MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-336J16
Chromosome	9 (Build37)	9 (Build37)
Map Location	19,632,368 - 19,633,531	3,921,136 - 3,921,925
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	Olfr829, Olfr830, Olfr831-ps1, Olfr832, GA_x5J8B7W6RL5-13870817-13871726, Olfr834, Olfr835, Olfr836, Olfr837, GA_x5J8B7W6RL5-13695863-13696754, Olfr839-ps1, GA_x5J8B7W6RL5-13645512-13646298, Olfr841-ps1, Olfr842-ps1, Olfr843, Olfr845, Olfr1522-ps1, Olfr846, LOC665697, Olfr847, GA_x5J8B7W6RL5-13451244-13452122, Olfr849, Olfr850, Olfr851, Olfr852-ps1, Olfr853, Olfr854, Olfr855, Zfp75, EG624341, LOC665751, Olfr857, Olfr858-ps1, Olfr58, Olfr859
Downstream gene	Olfr860, GA_x5J8B7W6RL5-13004417-13003354, Olfr862, Olfr77, EG665823, Olfr863-ps1, Olfr864-ps1, Olfr865-ps1, Olfr866, Olfr867, Olfr868, Olfr869, Olfr870, Olfr871, Olfr872, Olfr39, Olfr873, Olfr18, Zfp560, 4921534A09Rik, EG624824, Zfp26, Zfp426, 5730601F06Rik, 7030419G21Rik, LOC100041205, 2210010B09Rik, 5730577I03Rik, Fbxl12, Ubl5, Pin1, Olfm2, Col5a3, Rdh8
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259070 MGI:3030663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr830 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258559 MGI:3030664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr831-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404431 MGI:3030665
definition	note : olfactory receptor 831, pseudogene 1 pseudo : _no_value

name	Olfr832 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258075 MGI:3030666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13870817-13871726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257755
definition	note : olfactory receptor GA_x5J8B7W6RL5-13870817-13871726 pseudo : _no_value

name	Olfr834 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258074 MGI:3030668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr835 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257872 MGI:3030669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr836 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258557 MGI:3030670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr837 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258558 MGI:3030671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13695863-13696754 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257756
definition	note : olfactory receptor GA_x5J8B7W6RL5-13695863-13696754 pseudo : _no_value

name	Olfr839-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258184 MGI:3030673
definition	gene_synonym : MOR152-4P note : olfactory receptor 839, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W6RL5-13645512-13646298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257757
definition	note : olfactory receptor GA_x5J8B7W6RL5-13645512-13646298 pseudo : _no_value

name	Olfr841-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258072 MGI:3030675
definition	gene_synonym : MOR266-7P note : olfactory receptor 841, pseudogene 1 pseudo : _no_value

name	Olfr842-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258073 MGI:3030676
definition	gene_synonym : MOR154-2P; MOR154-3_p note : olfactory receptor 842, pseudogene 1 pseudo : _no_value

name	Olfr843 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258560 MGI:3030677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr845 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258249 MGI:3030679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1522-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258176 MGI:3031356
definition	gene_synonym : MOR150-1P note : olfactory receptor 1522, pseudogene 1 pseudo : _no_value

name	Olfr846 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258279 MGI:3030680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Olfr847 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258518 MGI:3030681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13451244-13452122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257758
definition	note : olfactory receptor GA_x5J8B7W6RL5-13451244-13452122 pseudo : _no_value

name	Olfr849 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258520 MGI:3030683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr850 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258516 MGI:3030684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr851 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258907 MGI:3030685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr852-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404436 MGI:3030686
definition	note : olfactory receptor 852, pseudogene 1 pseudo : _no_value

name	Olfr853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258908 MGI:3030687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr854 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258515 MGI:3030688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258517 MGI:3030689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp75 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244713 MGI:107775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624341 MGI:3645477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2105 Proteins

name	LOC665751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Olfr857 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257963 MGI:3030691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr858-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258058 MGI:3030692
definition	gene_synonym : MOR146-6P note : olfactory receptor 858, pseudogene 1 pseudo : _no_value

name	Olfr58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18358 MGI:1333790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258519 MGI:3030693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258521 MGI:3030694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13004417-13003354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257718
definition	note : olfactory receptor GA_x5J8B7W6RL5-13004417-13003354 pseudo : _no_value

