MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-333C22
Chromosome	9 (Build37)
Map Location	88,837,238 - 88,983,429
singlet/doublet	doublet
Overlap gene	Bcl2a1a, LOC100039689, EG666747
Upstream gene	LOC100039580, LOC384962, EG272633, Nt5e, Snx14, LOC100039601, Syncrip, 2810026P18Rik, 4930422I07Rik, EG547109, LOC100039707, LOC100039721, Bcl2a1d, LOC100039674, EG666731, LOC100039741
Downstream gene	LOC100039714, 4930579C12Rik, Bcl2a1b, Mthfs, AF529169, Tmed3, B230218L05Rik, Rasgrf1, Ctsh
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC384962 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG272633 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272633 MGI:3645897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Nt5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23959 MGI:99782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244962 MGI:2155664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1163 ESTs, 10 Proteins

name	Syncrip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56403 MGI:1891690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2810026P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72655 MGI:1919905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs

name	4930422I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71640 MGI:1918890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs

name	EG547109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547109 MGI:3645218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 81 ESTs, 5 Proteins

name	LOC100039721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Bcl2a1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12047 MGI:1278325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	EG666731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666731 MGI:3647365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 1 Protein

name	LOC100039741 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Bcl2a1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12044 MGI:102687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039689 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs

name	EG666747 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666747 MGI:3648996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 1 Protein

name	LOC100039714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	4930579C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319213 MGI:2441687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2a1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12045 MGI:1278326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mthfs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107885 MGI:1340032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AF529169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209743 MGI:2667167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66111 MGI:1913361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230218L05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330998 MGI:2685617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasgrf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19417 MGI:99694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ctsh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13036 MGI:107285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350747 GeneID:23959 MGI:99782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5' nucleotidase, ecto transcript_id : NM_011851.3

name	Snx14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379980 GeneID:244962 MGI:2155664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 14 transcript_id : NM_172926.2

name	LOC100039601 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260128 GeneID:100039601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1163 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001473176.1

name	Syncrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145481 GeneID:56403 MGI:1891690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin binding, cytoplasmic RNA interacting protein transcript_id : NM_019796.4

name	Syncrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145492 GeneID:56403 MGI:1891690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin binding, cytoplasmic RNA interacting protein transcript_id : NM_019666.2

name	2810026P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386315 GeneID:72655 MGI:1919905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs product : RIKEN cDNA 2810026P18 gene transcript_id : XM_986352.1

name	4930422I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260131 GeneID:71640 MGI:1918890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs product : RIKEN cDNA 4930422I07 gene transcript_id : XM_150216.6

name	EG547109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382012 GeneID:547109 MGI:3645218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG547109 transcript_id : NM_001034906.2

name	LOC100039707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260137 GeneID:100039707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 81 ESTs, 5 Proteins product : similar to 5, 10-methenyltetrahydrofolate synthetase transcript_id : XM_001473273.1

name	LOC100039721 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260141 GeneID:100039721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039721 transcript_id : XM_001473292.1

name	Bcl2a1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131097 GeneID:12047 MGI:1278325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1d transcript_id : NM_007536.2

name	LOC100039674 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260133 GeneID:100039674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical protein LOC100039674 transcript_id : XM_001473239.1

name	EG666731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386300 GeneID:666731 MGI:3647365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 1 Protein product : predicted gene, EG666731, transcript variant 2 transcript_id : XM_001000507.1

name	LOC100039741 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260143 GeneID:100039741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical protein LOC100039741 transcript_id : XM_001473330.1

name	Bcl2a1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130280 GeneID:12044 MGI:102687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1a transcript_id : NM_009742.3

name	LOC100039689 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260135 GeneID:100039689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs product : similar to Mthfs protein transcript_id : XM_001473342.1

name	EG666747 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260145 GeneID:666747 MGI:3648996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 1 Protein product : predicted gene, EG666747, transcript variant 2 transcript_id : XM_001000540.2

