926211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 4 transcript_id : NM_021789.2

name	Rps25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491883 GeneID:75617 MGI:1922867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S25 transcript_id : NM_024266.3

name	Ccdc84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886488 GeneID:382073 MGI:2685960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 84 transcript_id : NM_201372.3

name	Foxr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388011 GeneID:382074 MGI:2685961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box R1 transcript_id : NM_001033469.2

name	Upk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949818 GeneID:22269 MGI:98913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroplakin 2 transcript_id : NM_009476.2

name	Bcl9l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206399 GeneID:80288 MGI:1933114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 9-like transcript_id : NM_030256.2

name	Blr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475949 GeneID:12145 MGI:103567
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Burkitt lymphoma receptor 1 transcript_id : NM_007551.2

name	Ddx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342194 GeneID:13209 MGI:104976
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 transcript_id : NM_181324.2

name	Ddx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131155 GeneID:13209 MGI:104976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 transcript_id : NM_007841.3

name	Treh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130466 GeneID:58866 MGI:1926230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trehalase (brush-border membrane glycoprotein) transcript_id : NM_021481.2

name	Phldb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38455421 GeneID:102693 MGI:2143230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology-like domain, family B, member 1 transcript_id : NM_153537.3

name	Arcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020741 GeneID:213827 MGI:2387591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : archain 1 transcript_id : NM_145985.3

name	1500035H01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802295 GeneID:76568 MGI:1923818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500035H01 gene transcript_id : NM_023831.3

name	Tmem25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373326 GeneID:71687 MGI:1918937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 25 transcript_id : NM_027865.2

name	BC021608 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20336733 GeneID:192653 MGI:2384760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021608 transcript_id : NM_138951.1

name	Mll1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486681 GeneID:214162 MGI:96995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed-lineage leukemia 1 transcript_id : NM_001081049.1

name	Grik4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348983 CCDS:CCDS23089.1 GeneID:110637 MGI:95817
definition	GO_component : GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004970 - ionotropic glutamate receptor activity [Evidence TAS] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glutamate receptor KA1 precursor protein_id : NP_780690.1

name	LOC545339 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82929869 GeneID:545339
definition	codon_start : 1 product : similar to SP140 nuclear body protein family member isoform 4 protein_id : XP_906236.1

name	Arhgef12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046273 GeneID:69632 MGI:1916882
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : leukemia-associated Rho guanine-nucleotide exchange factor product : Rho guanine nucleotide exchange factor 12 protein_id : NP_081420.2

name	Tmem136 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702201 CCDS:CCDS23090.1 GeneID:235300 MGI:2685030
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC235300 protein_id : NP_001030035.1

name	Pou2f3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226249 GeneID:18988 MGI:102565
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : POU domain, class 2, transcription factor 3 protein_id : NP_035269.2

name	Oaf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520003 CCDS:CCDS23091.1 GeneID:102644 MGI:94852
definition	codon_start : 1 product : out at first protein_id : NP_848759.1

name	D630033O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259946 GeneID:235302 MGI:2685434
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479294.1

name	Trim29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789215 GeneID:72169 MGI:1919419
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : tripartite motif protein 29 protein_id : NP_076144.1

name	Pvrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254534 CCDS:CCDS23092.1 GeneID:58235 MGI:1926483
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence IDA]; GO:0007156 - homophilic cell adhesion [Evidence IDA] codon_start : 1 note : nectin-1 delta; nectin-1 alpha product : poliovirus receptor-related 1 protein_id : NP_067399.2

name	LOC100042548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259912 GeneID:100042548
definition	codon_start : 1 product : similar to HVEC cell-cell adhesion molecule/herpesvirus receptor; HveC; PRR; PRR1; HigR; nectin-1 protein_id : XP_001478469.1

