MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-325N09
Chromosome	9 (Build37)
Map Location	87,894,942 - 88,035,688
singlet/doublet	doublet
Overlap gene	LOC100039580
Upstream gene	C030002E08Rik, Cyb5r4, LOC666777, LOC244958, LOC100039510, 4922501C03Rik, LOC671706, Tbx18, LOC671731
Downstream gene	LOC384962, EG272633, Nt5e, Snx14, LOC100039601, Syncrip, 2810026P18Rik, 4930422I07Rik, EG547109, LOC100039707, LOC100039721, Bcl2a1d, LOC100039674, EG666731, LOC100039741, Bcl2a1a, LOC100039689, EG666747, LOC100039714, 4930579C12Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	C030002E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382089 MGI:2685968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins

name	Cyb5r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266690 MGI:2386848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666777 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC244958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:244958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100039510 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	4922501C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382090 MGI:1925343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 64 ESTs, 4 Proteins

name	LOC671706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Tbx18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76365 MGI:1923615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100039580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC384962 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG272633 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272633 MGI:3645897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Nt5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23959 MGI:99782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244962 MGI:2155664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1163 ESTs, 10 Proteins

name	Syncrip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56403 MGI:1891690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2810026P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72655 MGI:1919905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs

name	4930422I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71640 MGI:1918890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs

name	EG547109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547109 MGI:3645218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 81 ESTs, 5 Proteins

name	LOC100039721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Bcl2a1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12047 MGI:1278325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	EG666731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666731 MGI:3647365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 1 Protein

name	LOC100039741 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Bcl2a1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12044 MGI:102687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039689 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs

name	EG666747 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666747 MGI:3648996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 1 Protein

name	LOC100039714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	4930579C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319213 MGI:2441687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030002E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260120 GeneID:382089 MGI:2685968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins product : RIKEN cDNA C030002E08 gene transcript_id : XM_985855.2

name	Cyb5r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28916666 GeneID:266690 MGI:2386848
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 reductase 4 transcript_id : NM_024195.1

name	LOC244958 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260123 GeneID:244958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Chromosome 6 open reading frame 117 transcript_id : XM_147017.8

name	LOC100039510 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260126 GeneID:100039510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CG2839-PA transcript_id : XM_001473027.1

name	4922501C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386285 GeneID:382090 MGI:1925343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 64 ESTs, 4 Proteins product : RIKEN cDNA 4922501C03 gene, transcript variant 5 transcript_id : XM_001000297.1

name	Tbx18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387339 GeneID:76365 MGI:1923615
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box18 transcript_id : NM_023814.3

name	Nt5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350747 GeneID:23959 MGI:99782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5' nucleotidase, ecto transcript_id : NM_011851.3

name	Snx14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379980 GeneID:244962 MGI:2155664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 14 transcript_id : NM_172926.2

name	LOC100039601 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260128 GeneID:100039601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1163 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001473176.1

name	Syncrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145481 GeneID:56403 MGI:1891690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin binding, cytoplasmic RNA interacting protein transcript_id : NM_019796.4

name	Syncrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145492 GeneID:56403 MGI:1891690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin binding, cytoplasmic RNA interacting protein transcript_id : NM_019666.2

name	2810026P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386315 GeneID:72655 MGI:1919905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs product : RIKEN cDNA 2810026P18 gene transcript_id : XM_986352.1

name	4930422I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260131 GeneID:71640 MGI:1918890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs product : RIKEN cDNA 4930422I07 gene transcript_id : XM_150216.6

name	EG547109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382012 GeneID:547109 MGI:3645218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG547109 transcript_id : NM_001034906.2

name	LOC100039707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260137 GeneID:100039707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 81 ESTs, 5 Proteins product : similar to 5, 10-methenyltetrahydrofolate synthetase transcript_id : XM_001473273.1

name	LOC100039721 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260141 GeneID:100039721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039721 transcript_id : XM_001473292.1

name	Bcl2a1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131097 GeneID:12047 MGI:1278325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1d transcript_id : NM_007536.2

name	LOC100039674 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260133 GeneID:100039674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical protein LOC100039674 transcript_id : XM_001473239.1

name	EG666731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386300 GeneID:666731 MGI:3647365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 1 Protein product : predicted gene, EG666731, transcript variant 2 transcript_id : XM_001000507.1