name	LOC100039714 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260139 GeneID:100039714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039714 transcript_id : XM_001473372.1

name	4930579C12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802728 GeneID:319213 MGI:2441687
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930579C12 gene transcript_id : NM_175672.3

name	Bcl2a1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671625 GeneID:12045 MGI:1278326
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1b transcript_id : NM_007534.1

name	Mthfs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363048 GeneID:107885 MGI:1340032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5, 10-methenyltetrahydrofolate synthetase transcript_id : NM_026829.2

name	AF529169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130174 GeneID:209743 MGI:2667167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AF529169 transcript_id : NM_153509.2

name	Tmed3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384723 GeneID:66111 MGI:1913361
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 domain containing 3 transcript_id : NM_025360.1

name	B230218L05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387048 GeneID:330998 MGI:2685617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230218L05 gene transcript_id : NM_207260.2

name	Rasgrf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89111132 GeneID:19417 MGI:99694
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS protein-specific guanine nucleotide-releasing factor 1 transcript_id : NM_011245.2

name	Rasgrf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89111130 GeneID:19417 MGI:99694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS protein-specific guanine nucleotide-releasing factor 1 transcript_id : NM_001039655.1

name	Ctsh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106278 GeneID:13036 MGI:107285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin H transcript_id : NM_007801.1

name	Nt5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754900 CCDS:CCDS23386.1 GeneID:23959 MGI:99782
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009166 - nucleotide catabolism [Evidence IEA] codon_start : 1 note : ecto-5'-nucleotidase product : 5' nucleotidase, ecto protein_id : NP_035981.1

name	Snx14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370428 CCDS:CCDS23387.1 GeneID:244962 MGI:2155664
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : sorting nexin 14 protein_id : NP_766514.1

name	LOC100039601 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260129 GeneID:100039601
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473226.1

name	Syncrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788787 CCDS:CCDS23388.1 GeneID:56403 MGI:1891690
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; synaptotagmin-binding, cytoplasmic RNA-interacting protein; NS1-associated protein 1-like; RRM RNA binding protein GRY-RBP product : NS1-associated protein 1 isoform 2 protein_id : NP_062770.1

name	Syncrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145493 GeneID:56403 MGI:1891690
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; synaptotagmin-binding, cytoplasmic RNA-interacting protein; NS1-associated protein 1-like; RRM RNA binding protein GRY-RBP product : NS1-associated protein 1 isoform 1 protein_id : NP_062640.2

name	2810026P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386316 GeneID:72655 MGI:1919905
definition	codon_start : 1 product : hypothetical protein LOC72655 protein_id : XP_991446.1

name	4930422I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260132 GeneID:71640 MGI:1918890
definition	codon_start : 1 product : hypothetical protein LOC71640 protein_id : XP_150216.3

name	EG547109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702270 CCDS:CCDS23389.1 GeneID:547109 MGI:3645218
definition	codon_start : 1 product : similar to tripartite motif-containing 43 protein_id : NP_001030078.1

name	LOC100039707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260138 GeneID:100039707
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473323.1

name	LOC100039721 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260142 GeneID:100039721
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473342.1

name	Bcl2a1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671630 CCDS:CCDS23390.1 GeneID:12047 MGI:1278325
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : B-cell leukemia/lymphoma 2 related protein A1d protein_id : NP_031562.1

name	LOC100039674 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260134 GeneID:100039674
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473289.1

name	EG666731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386301 GeneID:666731 MGI:3647365
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001000507.1

name	LOC100039741 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260144 GeneID:100039741
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473380.1

name	Bcl2a1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11024684 CCDS:CCDS23391.1 GeneID:12044 MGI:102687
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : B-cell leukemia/lymphoma 2 related protein A1a protein_id : NP_033872.1

name	LOC100039689 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260136 GeneID:100039689
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473392.1

name	EG666747 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386305 GeneID:666747 MGI:3648996
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001000540.1

name	LOC100039714 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260140 GeneID:100039714
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473422.1