name	Olfr862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258555 MGI:3030696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr77 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258336 MGI:2153206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665823 MGI:3643360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 689 ESTs, 16 Proteins

name	Olfr863-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258070 MGI:3030697
definition	gene_synonym : MOR146-5P note : olfactory receptor 863, pseudogene 1 pseudo : _no_value

name	Olfr864-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258071 MGI:3030698
definition	gene_synonym : MOR146-4 note : olfactory receptor 864, pseudogene 1 pseudo : _no_value

name	Olfr865-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404438 MGI:3030699
definition	note : olfactory receptor 865, pseudogene 1 pseudo : _no_value

name	Olfr866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258551 MGI:3030700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257898 MGI:3030701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258552 MGI:3030702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr869 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258550 MGI:3030703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr870 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57251 MGI:3030704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258905 MGI:3030705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr872 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258553 MGI:3030706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258822 MGI:1313142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr873 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258554 MGI:3030707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18315 MGI:109317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434377 MGI:1915280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921534A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320674 MGI:2444504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG624824 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624824 MGI:3647240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22688 MGI:99173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235028 MGI:1920248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730601F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77519 MGI:1924769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 118 ESTs, 2 Proteins

name	7030419G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434378 MGI:3045384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC100041205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 227 ESTs, 2 Proteins pseudo : _no_value

name	2210010B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244721 MGI:1924012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730577I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66662 MGI:1913912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30843 MGI:1354738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ubl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66177 MGI:1913427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23988 MGI:1346036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244723 MGI:3045350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col5a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53867 MGI:1858212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235033 MGI:2685028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128822 GeneID:259070 MGI:3030663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 829 transcript_id : NM_147067.1

name	Olfr830 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129510 GeneID:258559 MGI:3030664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 830 transcript_id : NM_146566.1

name	Olfr832 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801411 GeneID:258075 MGI:3030666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 832 transcript_id : NM_001011824.1

name	Olfr834 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801409 GeneID:258074 MGI:3030668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 834 transcript_id : NM_001011823.1

name	Olfr835 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676582 GeneID:257872 MGI:3030669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 835 transcript_id : NM_001012266.1

name	Olfr836 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129514 GeneID:258557 MGI:3030670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 836 transcript_id : NM_146564.1

name	Olfr837 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129516 GeneID:258558 MGI:3030671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 837 transcript_id : NM_146565.1

name	Olfr843 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129512 GeneID:258560 MGI:3030677
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 843 transcript_id : NM_146567.1

name	Olfr845 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369496 GeneID:258249 MGI:3030679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 845 transcript_id : NM_207145.1

name	Olfr846 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129722 GeneID:258279 MGI:3030680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 846 transcript_id : NM_146282.1

name	Olfr847 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239265 GeneID:258518 MGI:3030681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 847 transcript_id : NM_146525.1

name	Olfr849 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239267 GeneID:258520 MGI:3030683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 849 transcript_id : NM_146527.1

name	Olfr850 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239273 GeneID:258516 MGI:3030684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 850 transcript_id : NM_146523.1

name	Olfr851 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112982692 GeneID:258907 MGI:3030685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 851 transcript_id : NM_146905.2

name	Olfr853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129072 GeneID:258908 MGI:3030687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 853 transcript_id : NM_146906.1

name	Olfr854 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239275 GeneID:258515 MGI:3030688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 854 transcript_id : NM_146522.1

name	Olfr855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239269 GeneID:258517 MGI:3030689
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 855 transcript_id : NM_146524.1

name	Zfp75 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254382 GeneID:244713 MGI:107775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 75 transcript_id : NM_172918.3

name	EG624341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259839 GeneID:624341 MGI:3645477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2105 Proteins product : predicted gene, EG624341 transcript_id : XM_888877.3

name	Olfr857 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676578 GeneID:257963 MGI:3030691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 857 transcript_id : NM_001012265.1

name	Olfr58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520615 GeneID:18358 MGI:1333790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 58 transcript_id : NM_011001.2

name	Olfr859 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953179 GeneID:258519 MGI:3030693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 859 transcript_id : NM_146526.2

name	Olfr860 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239277 GeneID:258521 MGI:3030694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 860 transcript_id : NM_146528.1