name	LOC100039741 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260143 GeneID:100039741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical protein LOC100039741 transcript_id : XM_001473330.1

name	Bcl2a1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130280 GeneID:12044 MGI:102687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1a transcript_id : NM_009742.3

name	LOC100039689 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260135 GeneID:100039689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs product : similar to Mthfs protein transcript_id : XM_001473342.1

name	EG666747 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260145 GeneID:666747 MGI:3648996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 1 Protein product : predicted gene, EG666747, transcript variant 2 transcript_id : XM_001000540.2

name	LOC100039714 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260139 GeneID:100039714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039714 transcript_id : XM_001473372.1

name	4930579C12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802728 GeneID:319213 MGI:2441687
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930579C12 gene transcript_id : NM_175672.3

name	C030002E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260121 GeneID:382089 MGI:2685968
definition	codon_start : 1 product : RIKEN cDNA C030002E08 protein_id : XP_990949.2

name	Cyb5r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916667 GeneID:266690 MGI:2386848
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004128 - cytochrome-b5 reductase activity [Evidence ISS]; GO:0020037 - heme binding [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042168 - heme metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation note : cytochrome b-type NAD(P)H oxidoreductase product : NADPH cytochrome B5 oxidoreductase protein_id : NP_077157.1

name	LOC100039510 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260127 GeneID:100039510
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473077.1

name	LOC244958 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260124 GeneID:244958
definition	codon_start : 1 product : similar to Chromosome 6 open reading frame 117 protein_id : XP_147017.8

name	4922501C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260125 GeneID:382090 MGI:1925343
definition	codon_start : 1 product : KIAA1009 protein isoform 5 protein_id : XP_001000297.2

name	Tbx18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560050 GeneID:76365 MGI:1923615
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009948 - anterior/posterior axis specification [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0051145 - smooth muscle cell differentiation [Evidence IMP]; GO:0001756 - somitogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : T-box18 protein_id : NP_076303.2

name	Nt5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754900 CCDS:CCDS23386.1 GeneID:23959 MGI:99782
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009166 - nucleotide catabolism [Evidence IEA] codon_start : 1 note : ecto-5'-nucleotidase product : 5' nucleotidase, ecto protein_id : NP_035981.1

name	Snx14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370428 CCDS:CCDS23387.1 GeneID:244962 MGI:2155664
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : sorting nexin 14 protein_id : NP_766514.1

name	LOC100039601 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260129 GeneID:100039601
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473226.1

name	Syncrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788787 CCDS:CCDS23388.1 GeneID:56403 MGI:1891690
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; synaptotagmin-binding, cytoplasmic RNA-interacting protein; NS1-associated protein 1-like; RRM RNA binding protein GRY-RBP product : NS1-associated protein 1 isoform 2 protein_id : NP_062770.1

name	Syncrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145493 GeneID:56403 MGI:1891690
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; synaptotagmin-binding, cytoplasmic RNA-interacting protein; NS1-associated protein 1-like; RRM RNA binding protein GRY-RBP product : NS1-associated protein 1 isoform 1 protein_id : NP_062640.2

name	2810026P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386316 GeneID:72655 MGI:1919905
definition	codon_start : 1 product : hypothetical protein LOC72655 protein_id : XP_991446.1

name	4930422I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260132 GeneID:71640 MGI:1918890
definition	codon_start : 1 product : hypothetical protein LOC71640 protein_id : XP_150216.3

name	EG547109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702270 CCDS:CCDS23389.1 GeneID:547109 MGI:3645218
definition	codon_start : 1 product : similar to tripartite motif-containing 43 protein_id : NP_001030078.1

name	LOC100039707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260138 GeneID:100039707
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473323.1

name	LOC100039721 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260142 GeneID:100039721
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473342.1

name	Bcl2a1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671630 CCDS:CCDS23390.1 GeneID:12047 MGI:1278325
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : B-cell leukemia/lymphoma 2 related protein A1d protein_id : NP_031562.1

name	LOC100039674 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260134 GeneID:100039674
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473289.1

name	EG666731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386301 GeneID:666731 MGI:3647365
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001000507.1

name	LOC100039741 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260144 GeneID:100039741
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473380.1