name	Thy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678347 CCDS:CCDS23093.1 GeneID:21838 MGI:98747
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0030426 - growth cone [Evidence ISS]; GO:0045121 - lipid raft [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0048503 - GPI anchor binding [Evidence ISS] [Evidence IEA]; GO:0005100 - Rho GTPase activator activity [Evidence ISS] GO_process : GO:0001525 - angiogenesis [Evidence IDA]; GO:0016337 - cell-cell adhesion [Evidence ISS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0048041 - focal adhesion formation [Evidence ISS]; GO:0045576 - mast cell activation [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0050771 - negative regulation of axonogenesis [Evidence ISS]; GO:0030336 - negative regulation of cell migration [Evidence ISS]; GO:0048147 - negative regulation of fibroblast proliferation [Evidence ISS]; GO:0006469 - negative regulation of protein kinase activity [Evidence ISS]; GO:0050860 - negative regulation of T cell receptor signaling pathway [Evidence IDA]; GO:0043547 - positive regulation of GTPase activity [Evidence ISS]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence ISS]; GO:0051281 - positive regulation of release of sequestered calcium ion into cytosol [Evidence ISS]; GO:0050870 - positive regulation of T cell activation [Evidence ISS]; GO:0046549 - retinal cone cell development [Evidence IMP]; GO:0050852 - T cell receptor signaling pathway [Evidence ISS] codon_start : 1 note : Thy 1.2 product : thymus cell antigen 1, theta protein_id : NP_033408.1

name	Usp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052502 GeneID:53376 MGI:1858178
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : isoform Usp2-69 is encoded by transcript variant 1; ubiquitin specific protease 2; deubiquitinating enzyme product : ubiquitin-specific protease 2 isoform Usp2-69 protein_id : NP_058088.2

name	Usp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052498 CCDS:CCDS23094.1 GeneID:53376 MGI:1858178
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : isoform Usp2-69 is encoded by transcript variant 3; ubiquitin specific protease 2; deubiquitinating enzyme product : ubiquitin-specific protease 2 isoform Usp2-69 protein_id : NP_932760.2

name	Usp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674279 CCDS:CCDS23095.1 GeneID:53376 MGI:1858178
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : isoform Usp2-45 is encoded by transcript variant 2; ubiquitin specific protease 2; deubiquitinating enzyme product : ubiquitin-specific protease 2 isoform Usp2-45 protein_id : NP_932759.1

name	Mfrp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128653 GeneID:259172 MGI:2385957
definition	GO_process : GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : retinal degeneration 6 product : membrane-type frizzled-related protein protein_id : NP_667337.1

name	Rnf26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048336 CCDS:CCDS23096.1 GeneID:213211 MGI:2388131
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 26 protein_id : NP_717095.2

name	LOC100042569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259916 GeneID:100042569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478489.1

name	Mcam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746444 CCDS:CCDS23097.1 GeneID:84004 MGI:1933966
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation note : l-gicerin protein; melanoma adhesion molecule product : melanoma cell adhesion molecule protein_id : NP_075548.1

name	Cbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80978932 GeneID:12402 MGI:88279
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : Casitas B-lineage lymphoma protein_id : NP_031645.2

name	BC038167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486953 GeneID:270150 MGI:2448587
definition	codon_start : 1 product : hypothetical protein LOC270150 protein_id : NP_001074838.1

name	Pdzd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875384 CCDS:CCDS23099.1 GeneID:170761 MGI:2429554
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030251 - guanylate cyclase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA] GO_process : GO:0007168 - receptor guanylyl cyclase signaling pathway [Evidence ISS] codon_start : 1 exception : mismatches in translation note : natrium-phosphate cotransporter IIa C-terminal-associated protein 2; sodium-phosphate cotransporter IIa C-terminal-associated protein 2 product : PDZ domain containing 2 protein_id : NP_573489.1

name	Nlrx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410746 CCDS:CCDS23100.1 GeneID:270151 MGI:2429611
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : NOD9 protein protein_id : NP_848507.1

name	Abcg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144926011 CCDS:CCDS23101.1 GeneID:192663 MGI:1890594
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family G (WHITE), member 4 protein_id : NP_620405.3

name	Mizf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080426 CCDS:CCDS23102.1 GeneID:102423 MGI:2429620
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein protein_id : NP_751894.1

name	Tmem24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900515 CCDS:CCDS23103.1 GeneID:71764 MGI:1919014
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 24 protein_id : NP_082185.2

name	Dpagt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982409 CCDS:CCDS23104.1 GeneID:13478 MGI:1196396
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0003975 - UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity [Evidence IDA] GO_process : GO:0006488 - dolichol-linked oligosaccharide biosynthesis [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : dolichyl-phosphate alpha-N-acetylglucosaminephosphotransferase 2 product : UDP-N-acetylglucosamine-dolichyl-phosphateN-acetylglucosaminephosphotransferase protein_id : NP_031901.2

name	H2afx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106331 CCDS:CCDS23105.1 GeneID:15270 MGI:102688
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0000077 - DNA damage checkpoint [Evidence IMP]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IDA] [Evidence IMP]; GO:0000724 - double-strand break repair via homologous recombination [Evidence IMP]; GO:0007126 - meiosis [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : histone 5 protein 2ax product : H2A histone family, member X protein_id : NP_034566.1

