MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-334L24
Chromosome	9 (Build37)
Map Location	122,150,225 - 122,347,028
singlet/doublet	doublet
Overlap gene	Tmem16k, Abhd5
Upstream gene	Ulk4, Trak1, Cck, Lyzl4, Vipr1, LOC100040063, Sec22c, Deb1, Nktr, Kbtbd5, Hhatl, Ccdc13, Higd1a, Ccbp2, Cyp8b1, C730027P07Rik, C85492, LOC100040121, Snrk
Downstream gene	LOC100040193, LOC100040204, 9530059O14Rik, LOC666218, LOC671232, D9Ertd402e, Zfp445, LOC623874, Zfp167, EG666257, Zfp660, Zfp105, 1110059G10Rik, Kif15, Tmem42, Tgm4, Zdhhc3, Exosc7, Clec3b, Cdcp1, Tmem158, Scp2-ps2, Lars2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ulk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209012 MGI:1921622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Trak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67095 MGI:1914345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12424 MGI:88297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyzl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69032 MGI:1916282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vipr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22354 MGI:109272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Sec22c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215474 MGI:2447871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Deb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26901 MGI:1349474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nktr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18087 MGI:97346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kbtbd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72330 MGI:1919580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hhatl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74770 MGI:1922020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434446 MGI:1920144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56295 MGI:1930666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59289 MGI:1891697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp8b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13124 MGI:1338044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730027P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245050 MGI:3041196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C85492 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215494 MGI:2143424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Snrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20623 MGI:108104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102566 MGI:2143103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67469 MGI:1914719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040193 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9530059O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319626 MGI:2442421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	LOC666218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC671232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	D9Ertd402e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382117 MGI:1196217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235682 MGI:2143340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Zfp167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382118 MGI:3040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 10 Proteins

name	EG666257 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666257 MGI:3645415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Zfp660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623911 MGI:3643882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Zfp105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22646 MGI:1277119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110059G10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66202 MGI:1913452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209737 MGI:1098258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66079 MGI:1277176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331046 MGI:3027002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69035 MGI:1926134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66446 MGI:1913696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21922 MGI:104540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdcp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109332 MGI:2442010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem158 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72309 MGI:1919559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scp2-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20282 MGI:107679
definition	note : sterol carrier protein 2, pseudogene 2 pseudo : _no_value

name	Lars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102436 MGI:2142973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ulk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260413 GeneID:209012 MGI:1921622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : unc-51-like kinase 4 (C. elegans) transcript_id : XM_001481114.1

name	Trak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517684 GeneID:67095 MGI:1914345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein, kinesin binding 1 transcript_id : NM_175114.3

name	Cck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130260 GeneID:12424 MGI:88297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholecystokinin transcript_id : NM_031161.2

name	Lyzl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982636 GeneID:69032 MGI:1916282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysozyme-like 4 transcript_id : NM_026915.2

name	Vipr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367730 GeneID:22354 MGI:109272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasoactive intestinal peptide receptor 1 transcript_id : NM_011703.3

name	Sec22c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372397 GeneID:215474 MGI:2447871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC22 vesicle trafficking protein-like C (S. cerevisiae) transcript_id : NM_178677.3

name	Deb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982638 GeneID:26901 MGI:1349474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : differentially expressed in B16F10 1 transcript_id : NM_026794.2

name	Nktr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62526129 GeneID:18087 MGI:97346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natural killer tumor recognition sequence transcript_id : NM_010918.2

name	Kbtbd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802237 GeneID:72330 MGI:1919580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch repeat and BTB (POZ) domain containing 5 transcript_id : NM_028202.2

name	Hhatl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312881 GeneID:74770 MGI:1922020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hedgehog acyltransferase-like transcript_id : NM_029095.1

name	Ccdc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702098 GeneID:434446 MGI:1920144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 13 transcript_id : NM_001033784.1

name	Higd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361374 GeneID:56295 MGI:1930666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 1A transcript_id : NM_019814.3

name	Ccbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371177 GeneID:59289 MGI:1891697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine binding protein 2 transcript_id : NM_021609.3