name	Olfr862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129520 GeneID:258555 MGI:3030696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 862 transcript_id : NM_146562.1

name	Olfr77 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328370 GeneID:258336 MGI:2153206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 77 transcript_id : NM_146339.2

name	EG665823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259848 GeneID:665823 MGI:3643360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 689 ESTs, 16 Proteins product : predicted gene, EG665823 transcript_id : XM_979710.2

name	Olfr866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129524 GeneID:258551 MGI:3030700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 866 transcript_id : NM_146558.1

name	Olfr867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801283 GeneID:257898 MGI:3030701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 867 transcript_id : NM_001011748.1

name	Olfr868 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129518 GeneID:258552 MGI:3030702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 868 transcript_id : NM_146559.1

name	Olfr869 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170039 GeneID:258550 MGI:3030703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 869 transcript_id : NM_146557.1

name	Olfr870 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380660 GeneID:57251 MGI:3030704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 870 transcript_id : NM_146904.1

name	Olfr871 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129076 GeneID:258905 MGI:3030705
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 871 transcript_id : NM_146903.1

name	Olfr872 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170047 GeneID:258553 MGI:3030706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 872 transcript_id : NM_146560.1

name	Olfr39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129206 GeneID:258822 MGI:1313142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 39 transcript_id : NM_146825.1

name	Olfr873 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170043 GeneID:258554 MGI:3030707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 873 transcript_id : NM_146561.1

name	Olfr18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032326 GeneID:18315 MGI:109317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 18 transcript_id : NM_146563.1

name	Zfp560 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131087 GeneID:434377 MGI:1915280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 560 transcript_id : NM_001004190.3

name	4921534A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259843 GeneID:320674 MGI:2444504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4921534A09 gene transcript_id : XM_001474893.1

name	Zfp26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801412 GeneID:22688 MGI:99173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 26 transcript_id : NM_011753.2

name	Zfp426 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803273 GeneID:235028 MGI:1920248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 426 transcript_id : NM_146221.3

name	5730601F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259854 GeneID:77519 MGI:1924769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 118 ESTs, 2 Proteins product : RIKEN cDNA 5730601F06 gene transcript_id : XM_001475072.1

name	7030419G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259859 GeneID:434378 MGI:3045384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 7030419G21 gene transcript_id : XM_001475117.1

name	2210010B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938302 GeneID:244721 MGI:1924012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010B09 gene transcript_id : NM_172919.2

name	5730577I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378287 GeneID:66662 MGI:1913912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730577I03 gene transcript_id : NM_175110.4

name	Fbxl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57164956 GeneID:30843 MGI:1354738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 12 transcript_id : NM_001002846.1

name	Fbxl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57164954 GeneID:30843 MGI:1354738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 12 transcript_id : NM_013911.2

name	Ubl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801752 GeneID:66177 MGI:1913427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 5 transcript_id : NM_025401.3

name	Pin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543480 GeneID:23988 MGI:1346036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 transcript_id : NM_023371.2

name	Olfm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343362 GeneID:244723 MGI:3045350
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin 2 transcript_id : NM_173777.2

name	Col5a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130822 GeneID:53867 MGI:1858212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type V, alpha 3 transcript_id : NM_016919.2

name	Rdh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71892411 GeneID:235033 MGI:2685028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 8 transcript_id : NM_001030290.1

name	Olfr829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128823 CCDS:CCDS22847.1 GeneID:259070 MGI:3030663
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12599710-12600648; olfactory receptor MOR147-1 product : olfactory receptor 829 protein_id : NP_667278.1

name	Olfr830 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129511 CCDS:CCDS22848.1 GeneID:258559 MGI:3030664
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12618399-12619337; olfactory receptor MOR152-1 product : olfactory receptor 830 protein_id : NP_666777.1

name	Olfr832 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801412 CCDS:CCDS22849.1 GeneID:258075 MGI:3030666
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12687800-12688738; olfactory receptor MOR153-1 product : olfactory receptor 832 protein_id : NP_001011824.1

name	Olfr834 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801410 CCDS:CCDS22850.1 GeneID:258074 MGI:3030668
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12724921-12725859; olfactory receptor MOR153-2 product : olfactory receptor 834 protein_id : NP_001011823.1