name	Bcl2a1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11024684 CCDS:CCDS23391.1 GeneID:12044 MGI:102687
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : B-cell leukemia/lymphoma 2 related protein A1a protein_id : NP_033872.1

name	LOC100039689 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260136 GeneID:100039689
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473392.1

name	EG666747 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386305 GeneID:666747 MGI:3648996
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001000540.1

name	LOC100039714 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260140 GeneID:100039714
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473422.1

name	LOC671706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671706
definition	number : 1 pseudo : _no_value

name	LOC671706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671706
definition	number : 2 pseudo : _no_value

name	LOC671706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671706
definition	number : 3 pseudo : _no_value

name	LOC671706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671706
definition	number : 4 pseudo : _no_value

name	LOC671731 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671731
definition	number : 1 pseudo : _no_value

name	LOC671731 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671731
definition	number : 2 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 5 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 4 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 3 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 2 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 1 pseudo : _no_value

name	LOC384962 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384962
definition	number : 1 pseudo : _no_value

name	LOC666777 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260122 GeneID:666777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 2 Proteins product : similar to Crx opposite strand transcript 1 pseudo : _no_value transcript_id : XR_030967.1

name	EG272633 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260130 GeneID:272633 MGI:3645897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : predicted gene, EG272633 pseudo : _no_value transcript_id : XR_001924.2