name	4930579C12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316766 GeneID:319213 MGI:2441687
definition	codon_start : 1 product : hypothetical protein LOC319213 protein_id : NP_783603.1

name	Bcl2a1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671626 CCDS:CCDS23393.1 GeneID:12045 MGI:1278326
definition	codon_start : 1 exception : mismatches in translation function : hematopoietic-specific early-response note : anti-apoptotic protein A1-b product : B-cell leukemia/lymphoma 2 related protein A1b protein_id : NP_031560.1

name	Mthfs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18093092 CCDS:CCDS23394.1 GeneID:107885 MGI:1340032
definition	GO_function : GO:0030272 - 5-formyltetrahydrofolate cyclo-ligase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005542 - folic acid binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : 5, 10-methenyltetrahydrofolate synthetase protein_id : NP_081105.1

name	AF529169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943816 CCDS:CCDS23395.1 GeneID:209743 MGI:2667167
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC209743 protein_id : NP_705729.1

name	Tmed3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384724 CCDS:CCDS23396.1 GeneID:66111 MGI:1913361
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : integral type I protein protein_id : NP_079636.1

name	B230218L05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402267 CCDS:CCDS23397.1 GeneID:330998 MGI:2685617
definition	codon_start : 1 product : hypothetical protein LOC330998 protein_id : NP_997143.1

name	Rasgrf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755288 GeneID:19417 MGI:99694
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007616 - long-term memory [Evidence ISS]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence IMP]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; GRF beta; Ras guanine release factor beta; guanine nucleotide releasing factor 1 product : RAS protein-specific guanine nucleotide-releasing factor 1 isoform 1 protein_id : NP_035375.1

name	Rasgrf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111131 GeneID:19417 MGI:99694
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007616 - long-term memory [Evidence ISS]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence IMP]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; GRF beta; Ras guanine release factor beta; guanine nucleotide releasing factor 1 product : RAS protein-specific guanine nucleotide-releasing factor 1 isoform 2 protein_id : NP_001034744.1

name	Ctsh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106279 CCDS:CCDS23399.1 GeneID:13036 MGI:107285
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004215 - cathepsin H activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Cat H product : cathepsin H protein_id : NP_031827.1

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 5 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 4 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 3 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 2 pseudo : _no_value

name	LOC100039580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039580
definition	number : 1 pseudo : _no_value

name	LOC384962 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384962
definition	number : 1 pseudo : _no_value

name	EG272633 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260130 GeneID:272633 MGI:3645897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : predicted gene, EG272633 pseudo : _no_value transcript_id : XR_001924.2