name	Olfr835 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676583 CCDS:CCDS22851.1 GeneID:257872 MGI:3030669
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12771995-12772930; GA_x5J8B7TUND4-2-664; GA_x5J8B7TUND5-1082-669; olfactory receptor MOR150-3 product : olfactory receptor 835 protein_id : NP_001012266.1

name	Olfr836 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129515 CCDS:CCDS22852.1 GeneID:258557 MGI:3030670
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12857805-12858749; olfactory receptor MOR152-3 product : olfactory receptor 836 protein_id : NP_666775.1

name	Olfr837 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129517 GeneID:258558 MGI:3030671
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12873838-12874776; olfactory receptor MOR152-2 product : olfactory receptor 837 protein_id : NP_666776.1

name	Olfr843 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129513 CCDS:CCDS22853.1 GeneID:258560 MGI:3030677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-12986331-12985390; olfactory receptor MOR155-2 product : olfactory receptor 843 protein_id : NP_666778.1

name	Olfr845 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369497 CCDS:CCDS22854.1 GeneID:258249 MGI:3030679
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13076685-13077623; olfactory receptor MOR150-2 product : olfactory receptor 845 protein_id : NP_997028.1

name	Olfr846 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129723 CCDS:CCDS22855.1 GeneID:258279 MGI:3030680
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13098546-13097608; olfactory receptor MOR149-3 product : olfactory receptor 846 protein_id : NP_666394.1

name	Olfr847 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239266 CCDS:CCDS22856.1 GeneID:258518 MGI:3030681
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13113073-13112135; olfactory receptor MOR149-2 product : olfactory receptor 847 protein_id : NP_666736.1

name	Olfr849 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239268 CCDS:CCDS22857.1 GeneID:258520 MGI:3030683
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13176842-13177780; olfactory receptor MOR151-1 product : olfactory receptor 849 protein_id : NP_666738.1

name	Olfr850 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239274 CCDS:CCDS22858.1 GeneID:258516 MGI:3030684
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13214162-13213224; olfactory receptor MOR147-2 product : olfactory receptor 850 protein_id : NP_666734.1

name	Olfr851 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112982693 CCDS:CCDS22859.1 GeneID:258907 MGI:3030685
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13234278-13235216; olfactory receptor MOR155-1 product : olfactory receptor 851 protein_id : NP_667116.2

name	Olfr853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129073 CCDS:CCDS22860.1 GeneID:258908 MGI:3030687
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13277703-13276786; olfactory receptor MOR154-1 product : olfactory receptor 853 protein_id : NP_667117.1

name	Olfr854 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239276 CCDS:CCDS22861.1 GeneID:258515 MGI:3030688
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13313295-13312357; olfactory receptor MOR147-3 product : olfactory receptor 854 protein_id : NP_666733.1

name	Olfr855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239270 GeneID:258517 MGI:3030689
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-13330461-13331399; olfactory receptor MOR148-1 product : olfactory receptor 855 protein_id : NP_666735.1

name	Zfp75 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254383 CCDS:CCDS22862.1 GeneID:244713 MGI:107775
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 75 protein_id : NP_766506.3

name	EG624341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259840 GeneID:624341 MGI:3645477
definition	codon_start : 1 product : similar to olfactory receptor Olr1158 protein_id : XP_893970.3

name	Olfr857 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676579 GeneID:257963 MGI:3030691
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13452606-13453535; GA_x5J8B7W6RL5-13162713-13162216; olfactory receptor MOR146-8P product : olfactory receptor 857 protein_id : NP_001012265.1

name	Olfr58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828657 CCDS:CCDS22863.1 GeneID:18358 MGI:1333790
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR146-7P; GA_x6K02T2PVTD-13523015-13523944 product : olfactory receptor 58 protein_id : NP_035131.1

name	Olfr859 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953180 CCDS:CCDS22864.1 GeneID:258519 MGI:3030693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13548326-13549255; MOR146-10_p; olfactory receptor MOR146-3 product : olfactory receptor 859 protein_id : NP_666737.2

name	Olfr860 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239278 CCDS:CCDS22865.1 GeneID:258521 MGI:3030694
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13586614-13585661; olfactory receptor MOR146-2 product : olfactory receptor 860 protein_id : NP_666739.1