clone name	MSMg01-065A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491F02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-193F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-194I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339J14
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-039P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-325N09.b	B6Ng01-325N09.g
ACC	GA113792	GA113793
length	1,192	952
definition	B6Ng01-325N09.b	B6Ng01-325N09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(87,894,942 - 87,896,135)	(88,034,740 - 88,035,688)
sequence	gaattcagtacattgaaagtcagtccaattcagttaaatgcaggtcattt gttcccttttccaaattgttcatcttgtgctccctgttccattttatagg agggaaagtatttctaaacgtcctgtatgatcatggcttttctttctcct acaaaatccaaattaatactaaaatgctgctcagcacaattcttcagttg cttaactcaataaaatgtctataacattgaaaagtatttttaaaaatatg tcttaaaagccaatatatggtaactgcctttccttgagagctcactggat tttccagctttttcaggaaatgaggtactcaggtgaattttccagatagc ctcctcctcctcctcagaggacttaaaaagttcataaatcttctaccatg tggagtcagttacccctgcagtaccctaactgaatgaacatagccttacc aacccttgtagcatcagtaaatcagaggtttagaagcctccagtttaaaa ttccaccaagactaatggctatgtacacagacctgagagctcactgaagc aaaccccgctaagaatatatccatggaaagtagttcaagtttattaaacc ccctcctagcttccacatcatttctttagaaacgtagattgtataggatt ggtcccatgggccaaggccgcaagttcatttcagttcttgacagcctgat tgtgggatagggatgtcaaagttctctggccacactgatccagataatag ttaaagtgctgtctcagaatttcccaatatgcacatgaaaatgttcttct gtgcagagatttttatgtgtttctttcaccatgattccattagccaggtt cttgttgatagcgttaagtatttggctctcaacttatctacctatatagc agctctgtgtgtgtgtcaggcccagattaatgctgagaacagaaaaatga gcaactcagtcttctcactatagaaaacttgtctatcaagaatgagaggc aagcaatgttttctaggaacatggggtcatttgctttcatattgcctgtg atcccttcaaatactactgcagaacttgattggttaaagaccccatggcc acaaatcaacttatttactgttgggagtagaaggcttttgggaaaggttc catgacagctaccatgagttatgaattgtaattatatagcat	gaattcatacgtgaacactgtatctacaccattccccaccacttccaatg atcctgctctttctgcctcctgccatctcagggactttagggtgacaaga agggcttgtccctcagagagtggatagctggttggtagattgctgtggag ggagctaaaggttgctaggacgttcactgtctgtgttggagtgtaagccc cacgatccagcaggcctcagggtgatttccaattaccgatcatgttccct tctggactcccacatcagcataggtgagagcacaggtacagagtgaccac tgagtcagactgggctctcctgtaatcatccccattaaaagttttaattt gttaaagtcaaaggattaaattgccctttcagaatcttggagtgagggct gtctttcttgcctatcagcatgatataaggtggaatacaaagctacactc gtcttgtccaagctgtttacaggagtaataaacattagaatccaaggtat taccaaatttgtactttgcatgttttttagtaatcagtatcttccaatcc agcttttgcttagaaatttaatgaattaaaaacaaacaaacaaaccttaa actggagaaaaggcacagtttgacttgacgactgaatccaattcagtgtg tgctcaggtggagcagaagggttagtttatgccctctgaagcctgcggaa gctgatgctcatagttaccgtgtacagcagctttctgtgttatgtagaga aggtgagaaatgtggaaatgagtatgacctagagtggtcatgttttgtgc tgacaaaattgtgggtttgagtatttgtaacttactatcacttctgttaa cccttgctaatggtctagtcttttcccttgcttcctgggcatttcttttc ctttcctttcctttccttttcctttcctttcctttcctattccatttcca tt
quality values	Open. Hide. 62 47 31 32 62 37 25 47 62 62 56 42 54 62 62 47 62 62 47 59 59 44 59 62 62 59 43 62 62 62 59 36 59 62 59 62 62 62 54 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 49 62 54 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 49 54 58 52 58 58 58 54 54 58 58 58 58 54 58 58 58 49 40 58 58 58 58 58 45 47 58 52 58 54 42 58 54 58 58 58 58 52 58 58 58 58 58 58 58 54 54 52 54 58 54 46 58 58 54 58 52 52 51 46 50 58 58 54 58 58 58 58 51 53 58 51 51 50 58 58 49 58 53 46 53 53 58 53 53 58 58 58 58 51 58 44 50 53 58 58 50 49 49 51 53 52 39 39 58 58 53 46 53 54 53 53 46 32 54 58 49 49 58 58 50 39 50 58 58 58 51 49 40 46 41 58 51 58 51 53 58 49 51 54 53 52 39 41 58 58 39 39 49 58 53 53 53 54 58 53 50 39 53 51 58 51 54 41 40 58 58 50 58 58 41 47 32 42 39 51 46 34 28 54 44 50 30 54 53 40 53 53 53 53 52 39 51 54 29 54 30 49 40 53 49 46 37 42 52 42 24 34 53 28 31 42 42 49 29 42 37 26 54 53 40 42 53 32 41 45 37 33 39 40 32 26 54 14 28 54 41 37 54 35 28 26 35 40 37 47 40 40 40 33 40 37 45 54 51 31 32 47 39 33 53 28 28 31 37 53 34 34 32 32 37 53 35 23 20 51 51 52 52 32 32 42 32 34 40 53 25 29 32 52 16 24 29 30 31 23 31 42 33 18 32 30 35 21 30 31 23 8 12 19 25 37 38 31 31 39 35 32 51 24 20 25 32 26 33 21 29 30 27 27 29 31 31 32 38 31 47 31 46 15 13 31 31 28 31 26 30 37 31 35 28 31 43 32 14 15 31 31 29 28 21 38 32 36 28 31 22 35 43 36 32 41 31 31 34 43 31 31 25 26 20 30 18 6 30 21 37 16 15 16 10 6 24 30 23 31 41 30 43 25 30 7 23 31 27 20 27 38 46 44 48 31 14 23 29 19 29 21 32 26 31 14 43 14 22 21 31 31 26 32 27 23 19 32 19 27 31 13 24 41 44 31 17 24 20 26 16 23 14 21 24 24 19 24 16 26 22 27 21 22 18 32 15 33 22 21 24 24 32 19 20 22 23 21 48 48 28 32 28 32 19 10 26 9 14 14 31 7 43 48 17 13 18 11 12 39 14 20 23 25 43 20 10 8 6 13 12 19 27 11 19 12 21 20 25 5 8 13 34 13 23 18 7 20 28 6 8 6 28 11 16 13 18 21 16 20 7 6 11 8 11 21 5 14 4 15 6 3 6 13 21 38 21 13 14 13 34 28 15 7 17 20 13 3 3 3 4 8 21 24 6 6 11 12 11 23 19 11 17 23 9 10 8 6 13 5 9 10 7 8 23 6 12 6 4 13 13 13 12 8 10 15 17 17 19 3 4 5 4 14 7 4 20 22 6 7 5 7 16 8 6 3 2 5 9 6 5 6 21 4 6 5 4 16 11 7 7 6 3 5 5 4 8 3 4 22 8 5 8 7 16 5 8 5 22 5 4	Open. Hide. 62 49 62 47 62 47 59 62 59 62 46 62 62 43 49 59 59 59 62 62 54 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 59 62 62 62 62 59 62 54 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 49 48 52 58 58 58 58 58 54 58 58 58 58 54 42 39 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 54 54 58 58 48 45 58 58 54 58 58 58 58 58 37 58 52 58 58 58 58 58 33 58 58 51 52 58 58 51 40 54 58 58 58 58 54 52 58 58 48 58 58 51 58 39 58 58 58 58 39 51 53 53 54 51 51 58 58 58 58 49 48 58 58 51 36 41 37 51 42 53 54 58 52 53 49 53 46 50 49 58 49 42 53 52 58 50 58 53 51 50 54 53 42 39 58 39 46 49 44 27 53 52 32 58 50 26 58 50 40 50 53 42 42 58 53 53 41 46 39 58 50 52 42 47 49 51 47 27 50 54 50 51 49 28 28 49 49 32 51 53 51 47 29 53 52 37 40 35 52 53 39 54 52 30 47 35 49 27 51 35 37 45 32 42 45 52 32 52 44 54 40 40 45 47 38 53 38 41 33 33 52 34 39 42 54 37 53 35 13 14 19 52 54 37 53 54 22 20 41 40 53 45 49 46 22 29 34 35 25 40 32 45 40 34 17 35 37 32 16 45 32 29 53 40 32 32 29 31 47 31 53 53 53 52 31 32 28 32 35 31 24 31 51 51 22 13 33 42 26 41 46 22 17 46 16 33 51 29 33 31 41 51 29 30 14 15 45 42 42 32 34 31 31 31 31 32 34 35 26 46 30 25 46 18 17 20 13 26 48 46 22 30 41 28 31 34 25 24 48 31 18 32 21 37 31 25 35 29 46 46 26 32 46 35 33 24 37 25 19 31 27 24 24 37 41 27 18 32 31 44 37 27 8 48 46 33 29 14 23 41 31 30 39 29 47 36 32 32 29 41 33 24 37 13 44 36 29 30 30 32 41 28 31 29 21 48 19 22 21 12 33 31 21 31 9 5 12 25 14 26 11 13 16 17 22 25 14 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_87894942_87896135
seq2: B6Ng01-325N09.b_49_1240