name	Hmbs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794512 CCDS:CCDS23106.1 GeneID:15288 MGI:96112
definition	GO_function : GO:0004418 - hydroxymethylbilane synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006783 - heme biosynthesis [Evidence IEA]; GO:0006779 - porphyrin biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : porphobilinogen deaminase product : hydroxymethylbilane synthase protein_id : NP_038579.1

name	Vps11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037259 GeneID:71732 MGI:1918982
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 11 protein_id : NP_082165.1

name	Hyou1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542333 CCDS:CCDS23107.1 GeneID:12282 MGI:108030
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006950 - response to stress [Evidence TAS]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : calcium binding protein, 140 kDa; 150-kDa oxygen regulated protein; calcium binding protein 140; 170 kDa glucose regulated protein GRP170 product : hypoxia up-regulated 1 protein_id : NP_067370.2

name	LOC100043178 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259949 GeneID:100043178
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479535.1

name	Slc37a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592076 CCDS:CCDS23108.1 GeneID:14385 MGI:1316650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA] codon_start : 1 note : glucose-6-phosphatase, transport protein 1; transporter; glucose 6-phosphate transporter; solute carrier family 37 (glycerol-6-phosphate transporter), member 4 product : solute carrier family 37 (glucose-6-phosphate transporter), member 4 protein_id : NP_032089.2

name	Trappc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11140825 CCDS:CCDS23109.1 GeneID:60409 MGI:1926211
definition	GO_component : GO:0030425 - dendrite [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005801 - Golgi cis face [Evidence IEA]; GO:0005795 - Golgi stack [Evidence IDA]; GO:0045202 - synapse [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016358 - dendrite development [Evidence IDA]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0045212 - neurotransmitter receptor biosynthesis [Evidence TAS]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : syndecan binding protein 2; synbindin product : trafficking protein particle complex 4 protein_id : NP_068561.1

name	Rps25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28372479 GeneID:75617 MGI:1922867
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ribosomal protein S25 protein_id : NP_077228.1

name	Ccdc84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70912391 CCDS:CCDS23110.1 GeneID:382073 MGI:2685960
definition	codon_start : 1 product : coiled-coil domain containing 84 protein_id : NP_958760.2

name	Foxr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701638 CCDS:CCDS23111.1 GeneID:382074 MGI:2685961
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box R1 protein_id : NP_001028641.1

name	Upk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949819 CCDS:CCDS23112.1 GeneID:22269 MGI:98913
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0016044 - membrane organization and biogenesis [Evidence IEA] codon_start : 1 note : uroplakin II product : uroplakin 2 protein_id : NP_033502.2

name	Bcl9l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206400 GeneID:80288 MGI:1933114
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : nuclear co-factor of beta-catenin signalling product : B-cell CLL/lymphoma 9-like protein_id : NP_084532.2

name	Blr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475950 CCDS:CCDS23115.1 GeneID:12145 MGI:103567
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004945 - angiotensin type II receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048535 - lymph node development [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Burkitt lymphoma receptor 1 protein_id : NP_031577.2

name	Ddx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681159 CCDS:CCDS23116.1 GeneID:13209 MGI:104976
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 protein_id : NP_031867.1

name	Ddx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044467 CCDS:CCDS23116.1 GeneID:13209 MGI:104976
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 protein_id : NP_851841.1

name	Treh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946884 CCDS:CCDS23117.1 GeneID:58866 MGI:1926230
definition	GO_component : GO:0005903 - brush border [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : trehalase protein_id : NP_067456.1

name	Phldb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38455422 CCDS:CCDS23118.1 GeneID:102693 MGI:2143230
definition	codon_start : 1 note : Ll5alpha product : pleckstrin homology-like domain, family B, member 1 protein_id : NP_705765.3

name	Arcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020742 GeneID:213827 MGI:2387591
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : archain 1 protein_id : NP_666097.2

name	1500035H01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541828 CCDS:CCDS23119.1 GeneID:76568 MGI:1923818
definition	codon_start : 1 product : hypothetical protein LOC76568 protein_id : NP_076320.2

name	Tmem25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313687 CCDS:CCDS23120.1 GeneID:71687 MGI:1918937
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : transmembrane protein 25 protein_id : NP_082141.1