name	Cyp8b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981807 GeneID:13124 MGI:1338044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 8, subfamily b, polypeptide 1 transcript_id : NM_010012.2

name	C730027P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386694 GeneID:245050 MGI:3041196
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730027P07 gene transcript_id : NM_177743.3

name	C85492 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593062 GeneID:215494 MGI:2143424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C85492 transcript_id : NM_153540.3

name	LOC100040121 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260356 GeneID:100040121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040121 transcript_id : XM_001474116.1

name	Snrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526941 GeneID:20623 MGI:108104
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF related kinase transcript_id : NM_133741.1

name	Tmem16k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802585 GeneID:102566 MGI:2143103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16K transcript_id : NM_133979.2

name	Abhd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88703067 GeneID:67469 MGI:1914719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 5 transcript_id : NM_026179.2

name	9530059O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260358 GeneID:319626 MGI:2442421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : RIKEN cDNA 9530059O14 gene transcript_id : XM_982329.2

name	LOC666218 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260359 GeneID:666218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : gene model 847, (NCBI) transcript_id : XM_982360.2

name	LOC671232 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260361 GeneID:671232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to hCG1790160 transcript_id : XM_001474362.1

name	D9Ertd402e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61696135 GeneID:382117 MGI:1196217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 9, ERATO Doi 402, expressed transcript_id : NM_001013405.1

name	Zfp445 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896628 GeneID:235682 MGI:2143340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 445 transcript_id : NM_173364.4

name	LOC623874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260363 GeneID:623874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC623874 transcript_id : XM_356204.6

name	Zfp167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260365 GeneID:382118 MGI:3040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 10 Proteins product : zinc finger protein 167 transcript_id : XM_001474510.1

name	EG666257 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386609 GeneID:666257 MGI:3645415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG666257 transcript_id : XM_982630.1

name	Zfp105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374172 GeneID:22646 MGI:1277119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 105 transcript_id : NM_009544.2

name	1110059G10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360114 GeneID:66202 MGI:1913452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110059G10 gene transcript_id : NM_025419.3

name	Kif15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930324 GeneID:209737 MGI:1098258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 15 transcript_id : NM_010620.1

name	Tmem42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370779 GeneID:66079 MGI:1277176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 42 transcript_id : NM_025339.3

name	Tgm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344020 GeneID:331046 MGI:3027002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 4 (prostate) transcript_id : NM_177911.3

name	Zdhhc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328460 GeneID:69035 MGI:1926134
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 3 transcript_id : NM_026917.4

name	Exosc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487126 GeneID:66446 MGI:1913696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 7 transcript_id : NM_001081188.1

name	Clec3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755820 GeneID:21922 MGI:104540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 3, member b transcript_id : NM_011606.1

name	Cdcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129908 GeneID:109332 MGI:2442010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUB domain containing protein 1 transcript_id : NM_133974.3

name	Tmem158 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116805335 GeneID:72309 MGI:1919559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 158 transcript_id : NM_001002267.2

name	Lars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130101 GeneID:102436 MGI:2142973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucyl-tRNA synthetase, mitochondrial transcript_id : NM_153168.2

name	Ulk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260414 GeneID:209012 MGI:1921622
definition	codon_start : 1 product : unc-51-like kinase 4 protein_id : XP_001481164.1

name	Trak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517685 GeneID:67095 MGI:1914345
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence IDA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS]; GO:0006605 - protein targeting [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : trafficking protein, kinesin binding 1 protein_id : NP_780323.2

name	Cck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624301 CCDS:CCDS23631.1 GeneID:12424 MGI:88297
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0042755 - eating behavior [Evidence IDA]; GO:0001764 - neuron migration [Evidence IDA] codon_start : 1 product : cholecystokinin protein_id : NP_112438.1

name	Lyzl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312181 CCDS:CCDS23632.1 GeneID:69032 MGI:1916282
definition	GO_function : GO:0003796 - lysozyme activity [Evidence IEA] GO_process : GO:0016998 - cell wall catabolism [Evidence IEA] codon_start : 1 product : lysozyme-like protein 4 protein_id : NP_081191.1