seq1  GAATTCAGTACATTGAAAGTCAGTCCAATTCAGTTAAATGCAGGTCATTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTACATTGAAAGTCAGTCCAATTCAGTTAAATGCAGGTCATTT  50

seq1  GTTCCCTTTTCCAAATTGTTCATCTTGTGCTCCCTGTTCCATTTTATAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCCTTTTCCAAATTGTTCATCTTGTGCTCCCTGTTCCATTTTATAGG  100

seq1  AGGGAAAGTATTTCTAAACGTCCTGTATGATCATGGCTTTTCTTTCTCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAAAGTATTTCTAAACGTCCTGTATGATCATGGCTTTTCTTTCTCCT  150

seq1  ACAAAATCCAAATTAATACTAAAATGCTGCTCAGCACAATTCTTCAGTTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAATCCAAATTAATACTAAAATGCTGCTCAGCACAATTCTTCAGTTG  200

seq1  CTTAACTCAATAAAATGTCTATAACATTGAAAAGTATTTTTAAAAATATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAACTCAATAAAATGTCTATAACATTGAAAAGTATTTTTAAAAATATG  250

seq1  TCTTAAAAGCCAATATATGGTAACTGCCTTTCCTTGAGAGCTCACTGGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAAAAGCCAATATATGGTAACTGCCTTTCCTTGAGAGCTCACTGGAT  300

seq1  TTTCCAGCTTTTTCAGGAAATGAGGTACTCAGGTGAATTTTCCAGATAGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCAGCTTTTTCAGGAAATGAGGTACTCAGGTGAATTTTCCAGATAGC  350

seq1  CTCCTCCTCCTCCTCAGAGGACTTAAAAAGTTCATAAATCTTCTACCATG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTCCTCCTCCTCAGAGGACTTAAAAAGTTCATAAATCTTCTACCATG  400

seq1  TGGAGTCAGTTACCCCTGCAGTACCCTAACTGAATGAACATAGCCTTACC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGTCAGTTACCCCTGCAGTACCCTAACTGAATGAACATAGCCTTACC  450