name	BC021608 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20336734 CCDS:CCDS23121.1 GeneID:192653 MGI:2384760
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC192653 protein_id : NP_620401.1

name	Mll1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486682 GeneID:214162 MGI:96995
definition	GO_component : GO:0044428 - nuclear part [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI] [Evidence IMP]; GO:0006306 - DNA methylation [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0051569 - regulation of histone H3-K4 methylation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : trithorax Drosophila product : myeloid/lymphoid or mixed-lineage leukemia 1 protein_id : NP_001074518.1

name	LOC628726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628726
definition	number : 1 pseudo : _no_value

name	LOC384931 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384931
definition	number : 1 pseudo : _no_value

name	LOC667406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667406
definition	number : 1 pseudo : _no_value

name	LOC100043172 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259947 GeneID:100043172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 402 ESTs, 32 Proteins product : similar to myosin, light polypeptide 6, alkali, smooth muscle and non-muscle pseudo : _no_value transcript_id : XR_034218.1

name	LOC100042660 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259919 GeneID:100042660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to RIKEN cDNA 5730427N09 gene pseudo : _no_value transcript_id : XR_033776.1

clone name	MSMg01-411C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-416H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-056K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-320L18.b	B6Ng01-320L18.g
ACC	GA110029	GA110030
length	954	1,140
definition	B6Ng01-320L18.b	B6Ng01-320L18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(43,683,421 - 43,684,362)	(43,528,022 - 43,529,171)
sequence	gaattccttctgaagaatctattcttaaaaagatgaaaaggtcaggcatg atggtggtcgctgcttacaatccagcacctgagagacacaggccaaagga atcgctgcacttcccagccagccagggctacatagtaagaccctggctca gaacagaaagactccgttgccttccatgtaaagtcaccaacataccaaag agccatgcctgaaggcttcaccctctgagccttcaaataggcaatataga gtgtatgttccaatacatgttaggagaaggactgttctcctctgagtaca gtttcttttctttctttctttttctttttttttttttttttttttttttt ttgggttttcgagacagggtttctctgtgtagccctggctatcctggaac tcactctgtagaccaggctggcctcaaactcaaaaatccacctgcctctg cctcacaaatgctgggattaaaggtatgcgccaccacacccagcctgagt acagtttctatctgctatattctggttctggagtgttcccgaaatctcag atgttaaatccatcatccccagcttgacactattgatagatgatggaacc tctaagaggtaggactaatagaaggcgttggctcactggagacttacctt tcaaaggcattatggaaccttggcgcctatctttttctccctgctttgag ttctagccacgtgccctactatgatataccaccttgatatagacccaaga cagcaagatcccaaaccatggactgaaatcccccaaatcaacaacccaaa tccaccttttctctctgcaagttgattatcccaggggttgcactgaagtc ctgggaaagctgactccaaactcccattccagggagacaagtgatgctct gagggggaaatggaagccctgcttccacctgggcctggggtgagaggggg gggg	gaattccacaggccaaggaaaatacacacagactaggtatgcacatacat gtgttcacgcatgtgtacaaatacatggacaatcacacacatggacatac agatacacatatgtattcatgagcacacacacacacaaacacacacaggc tgtgctgtgtaggtggtaccaggaacaagaaaagcaagtaaaaagccaag agttgaactgctgtcagagtgagccaagaacagacttgtttgtgtctgtg acagcaggctgtgacagcagaggacagagcatgcctgtgcatgtggacca catgggtatgtgcctcaggaacctgtggctgcccctgcaggcagtagcct acagtgtactctgacacttgtgagggtcagacacttgcagccagagtctc cttcactggggacctaactcacagcccctgtcagtgactactcaacccag ggtgctccttacccctcgacttcttcctccttaggcactaatatgaccat ccccaactctgggacaagtctctctgttctgggggacagccatggcatcc aatccagtacaataaccactaaaccaaatgcatgtcctgatcccatcagc ctcatgtgactaaattcaaataataatatttgtatccctctcccctactc ctccttctcttgttcctcttcttctccttcctcatccactccttctctcc tctcctcctccttctttttaaaagatgaatagatattttttgtaggagat taaatgagataatgagataaagaatgtgaagcccctggcattgcaccaac tacaaagcaacacttcctcttcggcctctaattcactctcccaggagtaa attggtcaaaactcccagggacttcccaagtcacaccacctgcctgaaac tggaggtgaccttagaagccatgtgttctaggtcccaccctcaccaagtt tgtaatgtagactctcattcctggagaggccctgtgcattgacactggag cagagatcagcatacagactgcctgctcatctgagtcagtcttagcatcg tcttcagcagcaaagtcagagcaagaagctcagttgcctccattggctgg aatgaacgtgaactctgggagatggcagtgcaaggggtca