name	Vipr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543948 CCDS:CCDS23633.1 GeneID:22354 MGI:109272
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004999 - vasoactive intestinal polypeptide receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : VIP receptor subtype 1 product : vasoactive intestinal peptide receptor 1 protein_id : NP_035833.2

name	Sec22c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520061 CCDS:CCDS23634.1 GeneID:215474 MGI:2447871
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SEC22 vesicle trafficking protein-like 3 protein_id : NP_848792.1

name	Deb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312078 GeneID:26901 MGI:1349474
definition	codon_start : 1 note : Band 47B product : differentially expressed in B16F10 1 protein_id : NP_081070.1

name	Nktr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526130 CCDS:CCDS23636.1 GeneID:18087 MGI:97346
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cyclophilin-related protein; natural killer tumor recognition protein product : natural killer tumor recognition protein_id : NP_035048.3

name	Kbtbd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625935 CCDS:CCDS23637.1 GeneID:72330 MGI:1919580
definition	codon_start : 1 product : kelch repeat and BTB (POZ) domain containing 5 protein_id : NP_082478.1

name	Hhatl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312882 CCDS:CCDS23638.1 GeneID:74770 MGI:1922020
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : Gup1, glycerol uptake/transporter homolog protein_id : NP_083371.1

name	Ccdc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702099 CCDS:CCDS23639.1 GeneID:434446 MGI:1920144
definition	codon_start : 1 product : coiled-coil domain containing 13 protein_id : NP_001028956.1

name	Higd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789977 GeneID:56295 MGI:1930666
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypoxia induced gene 1 protein_id : NP_062788.1

name	Ccbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542483 CCDS:CCDS23640.1 GeneID:59289 MGI:1891697
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : D6 beta-chemokine receptor product : chemokine binding protein 2 protein_id : NP_067622.2

name	Cyp8b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981808 CCDS:CCDS23641.1 GeneID:13124 MGI:1338044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 8b1, sterol 12 alpha-hydrolase; sterol 12-alpha-hydrolase product : cytochrome P450, family 8, subfamily b, polypeptide 1 protein_id : NP_034142.2

name	C730027P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244228 GeneID:245050 MGI:3041196
definition	codon_start : 1 product : hypothetical protein LOC245050 protein_id : NP_808411.1

name	C85492 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593063 CCDS:CCDS23643.1 GeneID:215494 MGI:2143424
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase protein_id : NP_705768.3

name	LOC100040121 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260357 GeneID:100040121
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474166.1

name	Snrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526942 CCDS:CCDS23644.1 GeneID:20623 MGI:108104
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SNF related kinase protein_id : NP_598502.1

name	Tmem16k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794236 CCDS:CCDS23645.1 GeneID:102566 MGI:2143103
definition	codon_start : 1 product : hypothetical protein LOC102566 protein_id : NP_598740.1

name	Abhd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385690 CCDS:CCDS23646.1 GeneID:67469 MGI:1914719
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005811 - lipid particle [Evidence IDA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : abhydrolase domain containing 5 protein_id : NP_080455.1

name	9530059O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386602 GeneID:319626 MGI:2442421
definition	codon_start : 1 product : hypothetical protein LOC319626 protein_id : XP_987423.1

name	LOC666218 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260360 GeneID:666218
definition	codon_start : 1 product : similar to hCG1643239 protein_id : XP_987454.2

name	LOC671232 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260362 GeneID:671232
definition	codon_start : 1 product : similar to hCG1790160 protein_id : XP_001474412.1

name	D9Ertd402e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61696136 CCDS:CCDS23647.1 GeneID:382117 MGI:1196217
definition	codon_start : 1 product : hypothetical protein LOC382117 protein_id : NP_001013423.1

name	Zfp445 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71896629 CCDS:CCDS23648.1 GeneID:235682 MGI:2143340
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 445 protein_id : NP_775540.3

name	LOC623874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260364 GeneID:623874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_356204.6

name	Zfp167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260366 GeneID:382118 MGI:3040678
definition	codon_start : 1 product : similar to Zfp167 protein protein_id : XP_001474560.1

name	EG666257 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386610 GeneID:666257 MGI:3645415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987724.1

name	Zfp105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374173 CCDS:CCDS23649.1 GeneID:22646 MGI:1277119
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 105 protein_id : NP_033570.2