clone name	MSMg01-299N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-051K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491F02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-193F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-194I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339J14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-160K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260F10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-067I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244J14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-333C22.b	B6Ng01-333C22.g
ACC	GA119070	GA119071
length	1,099	1,109
definition	B6Ng01-333C22.b	B6Ng01-333C22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(88,837,238 - 88,838,335)	(88,982,320 - 88,983,429)
sequence	gaattccatttcatccttgtcagaatggctatgatcaagaaaacaaatga gaacaaatacaggagaggatgtggggaacccttattcattgctggcagga aagcaaacccgtgcagccactatggaaataagtatggaggctcctcagaa attaattagcaagaccatatcaacctcctatgtaactcttacaaatatat ttaaagtaagttaagtcaacatagcacagaaatacctacatgtcatgttt attgttacaatacttatacttgacgaaaatagacctagcctagatctcca tcaacattaaaatggataaaggaaacgtgatacatagccagaatgttatg aacctgtaaataaaaagtggaattatgacatttgttagggaaatagatgc aactgagatcattatgtgtagtggaataacttgaacttagaaagtcagat gccatacttttcttttcaatgtagggtttatatgagtctgttcctcataa taccagttttcctaggatccaacctactagaaatagtgttgtgcaaatag cagtcctaaaatacagatttaaccatattgcagtcctattttagaccttt caaatgtccctcttattttcagctcacaacctagttagtactcagagcct ggtactcaaggctaccatgatttggattcccctctcctaacacatccata cactacagtccacagtttagctcatcacaaaacatacttgaagcacactg gtgcacctcacaagggtacactttctcattggcgacattttgtttatctg taaaagccaacttttgtgtcagtcttctcagaaaagaccattttgttgtt gttgttgttgttgttggtttacactctgagagatgtgttaatgacccaag actccattatttaggacctggctgtggcaagtgttcagtagagcttgttg agctaatggcttggtgcatagatgtcaattctctattctttgctccctag tgaatggtaggccttggcatttgtagaaaattgcattttagagacccagt ttccacttgctatcataaggtacttctgcttggttttaaatatggcttt	gaattccattgtgctaatccacttcattggcattaccctgggacgtgaaa atacatttgcaggtgaattggtatagtgctgactgacataaaacttaatg ggttggtggcatggctcaatggctaagagcactgatgcccccttctggtg tgtctgaagagagcaatagtgtactcatatctgtaaaatgaataaataaa tctcatatatatgaaaccacattgtgttctgtttctttaggtaactaagc ttctcttgttttgtttgcaggacttggatgacttgttcagaaggtgagtt tagtcctcagtgtaagccaggataccctgacctatggaaaaagcagaaca agacctcttagcaaagtatagatacactttgtttagcaaatccttaattg tttatggatgttgtgtttgggatggttttcatgggtatgatggctgttca cctttctatcagacagtgtcttttctttctccctatgaatgaagtagtgt atgtaatgggcttgagctaaaatttgttgttttccaatcccaatcattga ggcccacgggctatattttcctggtagtagaagaaaggggctggaagcat gggaagaacggaattggtagcaggagggcttcagaaacagcatctaagag gaaactaccctgtctcctgatcatggggtttctttaatatcagaaaatgt tttgtgtgaaaaatgttcaggtaagtgtttacttttataaaaattcaatt tctatgaatacctatgtgagtgcacatgtgtgcagggcagaggaccactc tcagtcagtctttctccttacaccatgggatcctgggattgaagttcagt tgtcaagttgtatggcaagggttttaacccctgagtcttacttagctctg agtgaagatttctcttcatcactggaatgataatcttagcatatcaatgt cttcttcttgcaggagtaagctagcggcaaagcttgacaatgccacaggg tatgataccaagactcgtgccattcaattcttgggctgactgcaaggact cactctttcgaggtgagtgacaggactgattatatgaccagagtgccctt cacacagtg