quality values	Open. Hide. 58 31 37 41 62 62 62 62 62 62 62 62 54 62 56 62 42 39 62 62 62 54 62 62 62 49 62 62 62 62 45 30 44 21 28 28 27 28 28 32 43 59 59 59 59 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 59 59 62 62 62 59 62 62 59 62 62 62 59 59 62 62 59 62 59 46 54 32 29 54 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 34 30 27 18 25 12 23 24 30 34 34 10 24 13 21 18 13 18 30 45 28 27 30 24 24 24 34 34 24 30 24 24 19 34 46 38 34 39 37 23 34 24 34 34 39 28 43 43 41 43 30 30 30 18 24 30 30 30 30 24 18 10 25 23 23 19 13 34 25 34 34 43 18 29 24 30 24 34 34 25 30 29 24 16 45 45 43 34 34 32 22 27 28 28 30 22 25 22 22 24 28 22 30 22 26 22 22 22 25 37 22 31 22 20 22 51 32 31 24 27 26 32 38 20 31 14 20 27 26 30 14 38 37 20 25 26 13 22 20 22 38 39 27 17 21 38 20 27 24 14 14 14 24 13 23 22 38 42 34 27 27 38 24 24 27 23 22 20 27 23 27 27 28 18 24 33 18 21 17 14 35 28 27 14 18 29 17 24 18 27 24 23 47 40 24 28 22 23 19 13 8 27 13 17 13 12 17 27 21 17 17 16 14 25 28 24 33 29 34 32 28 22 17 17 27 26 28 22 25 20 30 31 19 32 32 33 29 19 22 14 30 22 19 24 15 17 19 19 22 17 25 24 29 16 13 32 8 30 12 22 9 10 14 27 37 23 29 18 22 21 22 9 21 24 13 23 12 12 13 18 21 26 21 31 32 18 18 24 42 47 47 11 34 22 27 27 22 16 27 32 35 31 31 25 16 24 13 32 16 16 27 32 28 37 19 31 42 31 22 30 21 29 20 22 15 32 36 46 27 28 22 25 22 23 29 16 20 15 18 19 19 18 17 33 32 37 35 40 31 29 22 25 35 13 25 28 9 14 24 14 24 17 30 40 24 32 32 31 37 32 27 21 32 29 31 18 26 17 14 17 23 7 30 42 19 21 15 28 16 19 29 28 10 30 15 23 12 12 23 10 24 15 23 17 19 27 40 18 32 13 14 23 16 14 25 20 9 26 13 16 22 26 18 9 18 15 10 16 25 10 13 13 37 32 37 29 17 24 14 11 7 6 9 12 19 19 31 40 19 31 25 15 14 25 9 9 25 23 45 52 32 19 31 29 29 25 31 31 26 19 33 26 29 18 18 21 14 17 18 9 9 30 12 13 15 25 40 24 23 21 25 15 16 26 17 9 14 27 6 15 19 14 10 9 34 16 18 40 31 16 13 30 23 14 5 15 11 14 28 35 8 7 13 6 9 17 8 9 33 17 12 13 8 46 8 30 8 9 6 12 8 9 11 9 9 18 19 15 21 9 9 13 9 7 46 46 41 6 9 29 26 12 15 23 7 15 12 25 32 10 9 17 11 9 7 5 9 25 8 10 13 21 22 27 8 9 23 29 38 31 6 18 15 13 5 23 6 13 37 46 44 44 44 44 44	Open. Hide. 62 44 51 47 62 62 59 43 62 59 59 62 44 44 24 28 28 29 20 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 56 54 59 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 54 56 59 50 56 50 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 56 59 59 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 54 62 62 62 62 62 47 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 54 54 58 58 58 58 58 58 58 58 58 54 54 58 58 58 54 58 52 58 54 58 58 58 58 58 58 49 52 54 58 58 58 54 58 52 58 58 58 58 58 58 52 58 58 58 58 58 58 45 50 58 53 58 58 54 58 51 58 58 54 54 51 48 43 58 58 58 58 50 52 58 58 51 52 54 51 54 58 58 44 48 58 58 51 58 58 49 51 36 58 51 58 58 54 51 58 58 58 48 58 58 58 41 49 50 58 43 40 58 53 53 50 51 54 44 42 50 49 58 51 54 41 43 41 39 58 40 41 58 49 40 58 58 50 49 58 50 58 58 50 51 49 58 58 58 58 54 54 54 58 58 54 53 58 58 58 49 49 39 50 43 41 49 58 50 51 51 54 50 51 49 54 44 39 54 39 52 42 54 49 51 52 47 51 52 51 51 52 54 36 49 45 42 54 47 45 40 53 49 36 44 38 54 49 49 49 54 40 47 44 40 40 49 45 53 52 37 46 34 40 54 42 42 51 51 45 37 36 54 46 35 27 29 54 54 49 41 35 30 52 49 41 52 52 51 41 53 53 42 46 46 49 49 40 47 31 34 32 51 53 32 32 16 35 34 49 41 40 36 46 29 39 36 31 34 35 51 47 34 35 31 52 46 31 31 33 32 19 41 31 38 33 33 35 31 46 46 40 25 32 51 30 26 40 25 30 30 33 18 12 10 41 42 36 34 38 27 51 42 31 30 33 11 22 25 30 32 42 32 31 31 27 20 27 21 19 31 25 27 26 25 31 31 33 42 32 32 32 32 42 31 31 23 46 29 29 28 36 38 16 31 29 48 31 28 32 32 41 31 32 32 48 46 35 30 31 31 41 23 27 21 48 31 16 24 31 31 29 41 13 11 25 23 31 32 24 31 24 26 32 16 20 29 31 36 31 30 31 21 26 44 21 31 34 32 26 29 27 13 19 29 33 17 21 19 30 22 11 29 38 24 26 21 17 23 16 18 16 11 6 24 31 21 13 15 14 22 36 24 12 11 39 7 23 27 25 15 15 12 21 32 16 33 10 13 26 20 9 13 29 18 29 21 22 24 32 32 23 26 18 13 21 9 17 9 9 15 5 5 12 9 25 5 27 14 21 11 6 11 27 14 16 10 14 14 9 5 8 27 22 17 14 9 23 12 9 25 6 11 22 20 26 11 18 10 17 19 21 10 10 11 18 24 26 12 11 28 9 23 11 20 15 11 3 3 5 6 3 2 8 16 15 17 18 7 16 7 4 12 7 9 3 3 6 18 5 13 17 16 6 3 5 9 11 17 29 11 3 2 12 5 7 23 7 13 9 4 12 2 5 5 11 3 3 3 3 2 2 18 7 4 6 15 17 5 17 17 4 16 5 6 6 4 2 3 4 6 6 9 4 5 5 6 17 9 11 5 12 10 9 13 7 10 4 7 5 8 2 1 3 7 3 2 1 4 8 5 11 17 12 2 3 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_43683421_43684362
seq2: B6Ng01-320L18.b_50_1003 (reverse)