name	1110059G10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541808 CCDS:CCDS23650.1 GeneID:66202 MGI:1913452
definition	codon_start : 1 product : hypothetical protein LOC66202 protein_id : NP_079695.2

name	Kif15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930325 CCDS:CCDS23651.1 GeneID:209737 MGI:1098258
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : kinesin 15; N-10 kinesin product : kinesin-like 7 protein_id : NP_034750.1

name	Tmem42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384708 CCDS:CCDS23652.1 GeneID:66079 MGI:1277176
definition	codon_start : 1 product : transmembrane protein 42 protein_id : NP_079615.1

name	Tgm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244550 CCDS:CCDS23653.1 GeneID:331046 MGI:3027002
definition	GO_function : GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 exception : mismatches in translation note : experimental autoimmune prostatitis antigen 1 product : transglutaminase 4 (prostate) protein_id : NP_808579.1

name	Zdhhc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754040 CCDS:CCDS23654.1 GeneID:69035 MGI:1926134
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA]; GO:0006605 - protein targeting [Evidence IDA] codon_start : 1 note : GABA-A receptor-associated membrane protein 1 product : zinc finger, DHHC domain containing 3 protein_id : NP_081193.2

name	Exosc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487127 GeneID:66446 MGI:1913696
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000175 - 3'-5'-exoribonuclease activity [Evidence ISS] [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006401 - RNA catabolism [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] [Evidence ISS] codon_start : 1 product : exosome component 7 protein_id : NP_001074657.1

name	Clec3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755821 CCDS:CCDS23656.1 GeneID:21922 MGI:104540
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS]; GO:0005615 - extracellular space [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0005529 - sugar binding [Evidence TAS] GO_process : GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 exception : mismatches in translation note : tetranectin (plasminogen-binding protein); tetranectin (plasminogen binding protein) product : C-type lectin domain family 3, member b protein_id : NP_035736.1

name	Cdcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098143 CCDS:CCDS23657.1 GeneID:109332 MGI:2442010
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : CUB domain-containing protein 1 protein_id : NP_598735.2

name	Tmem158 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116805336 CCDS:CCDS23658.1 GeneID:72309 MGI:1919559
definition	codon_start : 1 note : BINP binding protein p40BBP; brain injury-derived neurotrophic peptide (BINP) binding protein product : Ras-induced senescence 1 protein_id : NP_001002267.2

name	Lars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346617 CCDS:CCDS23659.1 GeneID:102436 MGI:2142973
definition	EC_number : 6.1.1.4 GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : leucyl-tRNA synthetase, mitochondrial protein_id : NP_694808.1

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 1 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 2 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 3 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 4 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 5 pseudo : _no_value

name	LOC100040193 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040193
definition	number : 1 pseudo : _no_value

name	LOC100040193 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040193
definition	number : 2 pseudo : _no_value

name	LOC100040204 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040204
definition	number : 2 pseudo : _no_value

name	LOC100040204 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040204
definition	number : 1 pseudo : _no_value

name	Zfp660 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260367 GeneID:623911 MGI:3643882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : zinc finger protein 660 pseudo : _no_value transcript_id : XR_031805.1