quality values	Open. Hide. 62 47 23 31 62 62 37 22 62 62 62 31 22 62 62 62 62 62 62 62 59 43 62 62 62 59 62 59 43 51 46 29 34 28 28 27 34 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 59 62 62 54 54 46 62 62 62 62 62 62 54 54 54 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 34 47 62 62 62 62 62 62 62 43 52 43 62 48 54 62 47 62 62 62 62 62 54 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 54 58 58 52 52 54 52 54 54 58 58 54 54 54 54 52 52 54 53 58 54 47 52 52 44 49 52 58 58 54 58 54 54 37 42 49 52 52 52 54 58 58 43 54 50 58 43 52 54 54 58 54 46 58 58 58 58 52 52 47 41 52 52 58 46 54 47 58 58 58 53 49 50 48 49 48 42 50 50 50 41 31 43 51 41 58 52 53 51 51 51 54 54 51 51 52 58 50 47 47 50 54 40 42 46 30 43 52 53 29 31 58 48 49 50 39 22 44 51 58 51 51 58 54 58 39 51 39 49 48 34 43 44 47 49 46 33 50 41 52 50 50 50 49 40 43 40 37 37 53 44 41 39 51 49 47 50 50 43 41 44 40 40 43 52 53 58 58 40 49 39 49 51 39 40 52 52 39 44 36 49 52 50 34 40 53 45 44 49 49 51 32 49 31 50 44 40 42 44 40 54 49 34 49 38 40 42 44 51 53 42 40 32 49 37 49 39 38 40 47 27 24 52 53 41 45 53 45 37 47 32 47 44 40 27 42 18 29 53 54 54 40 54 38 54 45 32 40 32 47 51 33 40 53 53 53 28 28 40 29 37 26 33 46 49 41 51 32 47 30 31 31 31 39 40 53 31 32 31 36 33 28 52 49 51 45 28 45 11 22 30 31 51 46 25 33 18 30 41 18 37 32 21 33 32 7 33 32 21 32 45 29 26 32 22 43 42 21 7 47 25 24 29 19 30 42 34 36 32 33 18 37 24 30 17 41 21 29 23 31 27 24 27 43 30 20 28 25 23 32 31 27 21 31 19 23 21 31 31 31 24 46 31 14 6 10 33 17 22 22 21 25 18 31 30 22 32 31 26 33 23 29 31 39 21 34 34 26 31 33 43 24 39 18 27 19 16 36 18 22 20 31 20 32 22 16 38 23 30 25 30 25 28 24 24 6 24 21 21 30 31 27 33 31 31 25 29 23 22 37 38 21 11 22 23 37 34 32 31 19 43 19 32 31 23 14 34 26 21 34 15 8 24 24 28 24 22 13 4 9 10 15 10 14 19 22 15 24 4 18 24 34 23 5 6 19 19 32 43 19 9 11 19 32 24 15 22 38 38 28 26 10 28 20 22 15 30 16 18 6 16 10 14 14 8 10 13 14 15 26 17 16 24 27 27 13 7 6 28 8 11 12 20 10 21 9 19 13 27 27 8 13 21 19 3 31 22 18 20 47 27 6 13 20 22 18 14 16 29 8	Open. Hide. 62 59 51 59 62 62 59 49 49 49 43 27 31 36 43 34 45 56 56 59 59 59 62 62 54 59 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 46 62 49 49 49 42 59 62 62 54 62 59 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 59 59 62 62 62 62 54 54 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 54 62 62 62 62 43 62 50 62 62 62 62 41 39 62 62 62 62 62 62 62 62 54 54 47 46 40 52 52 46 52 52 52 52 52 58 52 58 58 48 49 52 52 52 54 58 54 58 50 58 58 52 58 58 46 58 58 58 48 58 52 58 48 58 58 58 58 58 50 58 53 54 58 58 58 58 58 42 58 42 38 52 52 58 30 41 58 46 58 52 54 50 54 52 39 58 58 35 54 48 48 49 47 46 53 42 54 47 47 48 37 26 37 42 49 49 49 39 54 50 58 26 49 54 58 37 42 53 50 42 24 27 50 58 49 46 41 43 39 42 50 41 50 46 31 36 51 58 58 51 47 58 52 52 49 58 50 35 58 49 50 50 50 50 31 58 58 49 25 32 46 30 58 24 26 51 53 52 53 49 50 58 49 58 50 39 39 22 39 41 49 58 53 32 39 51 37 53 53 34 58 50 42 45 58 58 58 51 39 39 25 54 54 54 33 16 10 15 33 25 54 54 49 42 41 39 42 45 54 23 31 26 15 40 41 52 42 47 39 35 54 31 49 49 32 33 42 31 53 53 45 40 45 53 40 33 20 54 54 30 37 26 19 7 47 31 22 42 25 37 51 30 31 32 32 24 17 33 32 40 39 23 8 52 9 12 29 26 32 32 36 21 36 24 31 25 27 32 32 52 32 26 31 25 20 23 45 53 31 33 21 28 31 25 40 21 42 36 34 31 12 46 28 32 28 18 7 8 12 11 25 31 20 30 31 51 40 24 43 13 29 51 46 32 51 51 30 31 20 31 37 37 27 16 31 38 21 18 21 27 18 19 24 30 31 26 31 34 32 26 31 21 30 17 26 30 27 33 18 31 30 46 31 21 27 14 6 12 21 17 31 32 18 32 15 46 11 13 31 27 19 37 21 22 31 32 32 16 32 22 19 27 9 20 25 26 12 22 25 18 31 16 14 29 9 18 7 12 31 21 27 32 27 38 22 14 31 23 32 12 34 20 32 38 31 19 21 8 13 11 29 31 35 12 16 33 16 25 10 8 8 11 27 13 22 26 12 6 11 12 28 10 4 7 10 10 22 21 27 23 18 19 22 14 19 8 20 16 6 5 21 34 22 14 30 32 28 7 6 19 8 21 8 8 26 40 17 9 28 23 28 13 10 20 17 27 11 8 24 5 9 7 6 25 16 13 15 7 28 11 9 5 6 8 21 12 14 7 4 4 9 4 6 6 4 9 11 13 6 8 14 6 8 7 4 13 6 18 16 27 16 10 7 11 13 5 12 9 21 17 9 8 5 4 4 10 12 12 5 12 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_88837238_88838335
seq2: B6Ng01-333C22.b_48_1146