seq1  CCCCCCCCCTCTCACCC--AGCCCA-GTTGAAGCAGG--CTCCATTT-CC  44
      |||||||||||||||||   ||||| || ||||||||   ||||||| ||
seq2  CCCCCCCCCTCTCACCCCAGGCCCAGGTGGAAGCAGGGCTTCCATTTCCC  50

seq1  CCTCAGAGCATCAC-TGTCT-CCTGGAAT-GGAGTTT-GAGTCAGCTTT-  89
      |||||||||||||| ||||| |||||||| ||||||| ||||||||||| 
seq2  CCTCAGAGCATCACTTGTCTCCCTGGAATGGGAGTTTGGAGTCAGCTTTC  100

seq1  CCAGGACTTCAGTGCAA-CCCTGGGATAATCAACTTGCAGAGAGAAAAGG  138
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  CCAGGACTTCAGTGCAACCCCTGGGATAATCAACTTGCAGAGAGAAAAGG  150

seq1  TGGATTTGGGTTGCTGATTTGGGGGATTTCAGTCCATGGTTTGGGATCTT  188
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TGGATTTGGGTTGTTGATTTGGGGGATTTCAGTCCATGGTTTGGGATCTT  200

seq1  GCTGTCTTGGGTCTATATCAAGGTGGTATATCATAGTAGGGCACGTGGCT  238
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTCTTGGGTCTATATCAAGGTGGTATATCATAGTAGGGCACGTGGCT  250