name	Olfr862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129521 CCDS:CCDS22866.1 GeneID:258555 MGI:3030696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13624132-13623212; olfactory receptor MOR146-1 product : olfactory receptor 862 protein_id : NP_666773.1

name	Olfr77 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129623 CCDS:CCDS22867.1 GeneID:258336 MGI:2153206
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR143-1; GA_x6K02T2PVTD-13660026-13660964 product : olfactory receptor 77 protein_id : NP_666451.1

name	EG665823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386017 GeneID:665823 MGI:3643360
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_984804.1

name	Olfr866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129525 CCDS:CCDS22868.1 GeneID:258551 MGI:3030700
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13768406-13767468; olfactory receptor MOR145-5 product : olfactory receptor 866 protein_id : NP_666769.1

name	Olfr867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801284 CCDS:CCDS22869.1 GeneID:257898 MGI:3030701
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13795933-13794938; olfactory receptor MOR143-2 product : olfactory receptor 867 protein_id : NP_001011748.1

name	Olfr868 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129519 CCDS:CCDS22870.1 GeneID:258552 MGI:3030702
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13841888-13842802; olfactory receptor MOR145-4 product : olfactory receptor 868 protein_id : NP_666770.1

name	Olfr869 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170040 CCDS:CCDS22871.1 GeneID:258550 MGI:3030703
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13878275-13879204; olfactory receptor MOR145-6 product : olfactory receptor 869 protein_id : NP_666768.1

name	Olfr870 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380661 CCDS:CCDS22872.1 GeneID:57251 MGI:3030704
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR141-1; GA_x6K02T2PVTD-13912679-13911744; olfactory receptor 72 product : olfactory receptor 870 protein_id : NP_667115.1

name	Olfr871 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129077 CCDS:CCDS22873.1 GeneID:258905 MGI:3030705
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-13952555-13953490; olfactory receptor MOR141-2 product : olfactory receptor 871 protein_id : NP_667114.1

name	Olfr872 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170048 CCDS:CCDS22874.1 GeneID:258553 MGI:3030706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13999915-14000844; olfactory receptor MOR145-3 product : olfactory receptor 872 protein_id : NP_666771.1

name	Olfr39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129207 CCDS:CCDS22875.1 GeneID:258822 MGI:1313142
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14025733-14026668 product : olfactory receptor 39 protein_id : NP_667036.1

name	Olfr873 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170044 CCDS:CCDS22876.1 GeneID:258554 MGI:3030707
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14040245-14041204; olfactory receptor MOR145-2 product : olfactory receptor 873 protein_id : NP_666772.1

name	Olfr18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032327 GeneID:18315 MGI:109317
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14054886-14053957 product : olfactory receptor 18 protein_id : NP_666774.1

name	Zfp560 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677614 CCDS:CCDS22877.1 GeneID:434377 MGI:1915280
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 560 protein_id : NP_001004190.2

name	4921534A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259844 GeneID:320674 MGI:2444504
definition	codon_start : 1 product : hypothetical protein LOC320674 protein_id : XP_001474943.1

name	Zfp26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249206 GeneID:22688 MGI:99173
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 81, related sequence 1 product : zinc finger protein 26 protein_id : NP_035883.1

name	Zfp426 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122781 GeneID:235028 MGI:1920248
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 68, related sequence 1 product : zinc finger protein 426 protein_id : NP_666333.1

name	5730601F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259855 GeneID:77519 MGI:1924769
definition	codon_start : 1 product : hypothetical protein LOC77519 protein_id : XP_001475122.1

name	7030419G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259860 GeneID:434378 MGI:3045384
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475167.1

name	2210010B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938303 CCDS:CCDS22878.1 GeneID:244721 MGI:1924012
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger product : hypothetical protein LOC244721 protein_id : NP_766507.2

name	5730577I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424713 GeneID:66662 MGI:1913912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66662 protein_id : NP_780319.1

name	Fbxl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57164955 CCDS:CCDS22880.1 GeneID:30843 MGI:1354738
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IPI] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1; F-box protein containing leucine repeats 12 product : F-box and leucine-rich repeat protein 12 isoform a protein_id : NP_038939.2

name	Fbxl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57164957 CCDS:CCDS22881.1 GeneID:30843 MGI:1354738
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IPI] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2; F-box protein containing leucine repeats 12 product : F-box and leucine-rich repeat protein 12 isoform b protein_id : NP_001002846.1