seq1  GAATTCCATTTCATCCTTGTCAGAATGGCTATGATCAAGAAAACAAATGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATTTCATCCTTGTCAGAATGGCTATGATCAAGAAAACAAATGA  50

seq1  GAACAAATACAGGAGAGGATGTGGGGAACCCTTATTCATTGCTGGCAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAAATACAGGAGAGGATGTGGGGAACCCTTATTCATTGCTGGCAGGA  100

seq1  AAGCAAACCCGTGCAGCCACTATGGAAATAAGTATGGAGGCTCCTCAGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAAACCCGTGCAGCCACTATGGAAATAAGTATGGAGGCTCCTCAGAA  150

seq1  ATTAATTAGCAAGACCATATCAACCTCCTATGTAACTCTTACAAATATAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAATTAGCAAGACCATATCAACCTCCTATGTAACTCTTACAAATATAT  200

seq1  TTAAAGTAAGTTAAGTCAACATAGCACAGAAATACCTACATGTCATGTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGTAAGTTAAGTCAACATAGCACAGAAATACCTACATGTCATGTTT  250

seq1  ATTGTTACAATACTTATACTTGACGAAAATAGACCTAGCCTAGATCTCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTACAATACTTATACTTGACGAAAATAGACCTAGCCTAGATCTCCA  300

seq1  TCAACATTAAAATGGATAAAGGAAACGTGATACATAGCCAGAATGTTATG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACATTAAAATGGATAAAGGAAACGTGATACATAGCCAGAATGTTATG  350

seq1  AACCTGTAAATAAAAAGTGGAATTATGACATTTGTTAGGGAAATAGATGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTGTAAATAAAAAGTGGAATTATGACATTTGTTAGGGAAATAGATGC  400

seq1  AACTGAGATCATTATGTGTAGTGGAATAACTTGAACTTAGAAAGTCAGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGAGATCATTATGTGTAGTGGAATAACTTGAACTTAGAAAGTCAGAT  450

seq1  GCCATACTTTTCTTTTCAATGTAGGGTTTATATGAGTCTGTTCCTCATAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATACTTTTCTTTTCAATGTAGGGTTTATATGAGTCTGTTCCTCATAA  500

seq1  TACCAGTTTTCCTAGGATCCAACCTACTAGAAATAGTGTTGTGCAAATAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAGTTTTCCTAGGATCCAACCTACTAGAAATAGTGTTGTGCAAATAG  550

seq1  CAGTCCTAAAATACAGATTTAACCATATTGCAGTCCTATTTTAGACCTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCCTAAAATACAGATTTAACCATATTGCAGTCCTATTTTAGACCTTT  600

seq1  CAAATGTCCCTCTTATTTTCAGCTCACAACCTAGTTAGTACTCAGAGCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATGTCCCTCTTATTTTCAGCTCACAACCTAGTTAGTACTCAGAGCCT  650