seq1  AGAACTCAAAGCAGGGAGAAAAAGATAGGCGCCAAGGTTCCATAATGCCT  288
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACTCAAAGCAGGGAGAAAAAGATAGGCGCCAAGGTTCCATAATGCCT  300

seq1  TTGAAAGGTAAGTCTCCAGTGAGCCAACGCCTTCTATTAGTCCTACCTCT  338
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAGGTAAGTCTCCAGTGAGCCAACGCCTTCTATTAGTCCTACCTCT  350

seq1  TAGAGGTTCCATCATCTATCAATAGTGTCAAGCTGGGGATGATGGATTTA  388
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGGTTCCATCATCTATCAATAGTGTCAAGCTGGGGATGATGGATTTA  400

seq1  ACATCTGAGATTTCGGGAACACTCCAGAACCAGAATATAGCAGATAGAAA  438
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTGAGATTTCGGGAACACTCCAGAACCAGAATATAGCAGATAGAAA  450

seq1  CTGTACTCAGGCTGGGTGTGGTGGCGCATACCTTTAATCCCAGCATTTGT  488
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTACTCAGGCTGGGTGTGGTGGCGCATACCTTTAATCCCAGCATTTGT  500

seq1  GAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGA  538
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GAGGCAGAGGCAGGTGGATTTTTGAGTTTGAGGCCAGCCTGGTCTACAGA  550

seq1  GTGAGTTCCAGGATAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAA  588
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GTGAGTTCCAGGATAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAC  600

seq1  CCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAGAAAGAAAGAAAAG  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAGAAAGAAAGAAAAG  650

seq1  AAACTGTACTCAGAGGAGAACAGTCCTTCTCCTAACATGTATTGGAACAT  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGTACTCAGAGGAGAACAGTCCTTCTCCTAACATGTATTGGAACAT  700

seq1  ACACTCTATATTGCCTATTTGAAGGCTCAGAGGGTGAAGCCTTCAGGCAT  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTCTATATTGCCTATTTGAAGGCTCAGAGGGTGAAGCCTTCAGGCAT  750

seq1  GGCTCTTTGGTATGTTGGTGACTTTACATGGAAGGCAACGGAGTCTTTCT  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCTTTGGTATGTTGGTGACTTTACATGGAAGGCAACGGAGTCTTTCT  800

seq1  GTTCTGAGCCAGGGTCTTACTATGTAGCCCTGGCTGGCTGGGAAGTGCAG  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGAGCCAGGGTCTTACTATGTAGCCCTGGCTGGCTGGGAAGTGCAG  850

seq1  CGATTCCTTTGGCCTGTGTCTCTCAGGTGCTGGATTGTAAGCAGCGACCA  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGATTCCTTTGGCCTGTGTCTCTCAGGTGCTGGATTGTAAGCAGCGACCA  900

seq1  CCATCATGCCTGACCTTTTCATCTTTTTAAGAATAGATTCTTCAGAAGGA  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCATGCCTGACCTTTTCATCTTTTTAAGAATAGATTCTTCAGAAGGA  950

seq1  ATTC  942
      ||||
seq2  ATTC  954

seq1: chr9_43528022_43529171
seq2: B6Ng01-320L18.g_69_1208

seq1  GAATTCCACAGGCCAAGGAAAATACACACAGACTAGGTATGCACATACAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACAGGCCAAGGAAAATACACACAGACTAGGTATGCACATACAT  50

seq1  GTGTTCACGCATGTGTACAAATACATGGACAATCACACACATGGACATAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTCACGCATGTGTACAAATACATGGACAATCACACACATGGACATAC  100

seq1  AGATACACATATGTATTCATGAGCACACACACACACAAACACACACAGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATACACATATGTATTCATGAGCACACACACACACAAACACACACAGGC  150

seq1  TGTGCTGTGTAGGTGGTACCAGGAACAAGAAAAGCAAGTAAAAAGCCAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCTGTGTAGGTGGTACCAGGAACAAGAAAAGCAAGTAAAAAGCCAAG  200

seq1  AGTTGAACTGCTGTCAGAGTGAGCCAAGAACAGACTTGTTTGTGTCTGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGAACTGCTGTCAGAGTGAGCCAAGAACAGACTTGTTTGTGTCTGTG  250

seq1  ACAGCAGGCTGTGACAGCAGAGGACAGAGCATGCCTGTGCATGTGGACCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCAGGCTGTGACAGCAGAGGACAGAGCATGCCTGTGCATGTGGACCA  300