clone name	MSMg01-331K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153C14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-511J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-334L24.b	B6Ng01-334L24.g
ACC	GA120178	GA120179
length	1,165	662
definition	B6Ng01-334L24.b	B6Ng01-334L24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(122,345,868 - 122,347,028)	(122,150,225 - 122,150,886)
sequence	gaattctgggatgtgtatctagctcctgtctctgactcacctcttccttt cctatcaccacactgctttgacaatgagtggcttgtggtatattttagcg tcaatcgaggcaagggcagccttccaagttttcactttctcatccttctg gagtgcaggttcctctctgtgaactgtgaagccattgtgttaggaagcta atggcagaaggcctggaattgggctgagtggtttcacagaaatatgagat gaattttcttggcacggccccaatcctgatgagtgattcagcttcagagc tacagtccacagatgtcccttctgttcgtgtgtcacagaccaaatcaaat tagatggccctgctgacttcaaaaggacaggaaaatgctaccctgagggg agggcagtgggaagttgaggaatattaataggggagatgacacacctgtg ggctgagtctattccagctgccaggagtcttgaacttcttccttcacagt caggaagctgagagttcaagatcaagggagcaggtgtgttctggtgaagc cttctttcttcccttcctcttccctcccctcctctctcctctcctctgtc cctttatttctcttctctccccttctcttccttttccttctttctctccc ttcccctcccccttccctttctttccccttccctccctctcctctccttc ctcccctccccctcccattcctcctctcccctcccctcccctttcttttc ccttccttttttttcccctttctactttttcttttcagacacagaatcaa aagagcgggagcctcaaagtttgggccctgaaagcccctgcaggcaaact catcttttcctaggacattgtcttagtttcttttttgatgcttagatgaa acaccccaacaaagccacttgagtctcgcagttctggattatgtttcatc acagtgaagtcctgaccagtggagagcttaagttgataacctctgcactc aagaagcagcttaatctctcagttcctggtgtgactggcactgccagcca aaagtatgcctctcttcctttagagcaggtcttcccacctgactacctta attaagacaactctcccacggggtggccagagtctcaaccctcctgatcc ctccaatgtgcctga	gaattctgagtcatatgactgcattactattcaaagatgacacacgtgga ttaacggaaagcacactcctccctggaaatgcctctctagtttccatatg cttttgactaacatcaaaatgaaatggtgtcaaaagacagataccaataa agcttcctactggtaaccacatgaaaatacagaggctggagctggctcag tgggtaaagtatccactgtgcaagtgtggggatgtgagttcaaatcccca cagcactcctaaggacagatgtgggagcacacacgtgtaatccccgaatc ctatcagcagagacaggtcagctagtgatcggatcagcaaacctgggtgg ggtatacagcagcaaacaagagtgtctcaaatgaggtggaaggtgaggag tgtcacttgtgactgtctgacagccacacatgtgctatgccatgcatgtg cctcacacacatgcatgtgcactctcacaccgattcccctggaggagcac agtttctctaaaaaccttgactaagatgtgtgcaatacaggagagctgag gaggaatgcctaggatctgtccttcctctcaggataaaatgaccaactaa cacctcctgttattctcacttgtgaatttgtacacatgcttgagtgcttc tgtgtgtgtgtg
quality values	Open. Hide. 49 31 33 35 58 62 47 62 62 62 25 19 25 41 47 62 56 37 56 62 41 43 46 49 62 62 62 62 62 56 62 59 49 56 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 42 42 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 51 62 62 56 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 56 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 52 54 62 62 62 52 62 62 62 62 43 62 62 62 62 62 52 62 62 62 52 62 41 58 54 58 58 58 54 54 58 41 58 54 58 54 58 49 54 54 58 58 58 52 58 58 58 52 39 58 58 58 54 58 58 58 58 54 58 47 58 58 58 58 47 58 54 54 52 58 58 49 58 58 48 58 58 58 54 51 58 58 49 51 54 58 48 58 58 51 58 51 58 51 49 49 58 53 53 58 58 58 58 58 54 53 58 58 58 53 51 58 49 51 52 53 58 53 58 58 58 54 58 51 51 58 58 58 50 58 49 58 58 58 33 58 35 58 58 50 58 49 51 51 58 58 33 58 58 49 54 40 39 41 58 50 40 39 40 50 46 49 58 37 22 32 51 51 44 54 50 49 58 40 58 58 41 41 58 41 35 46 51 42 44 49 46 47 44 46 54 39 38 39 37 51 51 51 35 54 51 37 54 54 46 28 23 42 39 40 32 39 49 51 32 27 42 42 45 51 41 32 33 28 42 52 47 46 42 49 46 44 40 52 32 27 34 46 47 51 44 44 22 35 37 47 40 42 26 34 38 32 33 32 32 39 47 40 40 40 40 40 33 28 52 41 40 36 40 40 47 29 32 43 28 53 52 52 15 52 39 53 51 37 30 21 31 46 28 31 29 31 26 32 29 27 19 6 40 46 45 42 43 23 43 31 32 30 22 18 32 30 45 36 31 37 31 28 42 46 31 18 18 18 31 40 38 30 37 17 40 9 13 12 30 31 31 34 36 26 10 18 27 18 30 35 38 36 31 29 26 31 38 33 38 41 35 31 38 26 21 28 22 33 25 24 28 31 38 22 41 31 24 44 6 11 46 44 33 25 39 39 41 39 39 28 19 13 36 32 22 25 29 13 31 31 30 44 36 32 33 28 31 38 33 29 22 14 26 14 28 18 14 13 12 8 13 8 17 13 33 24 26 11 9 20 34 16 32 13 25 23 42 34 32 32 11 9 11 14 16 33 21 36 19 21 20 17 19 5 6 7 11 32 32 16 19 21 9 18 30 13 22 16 14 19 18 19 24 11 10 19 8 20 13 33 19 16 21 30 13 23 30 13 28 20 13 9 14 19 16 23 20 28 10 4 5 14 16 9 6 13 6 13 22 11 7 10 21 12 11 27 15 6 5 14 13 11 27 21 15 12 16 17 15 7 8 11 9 7 13 9 4 5 6 6 21 5 13 20 22 24 8 9 10 7 23 21 6 17 20 27 8 10 8 1 3 8 10 4 3 5 6 5 7 11 18 11 30 16 7 8 14 5 8 10 10 14 3 4 6 18 9 21 15 5 6 11 2 4 14 13 12 11 2 6 6 5 15 4 7 9 8 19 5 16 5 6 7 1 2 4 18 8 8 10 9 4 5 11 22 7 6 6 4 9 23 10 9 23 8 6 5 21 1 3 2 3 1 4 7 7 8 16 5 11 3 3 19 7 6 6 7 7 3 1 2 4 5 3 5 4 3 2	Open. Hide. 62 44 44 59 62 62 59 46 49 56 59 59 51 59 56 54 48 62 59 62 62 62 59 62 54 62 59 59 62 62 62 59 59 62 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 49 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 49 43 56 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 52 54 54 54 54 52 52 58 58 58 58 54 58 58 58 54 54 54 54 54 54 54 54 58 54 54 54 58 41 58 54 58 54 58 58 58 54 58 54 52 52 52 41 46 58 58 35 54 52 52 52 52 58 30 58 58 30 58 45 30 34 54 50 48 48 48 36 58 58 51 51 54 58 58 58 58 53 53 51 50 49 50 54 52 52 25 51 51 52 32 58 58 50 37 50 46 39 39 39 50 51 58 54 51 48 50 28 43 43 50 50 52 58 51 52 49 49 51 49 51 51 54 58 58 51 50 54 50 49 58 53 58 51 52 50 50 51 52 52 36 40 43 40 49 51 54 58 43 50 51 51 58 41 39 50 58 43 58 38 52 27 42 36 18 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_122345868_122347028
seq2: B6Ng01-334L24.b_48_1212 (reverse)