name	Ubl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384784 GeneID:66177 MGI:1913427
definition	GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-like 5 protein_id : NP_079677.1

name	Pin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963653 CCDS:CCDS22882.1 GeneID:23988 MGI:1346036
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP] codon_start : 1 product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 protein_id : NP_075860.1

name	Olfm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424647 GeneID:244723 MGI:3045350
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : olfactomedin 2 protein_id : NP_776138.1

name	Col5a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393173 CCDS:CCDS22883.1 GeneID:53867 MGI:1858212
definition	GO_component : GO:0005588 - collagen type V [Evidence IDA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence ISS] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence ISS]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : Pro-alpha3(V) product : procollagen, type V, alpha 3 protein_id : NP_058615.1

name	Rdh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892412 CCDS:CCDS22884.1 GeneID:235033 MGI:2685028
definition	GO_function : GO:0004745 - retinol dehydrogenase activity [Evidence IDA] GO_process : GO:0042572 - retinol metabolism [Evidence IDA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 product : retinol dehydrogenase 8 protein_id : NP_001025461.1

name	LOC665697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665697
definition	number : 1 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 6 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 5 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 4 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 3 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 2 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 1 pseudo : _no_value

name	LOC665751 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259841 GeneID:665751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP2 isoform alpha pseudo : _no_value transcript_id : XR_031834.1

name	LOC100041205 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259858 GeneID:100041205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 227 ESTs, 2 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_032078.1