seq1  CATGGGTATGTGCCTCAGGAACCTGTGGCTGCCCCTGCAGGCAGTAGCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGTATGTGCCTCAGGAACCTGTGGCTGCCCCTGCAGGCAGTAGCCT  350

seq1  ACAGTGTACTCTGACACTTGTGAGGGTCAGACACTTGCAGCCAGAGTCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGTACTCTGACACTTGTGAGGGTCAGACACTTGCAGCCAGAGTCTC  400

seq1  CTTCACTGGGGACCTAACTCACAGCCCCTGTCAGTGACTACTCAACCCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCACTGGGGACCTAACTCACAGCCCCTGTCAGTGACTACTCAACCCAG  450

seq1  GGTGCTCCTTACCCCTCGACTTCTTCCTCCTTAGGCACTAATATGACCAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCTCCTTACCCCTCGACTTCTTCCTCCTTAGGCACTAATATGACCAT  500

seq1  CCCCAACTCTGGGACAAGTCTCTCTGTTCTGGGGGACAGCCATGGCATCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAACTCTGGGACAAGTCTCTCTGTTCTGGGGGACAGCCATGGCATCC  550

seq1  AATCCAGTACAATAACCACTAAACCAAATGCATGTCCTGATCCCATCAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCAGTACAATAACCACTAAACCAAATGCATGTCCTGATCCCATCAGC  600

seq1  CTCATGTGACTAAATTCAAATAATAATATTTGTATCCCTCTCCCCTACTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATGTGACTAAATTCAAATAATAATATTTGTATCCCTCTCCCCTACTC  650

seq1  CTCCTTCTCTTGTTCCTCTTCTTCTCCTTCCTCATCCACTCCTTCTCTCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTCTCTTGTTCCTCTTCTTCTCCTTCCTCATCCACTCCTTCTCTCC  700

seq1  TCTCCTCCTCCTTCTTTTTAAAAGATGAATAGATATTTTTTGTAGGAGAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCTCCTCCTTCTTTTTAAAAGATGAATAGATATTTTTTGTAGGAGAT  750

seq1  TAAATGAGATAATGAGATAAAGAATGTGAAGCCCCTGGCATTGCACCAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGAGATAATGAGATAAAGAATGTGAAGCCCCTGGCATTGCACCAAC  800

seq1  TACAAAGCAAACACTTCCTCTTCGGCCTCTAATTCACTCTCCCAGGAGTA  850
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  TACAAAGC-AACACTTCCTCTTCGGCCTCTAATTCACTCTCCCAGGAGTA  849

seq1  AATTGGTCAAAACTCCCAGGGACTTCCCAAGTCACACCACCTGCCTGAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGGTCAAAACTCCCAGGGACTTCCCAAGTCACACCACCTGCCTGAAA  899

seq1  CTGGAGGTGACCTTAGAAGCCATGTGTTCTAGGTCCCA-CCTCACCAAGT  949
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CTGGAGGTGACCTTAGAAGCCATGTGTTCTAGGTCCCACCCTCACCAAGT  949

seq1  TGTAAATGTAGACTCTCATTCCTGGAGAGG-CCTGTGCATTGACACTGGA  998
      |   |||||||||||||||||||||||||| |||||||||||||||||||
seq2  TTGTAATGTAGACTCTCATTCCTGGAGAGGCCCTGTGCATTGACACTGGA  999

seq1  GCAGAGATCAGCATACAGACTGCTGCCTCATCTTGAGGTCAGTCTTAGCA  1048
      |||||||||||||||||||||||   |||||| ||| |||||||||||||
seq2  GCAGAGATCAGCATACAGACTGCCTGCTCATC-TGA-GTCAGTCTTAGCA  1047

seq1  TTCGGCCTTCAGCCAGCAAAAGGTCAGAGCAGGGAGCTTCCAAGGTTGGC  1098
      |   | |||||| |||||||  ||||||||| | ||||  ||  |||| |
seq2  T--CGTCTTCAG-CAGCAAA--GTCAGAGCAAGAAGCT--CA--GTTGCC  1088

seq1  TCCCTTTGGCTTGGAGATGACAGTGAACTCT-GGAGATGGAAGTG--AGG  1145
      | || ||||| |||| ||||  ||||||||| |||||||| ||||  |||
seq2  T-CCATTGGC-TGGA-ATGAACGTGAACTCTGGGAGATGGCAGTGCAAGG  1135

seq1  GGTCA  1150
      |||||
seq2  GGTCA  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information