seq1  TCAGGCACATTTGTGAGGGATGA-GAGTGTTTAGA-TCTGGGCACACCTG  48
      |||||||||||   ||||||| | ||| ||| ||| ||||| ||| || |
seq2  TCAGGCACATT--GGAGGGATCAGGAGGGTTGAGACTCTGGCCAC-CCCG  47

seq1  TGAGAGA-TTGTCTTAATTAGGTTAGTCAAGGTGGGAAGACCTGCTCTAA  97
      || |||| |||||||||||| | ||||| |||||||||||||||||||||
seq2  TGGGAGAGTTGTCTTAATTAAGGTAGTC-AGGTGGGAAGACCTGCTCTAA  96

seq1  AGG-AGAGAGGCACTACTCTGGGCT-GCAGTGCCAGACAACACAGG-ACT  144
      ||| ||||||||| |||| | |||| |||||||||| ||   |||| |||
seq2  AGGAAGAGAGGCA-TACTTTTGGCTGGCAGTGCCAGTCACACCAGGAACT  145

seq1  G-GAGATT-AGCTGCTTCCTGAGTGCAGAGG-TATCAACTTAAGCTCT-C  190
      | |||||| ||||||||| |||||||||||| |||||||||||||||| |
seq2  GAGAGATTAAGCTGCTTCTTGAGTGCAGAGGTTATCAACTTAAGCTCTCC  195