clone name	MSMg01-357L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154E02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-067F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-486D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-057K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-336J16.b	B6Ng01-336J16.g
ACC	GA121477	GA121478
length	1,151	1,097
definition	B6Ng01-336J16.b	B6Ng01-336J16.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(19,632,368 - 19,633,531)	(3,921,136 - 3,921,925)
sequence	gaattcatgtagagaagaattggaacatgtaataatttaccctgctttga atctttttaaattccactatgctgccgtctaacttctgtcaccaacatat tccttcactaatgtcaaagacagatgatattctttcctcagatgcaaatg atgctgggccattatgcttcctattcaagcataagtcttatctcttctaa tatattttatctctatctttctttttgtctccttgtcactttcaccatcc tcatcagcatctcatgcagaagaggtggatttcaaatgagatattttgcc ttcagctattggctagtgggattacatttttaagtgaatttagagagctt tatgttgaatatatcatttttttatggaaatgacattagtgtctacaatg taataatagaaacttaatggaaattaccttttgttacatagctcagtttt tatttttgaactgtcctgaattaaaattcaatatgtgaagagccaacaca tcgagttttaatttactgacatgaagaataatcatacacccatttattta gacaggtaaaatgacaattccatgtatgcaggcaattctaggataatatt tagccagagaccaaatggcaggaatatacatacatacatacatacataca tacatacatacatacatgcatgcatacatacatacatacatctcagtaaa ttaaggtcaaaattgagccattttataggattatgcaaaaggagtatgtg atgctgaacagtcatttgttctgagaactgggatcaaatactatatggca aaaagaaactacagtctgcctcaacagataacgatatttattagtacatg caatgagagaaaacctctctcccaggggaaattaagaagcctccaaggta ggtctagctcacatactctgtaagggtagaagaggtgcttgggaaagagg aatttgagtcaattgtggagcctctgtgaggatctatgatctcttttcca ggaaatatttgcttcatgggaaagcagattatatggactagtgcctctat agcatttgactgtgagtgtgctgactgaaaggtggtcaggtcagctgtat actatagggtttcctgttaacactgagacacacctatccatgcagcctgg g	gaattcactgttcttaccatgttccccatcatgaagcagctggtctgata gaaaggtggaatggctttttgaaggcacagctacagtaccaattaggtgg caacagtatggagggctggggtaagaaaaagttcttcagaaggcagtata tgctttgaatcagcatttgatatatggtacagtttccccatagacaggat ccatggatccatgaattaaggggtgtaaaagggaatagttccactcacta tcactcctattaccctctaggaaaactttgcttcctgtccccataactct aggttctgttggccaaaagttttggttccagagcggggagtgctcctacc aggagccataacaaacattccattgaactggaagctcagacttccccctg gtcattttgggcttctcatccccttaaaccaacagactaaggaataacag tgttaggaagggtgatagatccagattaccatggggaaattggattacct atccacaattgaggtaaacaagattatgtctggaatgcaggagatccctt cgggcatctcttagtactaccatgtcctgtgattaaagtcaatgggaaac tacaccagcctaatccaagcaggatgacaaaggacacagacccatcagga atgaaggtgtgggtcaatcctccaggaaaagagccaagatctgctgaggt gcttgccaaggatgaaggaaatacagaatgggtagtagaggaaggtagtt ataaataccaactaaggccacataaccagttgcagaaacaaggattataa agtaatatgaatgcttctgtcttattttgctaacgaatacattcatcttt cttccaatttctttaacatcaatttgtatttgagacactaaaaggatgtt cccaaggaacaatgccccattgtaaatttacaaatgtgtttgcaattgta cgaggaatagtatatcatgataggcatattcatgaccttgttattgtttc atgtgaacatgagatattatttgtgtcaagtgacaggggtggatgttagt gctatctggtgtcaacttgactgtatcttggatgaacttacagtcca
quality values	Open. Hide. 62 47 27 24 62 37 26 47 47 62 62 62 62 62 62 62 62 62 29 36 59 62 43 62 62 59 59 59 62 59 51 38 56 59 34 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 42 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 62 54 49 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 52 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 54 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 58 58 32 50 58 52 58 58 58 58 58 58 58 45 38 58 58 46 42 41 43 47 50 58 58 58 58 52 51 41 58 58 51 51 51 51 58 58 53 58 49 58 50 58 54 58 50 58 51 58 52 58 54 58 34 58 58 58 35 58 54 58 50 58 51 58 50 58 51 58 50 58 51 58 50 58 58 51 50 51 58 54 50 51 53 58 39 58 50 58 40 58 51 58 52 54 50 54 40 58 54 58 53 54 40 40 51 58 43 41 52 42 51 41 49 25 50 38 54 54 40 44 54 50 54 36 44 44 37 53 54 54 38 52 52 39 39 54 32 28 53 49 35 49 49 37 54 54 52 28 54 51 34 45 40 33 54 45 53 37 28 51 37 51 40 45 39 40 40 40 40 43 32 38 54 47 53 44 30 40 41 34 47 32 54 42 36 37 