seq1  AACCCTTGTAGCATCAGTAAATCAGAGGTTTAGAAGCCTCCAGTTTAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCTTGTAGCATCAGTAAATCAGAGGTTTAGAAGCCTCCAGTTTAAAA  500

seq1  TTCCACCAAGACTAATGGCTATGTACACAGACCTGAGAGCTCACTGAAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCACCAAGACTAATGGCTATGTACACAGACCTGAGAGCTCACTGAAGC  550

seq1  AAACCCCGCTAAGAATATATCCATGGAAAGTAGTTCAAGTTTATTAAACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCCCGCTAAGAATATATCCATGGAAAGTAGTTCAAGTTTATTAAACC  600

seq1  CCCTCCTAGCTTCCACATCATTTCTTTAGAAACGTAGATTGTATAGGATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCTAGCTTCCACATCATTTCTTTAGAAACGTAGATTGTATAGGATT  650

seq1  GGTCCCATGGGCCAAGGCCGCAAGTTCATTTCAGTTCTTGACAGCCTGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCCATGGGCCAAGGCCGCAAGTTCATTTCAGTTCTTGACAGCCTGAT  700

seq1  TGTGGGATAGGGATGTCAAAGTTCTCTGGCCACACTGATCCAGATAATAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGGATAGGGATGTCAAAGTTCTCTGGCCACACTGATCCAGATAATAG  750

seq1  TTAAAGTGCTGTCTCAGAATTTCCCAATATGCACATGAAAATGTTCTTCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGTGCTGTCTCAGAATTTCCCAATATGCACATGAAAATGTTCTTCT  800

seq1  GTGCAGAGATTTTTATGTGTTTCTTTCACCATGATTCCATTAGCCAGGTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAGAGATTTTTATGTGTTTCTTTCACCATGATTCCATTAGCCAGGTT  850

seq1  CTTGTTGATAGCGTTAAGTATTTGGCTCTCAACTTATCTACCTATATAGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTTGATAGCGTTAAGTATTTGGCTCTCAACTTATCTACCTATATAGC  900

seq1  AGCTCTGTGTGTGTGTCAGGCCCAGATTAATGCTGAGAACAGAAAAATGA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTGTGTGTGTGTCAGGCCCAGATTAATGCTGAGAACAGAAAAATGA  950

seq1  GCAACTCAAGTCTTCTCACTATAGAAAACTTGTCTATCAAGAATGAGAGG  1000
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACTC-AGTCTTCTCACTATAGAAAACTTGTCTATCAAGAATGAGAGG  999

seq1  CAAGCAATGTTTTCTAGGAACATTGGGTCATTTGCTTTCATATTGCCTGT  1050
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  CAAGCAATGTTTTCTAGGAACATGGGGTCATTTGCTTTCATATTGCCTGT  1049

seq1  GGATCCCTTCAAATACTACTGCAG-ACTTGAATTGTGTTAAAGACCCCAT  1099
       ||||||||||||||||||||||| ||||| |||| ||||||||||||||
seq2  -GATCCCTTCAAATACTACTGCAGAACTTG-ATTG-GTTAAAGACCCCAT  1096

seq1  GGCCCACAAAATCAAACTTATTTACTGTT-GGAGTAGAAGGCTTTTGGGA  1148
      || |||| ||||| ||||||||||||||| ||||||||||||||||||||
seq2  GG-CCAC-AAATC-AACTTATTTACTGTTGGGAGTAGAAGGCTTTTGGGA  1143

seq1  GAAGTTTCATGACAGCTACAATGAGTTATGAA-TGTAAT--AATAGCAT  1194
       | ||| |||||||||||| |||||||||||| ||||||   |||||||
seq2  AAGGTTCCATGACAGCTACCATGAGTTATGAATTGTAATTATATAGCAT  1192

seq1: chr9_88034740_88035688
seq2: B6Ng01-325N09.g_68_1019 (reverse)

seq1  AAAGGAAA-GGAA-AGGAAAGGAAAGGAAAGG-AAAGGAAAGGAAAGGAA  47
      || ||||| |||| |||||||||||||||||| |||||||||||||||||
seq2  AATGGAAATGGAATAGGAAAGGAAAGGAAAGGAAAAGGAAAGGAAAGGAA  50