seq1  ACT-GTCAGGGCTTCACTTGTGATGAAACATAATCCAGAACTGCGAGACT  239
      ||| |||||| |||||| ||||||||||||||||||||||||||||||||
seq2  ACTGGTCAGGACTTCAC-TGTGATGAAACATAATCCAGAACTGCGAGACT  244

seq1  CAAGGTGCTTTTGTTGGGGTGTTTTCATCTAAGCATCAAAAAAGAAACTA  289
      ||| |||  |||||||||||| ||||||||||||||||||||||||||||
seq2  CAA-GTGGCTTTGTTGGGGTG-TTTCATCTAAGCATCAAAAAAGAAACTA  292

seq1  AGACAATGTCCTAGGAAAAGATGAGTTTGCCTGCAGGGGCCTTCAGGGCC  339
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AGACAATGTCCTAGGAAAAGATGAGTTTGCCTGCAGGGGCTTTCAGGGCC  342

seq1  CAAACTTTGAGGCTCCCGCTCTTTTGATTCTGTGTCTGAAAAG-AAAAGT  388
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CAAACTTTGAGGCTCCCGCTCTTTTGATTCTGTGTCTGAAAAGAAAAAGT  392

seq1  AGAAAGGGGAAAAAAAAGGAAGGGAAAAGAAAGGGGAGGGGAGGGGAGAG  438
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAGGGGAAAAAAAAGGAAGGGAAAAGAAAGGGGAGGGGAGGGGAGAG  442

seq1  GAGGAATGGGAGGGGGAGGGGAGGAAGGAGAGGAGAGGGAGGGAAGGGGA  488
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAATGGGAGGGGGAGGGGAGGAAGGAGAGGAGAGGGAGGGAAGGGGA  492

seq1  AAGAAAGGGAAGGGGGAGGGGAAGGGAGAGAAAGAAGGAAAAGGAAGAGA  538
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAGGGAAGGGGGAGGGGAAGGGAGAGAAAGAAGGAAAAGGAAGAGA  542

seq1  AGGGGAGAGAAGAGAAATAAAGGGACAGAGGAGAGGAGAGAGGAGGGGAG  588
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGAGAGAAGAGAAATAAAGGGACAGAGGAGAGGAGAGAGGAGGGGAG  592

seq1  GGAAGAGGAAGGGAAGAAAGAAGGCTTCACCAGAACACACCTGCTCCCTT  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAGGAAGGGAAGAAAGAAGGCTTCACCAGAACACACCTGCTCCCTT  642

seq1  GATCTTGAACTCTCAGCTTCCTGACTGTGAAGGAAGAAGTTCAAGACTCC  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTTGAACTCTCAGCTTCCTGACTGTGAAGGAAGAAGTTCAAGACTCC  692

seq1  TGGCAGCTGGAATAGACTCAGCCCACAGGTGTGTCATCTCCCCTATTAAT  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAGCTGGAATAGACTCAGCCCACAGGTGTGTCATCTCCCCTATTAAT  742

seq1  ATTCCTCAACTTCCCACTGCCCTCCCCTCAGGGTAGCATTTTCCTGTCCT  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCTCAACTTCCCACTGCCCTCCCCTCAGGGTAGCATTTTCCTGTCCT  792

seq1  TTTGAAGTCAGCAGGGCCATCTAATTTGATTTGGTCTGTGACACACGAAC  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAAGTCAGCAGGGCCATCTAATTTGATTTGGTCTGTGACACACGAAC  842

seq1  AGAAGGGACATCTGTGGACTGTAGCTCTGAAGCTGAATCACTCATCAGGA  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGGGACATCTGTGGACTGTAGCTCTGAAGCTGAATCACTCATCAGGA  892

seq1  TTGGGGCCGTGCCAAGAAAATTCATCTCATATTTCTGTGAAACCACTCAG  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGGCCGTGCCAAGAAAATTCATCTCATATTTCTGTGAAACCACTCAG  942

seq1  CCCAATTCCAGGCCTTCTGCCATTAGCTTCCTAACACAATGGCTTCACAG  988
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAATTCCAGGCCTTCTGCCATTAGCTTCCTAACACAATGGCTTCACAG  992