seq1  GGTACTCAAGGCTACCATGATTTGGATTCCCCTCTCCTAACACATCCATA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACTCAAGGCTACCATGATTTGGATTCCCCTCTCCTAACACATCCATA  700

seq1  CACTACAGTCCACAGTTTAGCTCATCACAAAACATACTTGAAGCACACTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTACAGTCCACAGTTTAGCTCATCACAAAACATACTTGAAGCACACTG  750

seq1  GTGCACCTCACAAGGGTACACTTTCTCATTGGCGACATTTTGTTTATCTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCACCTCACAAGGGTACACTTTCTCATTGGCGACATTTTGTTTATCTG  800

seq1  TAAAAGCCAACTTTTGTGTCAGTCTTCTCAGAAAAGACCATTTTGTTGTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGCCAACTTTTGTGTCAGTCTTCTCAGAAAAGACCATTTTGTTGTT  850

seq1  GTTGTTGTTGTTGTTGGTTTACACTCTGAGAGATGTGTTAATGACCCAAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTTGTTGTTGTTGGTTTACACTCTGAGAGATGTGTTAATGACCCAAG  900

seq1  ACTCCATTATTTAGGACCTGGCTGTGGCAAGTGTTCAGTAGAGCTTGTTG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCATTATTTAGGACCTGGCTGTGGCAAGTGTTCAGTAGAGCTTGTTG  950

seq1  AGCTAATGGCTTGGTGCATAGATGTCAATTCTCTATTCTTTGCTCCCTAG  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAATGGCTTGGTGCATAGATGTCAATTCTCTATTCTTTGCTCCCTAG  1000

seq1  TGAATGGTTAGGCCTTGGCATTTGTAGAAAATTGCATTTTAGAGACCCAG  1050
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGG-TAGGCCTTGGCATTTGTAGAAAATTGCATTTTAGAGACCCAG  1049

seq1  TTT-CACTTGCTATCATAA-GTACTTCTGCTTGGTTTTAAATATGGCTTT  1098
      ||| ||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TTTCCACTTGCTATCATAAGGTACTTCTGCTTGGTTTTAAATATGGCTTT  1099

seq1: chr9_88982320_88983429
seq2: B6Ng01-333C22.g_69_1177 (reverse)

seq1  CACTGT-TGAAGGGCACCTCTGGTCATTATATCAGTCCTGACACTCACCT  49
      |||||| ||||||||| ||||||||||   |||||||||| |||||||||
seq2  CACTGTGTGAAGGGCA-CTCTGGTCATATAATCAGTCCTGTCACTCACCT  49

seq1  CGGAAGGAGTTGAG-CCTTGCAGTCAGCCCAGGAATGGAATGGGCACGGA  98
      | ||| ||| |||| |||||||||||||||| |||| |||| ||||| ||
seq2  C-GAAAGAG-TGAGTCCTTGCAGTCAGCCCAAGAATTGAAT-GGCAC-GA  95

seq1  GTCTTGGTATCATACCCTGTGGCA-TGTCCAGCTTTGCCGCTAGCTTACT  147
      |||||||||||||||||||||||| |||| ||||||||||||||||||||
seq2  GTCTTGGTATCATACCCTGTGGCATTGTCAAGCTTTGCCGCTAGCTTACT  145

seq1  CCTGCAAGGAGAAGACATTGATATGCTAAGATTATCATCCCAGTGATGAG  197
      |||||||| ||||||||||||||||||||||||||||| |||||||||| 
seq2  CCTGCAAGAAGAAGACATTGATATGCTAAGATTATCATTCCAGTGATGAA  195

seq1  GAGAAATCTTCACTCAGAGCTAAGTAAGACTCAGGGGTTAAAACCCTTGC  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAATCTTCACTCAGAGCTAAGTAAGACTCAGGGGTTAAAACCCTTGC  245