seq1  AGGAAAAGAAATGCCCAGGAAGCAAGGGAAAAGACTAGACCATTAGCAAG  97
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAAGAAATGCCCAGGAAGCAAGGGAAAAGACTAGACCATTAGCAAG  100

seq1  GGTTAACAGAAGTGATAGTAAGTTACAAATACTCAAACCCACAATTTTGT  147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAACAGAAGTGATAGTAAGTTACAAATACTCAAACCCACAATTTTGT  150

seq1  CAGCACAAAACATGACCACTCTAGGTCATACTCATTTCCACATTTCTCAC  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACAAAACATGACCACTCTAGGTCATACTCATTTCCACATTTCTCAC  200

seq1  CTTCTCTACATAACACAGAAAGCTGCTGTACACGGTAACTATGAGCATCA  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCTACATAACACAGAAAGCTGCTGTACACGGTAACTATGAGCATCA  250

seq1  GCTTCCGCAGGCTTCAGAGGGCATAAACTAACCCTTCTGCTCCACCTGAG  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCCGCAGGCTTCAGAGGGCATAAACTAACCCTTCTGCTCCACCTGAG  300

seq1  CACACACTGAATTGGATTCAGTCGTCAAGTCAAACTGTGCCTTTTCTCCA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACTGAATTGGATTCAGTCGTCAAGTCAAACTGTGCCTTTTCTCCA  350

seq1  GTTTAAGGTTTGTTTGTTTGTTTTTAATTCATTAAATTTCTAAGCAAAAG  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAAGGTTTGTTTGTTTGTTTTTAATTCATTAAATTTCTAAGCAAAAG  400

seq1  CTGGATTGGAAGATACTGATTACTAAAAAACATGCAAAGTACAAATTTGG  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGATTGGAAGATACTGATTACTAAAAAACATGCAAAGTACAAATTTGG  450

seq1  TAATACCTTGGATTCTAATGTTTATTACTCCTGTAAACAGCTTGGACAAG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATACCTTGGATTCTAATGTTTATTACTCCTGTAAACAGCTTGGACAAG  500

seq1  ACGAGTGTAGCTTTGTATTCCACCTTATATCATGCTGATAGGCAAGAAAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAGTGTAGCTTTGTATTCCACCTTATATCATGCTGATAGGCAAGAAAG  550

seq1  ACAGCCCTCACTCCAAGATTCTGAAAGGGCAATTTAATCCTTTGACTTTA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCCCTCACTCCAAGATTCTGAAAGGGCAATTTAATCCTTTGACTTTA  600

seq1  ACAAATTAAAACTTTTAATGGGGATGATTACAGGAGAGCCCAGTCTGACT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAATTAAAACTTTTAATGGGGATGATTACAGGAGAGCCCAGTCTGACT  650

seq1  CAGTGGTCACTCTGTACCTGTGCTCTCACCTATGCTGATGTGGGAGTCCA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGGTCACTCTGTACCTGTGCTCTCACCTATGCTGATGTGGGAGTCCA  700

seq1  GAAGGGAACATGATCGGTAATTGGAAATCACCCTGAGGCCTGCTGGATCG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGAACATGATCGGTAATTGGAAATCACCCTGAGGCCTGCTGGATCG  750

seq1  TGGGGCTTACACTCCAACACAGACAGTGAACGTCCTAGCAACCTTTAGCT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGCTTACACTCCAACACAGACAGTGAACGTCCTAGCAACCTTTAGCT  800

seq1  CCCTCCACAGCAATCTACCAACCAGCTATCCACTCTCTGAGGGACAAGCC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCACAGCAATCTACCAACCAGCTATCCACTCTCTGAGGGACAAGCC  850

seq1  CTTCTTGTCACCCTAAAGTCCCTGAGATGGCAGGAGGCAGAAAGAGCAGG  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTGTCACCCTAAAGTCCCTGAGATGGCAGGAGGCAGAAAGAGCAGG  900

seq1  ATCATTGGAAGTGGTGGGGAATGGTGTAGATACAGTGTTCACGTATGAAT  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATTGGAAGTGGTGGGGAATGGTGTAGATACAGTGTTCACGTATGAAT  950

seq1  TC  949
      ||
seq2  TC  952

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information