seq1  TTCACAGAGAGGAACCTGCACTCCAGAAGGATGAGAAAGTGAAAACTTGG  1038
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACAGAGAGGAACCTGCACTCCAGAAGGATGAGAAAGTGAAAACTTGG  1042

seq1  AAGGCTGCCCTTGCCTCGATTGACGCTAAAATATACCACAAGCCACTCAT  1088
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTGCCCTTGCCTCGATTGACGCTAAAATATACCACAAGCCACTCAT  1092

seq1  TGTCAAAGCAGTGTGGTGATAGGAAAGGAAGAGGTGAGTCAGAGACAGGA  1138
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAAAGCAGTGTGGTGATAGGAAAGGAAGAGGTGAGTCAGAGACAGGA  1142

seq1  GCTAGATACACATCCCAGAATTC  1161
      |||||||||||||||||||||||
seq2  GCTAGATACACATCCCAGAATTC  1165

seq1: chr9_122150225_122150886
seq2: B6Ng01-334L24.g_74_735

seq1  GAATTCTGAGTCATATGACTGCATTACTATTCAAAGATGACACACGTGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGAGTCATATGACTGCATTACTATTCAAAGATGACACACGTGGA  50

seq1  TTAACGGAAAGCACACTCCTCCCTGGAAATGCCTCTCTAGTTTCCATATG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACGGAAAGCACACTCCTCCCTGGAAATGCCTCTCTAGTTTCCATATG  100

seq1  CTTTTGACTAACATCAAAATGAAATGGTGTCAAAAGACAGATACCAATAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTGACTAACATCAAAATGAAATGGTGTCAAAAGACAGATACCAATAA  150

seq1  AGCTTCCTACTGGTAACCACATGAAAATACAGAGGCTGGAGCTGGCTCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTCCTACTGGTAACCACATGAAAATACAGAGGCTGGAGCTGGCTCAG  200

seq1  TGGGTAAAGTATCCACTGTGCAAGTGTGGGGATGTGAGTTCAAATCCCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTAAAGTATCCACTGTGCAAGTGTGGGGATGTGAGTTCAAATCCCCA  250

seq1  CAGCACTCCTAAGGACAGATGTGGGAGCACACACGTGTAATCCCCGAATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACTCCTAAGGACAGATGTGGGAGCACACACGTGTAATCCCCGAATC  300

seq1  CTATCAGCAGAGACAGGTCAGCTAGTGATCGGATCAGCAAACCTGGGTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCAGCAGAGACAGGTCAGCTAGTGATCGGATCAGCAAACCTGGGTGG  350

seq1  GGTATACAGCAGCAAACAAGAGTGTCTCAAATGAGGTGGAAGGTGAGGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATACAGCAGCAAACAAGAGTGTCTCAAATGAGGTGGAAGGTGAGGAG  400

seq1  TGTCACTTGTGACTGTCTGACAGCCACACATGTGCTATGCCATGCATGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCACTTGTGACTGTCTGACAGCCACACATGTGCTATGCCATGCATGTG  450

seq1  CCTCACACACATGCATGTGCACTCTCACACCGATTCCCCTGGAGGAGCAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACACACATGCATGTGCACTCTCACACCGATTCCCCTGGAGGAGCAC  500

seq1  AGTTTCTCTAAAAACCTTGACTAAGATGTGTGCAATACAGGAGAGCTGAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTCTCTAAAAACCTTGACTAAGATGTGTGCAATACAGGAGAGCTGAG  550

seq1  GAGGAATGCCTAGGATCTGTCCTTCCTCTCAGGATAAAATGACCAACTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAATGCCTAGGATCTGTCCTTCCTCTCAGGATAAAATGACCAACTAA  600

seq1  CACCTCCTGTTATTCTCACTTGTGAATTTGTACACATGCTTGAGTGCTTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTCCTGTTATTCTCACTTGTGAATTTGTACACATGCTTGAGTGCTTC  650

seq1  TGTGTGTGTGTG  662
      ||||||||||||
seq2  TGTGTGTGTGTG  662

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information