seq1  CATACAACCTGACAACTGAACTTCAATCCCAGGATCCCATGGTGTAAGGA  297
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CATACAACTTGACAACTGAACTTCAATCCCAGGATCCCATGGTGTAAGGA  295

seq1  G-AAGACTGACTGAGAGTGGTCCTCTGCCCTGCACACATGTGCACTCACA  346
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGACTGACTGAGAGTGGTCCTCTGCCCTGCACACATGTGCACTCACA  345

seq1  TAGGTATTCATAGAAATTGAATTTTTATAAAAGTAAACACTTACCTGAAC  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTATTCATAGAAATTGAATTTTTATAAAAGTAAACACTTACCTGAAC  395

seq1  ATTTTTCACACAAAACATTTTCTGATATTAAAGAAACCCCATGATCAGGA  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTCACACAAAACATTTTCTGATATTAAAGAAACCCCATGATCAGGA  445

seq1  GACAGGGTAGTTTCCTCTTAGATGCTGTTTCTGAAGCCCTCCTGCTACCA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGGTAGTTTCCTCTTAGATGCTGTTTCTGAAGCCCTCCTGCTACCA  495

seq1  ATTCCGTTCTTCCCATGCTTCCAGCCCCTTTCTTCTACTACCAGGAAAAT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCGTTCTTCCCATGCTTCCAGCCCCTTTCTTCTACTACCAGGAAAAT  545

seq1  ATAGCCCGTGGGCCTCAATGATTGGGATTGGAAAACAACAAATTTTAGCT  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCCCGTGGGCCTCAATGATTGGGATTGGAAAACAACAAATTTTAGCT  595

seq1  CAAGCCCATTACATACACTACTTCATTCATAGGGAGAAAGAAAAGACACT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCCCATTACATACACTACTTCATTCATAGGGAGAAAGAAAAGACACT  645

seq1  GTCTGATAGAAAGGTGAACAGCCATCATACCCATGAAAACCATCCCAAAC  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGATAGAAAGGTGAACAGCCATCATACCCATGAAAACCATCCCAAAC  695

seq1  ACAACATCCATAAACAATTAAGGATTTGCTAAACAAAGTGTATCTATACT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACATCCATAAACAATTAAGGATTTGCTAAACAAAGTGTATCTATACT  745

seq1  TTGCTAAGAGGTCTTGTTCTGCTTTTTCCATAGGTCAGGGTATCCTGGCT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTAAGAGGTCTTGTTCTGCTTTTTCCATAGGTCAGGGTATCCTGGCT  795

seq1  TACACTGAGGACTAAACTCACCTTCTGAACAAGTCATCCAAGTCCTGCAA  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACTGAGGACTAAACTCACCTTCTGAACAAGTCATCCAAGTCCTGCAA  845

seq1  ACAAAACAAGAGAAGCTTAGTTACCTAAAGAAACAGAACACAATGTGGTT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAACAAGAGAAGCTTAGTTACCTAAAGAAACAGAACACAATGTGGTT  895

seq1  TCATATATATGAGATTTATTTATTCATTTTACAGATATGAGTACACTATT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATATATATGAGATTTATTTATTCATTTTACAGATATGAGTACACTATT  945

seq1  GCTCTCTTCAGACACACCAGAAGGGGGCATCAGTGCTCTTAGCCATTGAG  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTCTTCAGACACACCAGAAGGGGGCATCAGTGCTCTTAGCCATTGAG  995

seq1  CCATGCCACCAACCCATTAAGTTTTATGTCAGTCAGCACTATACCAATTC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGCCACCAACCCATTAAGTTTTATGTCAGTCAGCACTATACCAATTC  1045

seq1  ACCTGCAAATGTATTTTCACGTCCCAGGGTAATGCCAATGAAGTGGATTA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGCAAATGTATTTTCACGTCCCAGGGTAATGCCAATGAAGTGGATTA  1095

seq1  GCACAATGGAATTC  1110
      ||||||||||||||
seq2  GCACAATGGAATTC  1109

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information