42 54 47 29 29 40 31 49 47 45 31 39 34 42 34 45 37 51 47 28 53 53 53 53 46 32 53 53 34 32 32 34 45 24 47 34 52 40 43 26 32 31 36 34 35 32 30 30 33 21 40 29 27 31 34 29 31 30 51 34 30 22 30 31 26 30 28 37 24 31 45 30 30 32 31 42 42 29 42 25 38 41 46 31 18 31 41 31 33 27 31 34 46 26 24 20 46 46 30 33 48 31 22 32 22 32 22 31 31 26 31 39 31 31 28 19 11 24 26 23 38 30 32 31 36 38 34 38 36 32 33 29 25 18 31 26 36 32 38 31 39 31 30 12 27 46 19 24 31 20 32 30 13 36 17 21 20 31 21 29 26 31 41 26 33 48 38 20 31 24 22 20 24 21 47 31 24 38 24 32 33 21 17 14 16 32 18 22 17 22 13 24 16 21 32 27 28 21 23 29 25 17 20 21 32 23 21 32 32 26 32 27 32 33 34 43 32 19 14 16 21 19 14 26 43 8 11 21 27 48 23 20 23 27 25 14 17 15 9 37 6 24 29 17 11 18 27 12 28 20 19 10 4 4 17 3 3 6 4 3 3 6 3 6 17 9 21 27 20 19 6 13 6 27 24 28 47 14 18 14 16 16 14 7 17 15 6 20 19 12 14 5 18 24 27 12 20 9 17 29 24 8 17 10 5 15 6 21 15 11 16 6 18 21 6 21 6 8 5 23 6 6 14 6 4 6 13 10 23 6 13 28 13 6 9 5 7 5 8 9 4 6 12 13 16 14 15 8 17 6 9 7 5 7 8 4 6 4 8 5 17 4 5 8 3 3 11 11 5 5 25 28	Open. Hide. 62 59 59 44 62 59 56 59 59 62 43 38 49 59 59 59 62 59 49 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 47 42 62 54 62 62 62 62 58 54 58 58 54 58 58 58 58 58 58 54 46 58 58 54 58 58 58 58 58 38 58 58 54 58 54 54 45 46 58 47 42 42 58 47 41 58 58 54 54 58 58 58 52 58 58 58 54 58 47 58 35 54 58 58 54 54 58 53 54 58 58 58 58 58 58 58 54 58 45 37 51 49 58 58 58 50 51 50 58 58 58 58 47 58 58 58 54 53 51 58 50 58 58 51 53 58 58 44 48 49 52 51 45 35 58 49 58 52 51 58 39 32 58 58 40 50 58 51 39 58 39 37 53 53 53 50 51 42 39 44 40 58 53 52 50 58 58 52 41 58 49 58 27 49 40 58 51 58 58 54 50 50 49 51 41 42 58 53 52 53 37 32 58 58 58 58 53 40 58 32 46 37 23 51 52 47 37 52 51 51 41 49 47 39 18 47 38 49 26 54 49 53 32 42 34 41 52 54 33 34 49 46 47 36 42 45 54 32 32 40 49 34 32 54 47 38 53 54 38 37 45 32 42 53 33 46 15 44 47 42 19 54 23 43 34 32 51 25 30 23 54 39 53 31 42 27 18 47 52 45 42 51 33 53 17 40 33 41 31 53 36 52 33 32 32 45 32 41 25 27 31 25 53 52 31 34 25 45 35 37 33 30 45 35 33 32 52 53 32 31 32 33 35 32 42 42 45 43 31 31 28 28 43 39 32 51 29 31 30 32 27 24 51 46 34 33 28 30 30 31 31 26 46 32 31 25 31 26 22 30 32 26 31 30 26 47 25 31 31 32 23 42 19 31 32 46 24 17 27 46 10 11 31 31 31 35 29 30 21 32 48 31 27 26 34 31 46 29 22 43 25 26 12 17 27 30 36 48 44 31 28 21 31 19 31 22 21 31 44 24 31 15 33 25 31 24 23 18 25 30 28 15 38 31 31 22 19 37 30 29 32 47 31 38 44 24 14 17 7 44 32 32 36 25 37 31 44 29 26 25 12 14 26 30 30 21 27 29 11 38 11 26 33 16 18 32 11 16 5 17 21 32 23 21 21 30 32 32 21 25 19 22 23 22 22 24 34 33 21 27 29 32 22 13 11 11 32 12 22 10 22 16 20 11 48 23 21 16 10 11 15 14 32 21 21 12 21 16 23 10 33 22 19 34 7 18 20 32 17 16 10 15 10 19 17 15 6 3 7 20 9 28 8 34 31 30 15 16 14 15 11 6 5 6 15 9 9 27 13 12 6 19 24 28 6 3 3 3 7 28 17 13 20 8 15 19 22 17 6 8 3 3 3 3 5 10 16 10 3 4 9 14 17 19 13 7 10 13 5 18 5 18 15 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_19632368_19633531
seq2: B6Ng01-336J16.b_42_1192

seq1  GAATTCATGTAGAGAAGAATTGGAACATGTAATAATTTACCCTGCTTTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGTAGAGAAGAATTGGAACATGTAATAATTTACCCTGCTTTGA  50

seq1  ATCTTTTTAAATTCCACTATGCTGCCGTCTAACTTCTGTCACCAACATAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTTTAAATTCCACTATGCTGCCGTCTAACTTCTGTCACCAACATAT  100

seq1  TCCTTCACTAATGTCAAAGACAGATGATATTCTTTCCTCAGATGCAAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCACTAATGTCAAAGACAGATGATATTCTTTCCTCAGATGCAAATG  150

seq1  ATGCTGGGCCATTATGCTTCCTATTCAAGCATAAGTCTTATCTCTTCTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTGGGCCATTATGCTTCCTATTCAAGCATAAGTCTTATCTCTTCTAA  200

seq1  TATATTTTATCTCTATCTTTCTTTTTGTCTCCTTGTCACTTTCACCATCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATTTTATCTCTATCTTTCTTTTTGTCTCCTTGTCACTTTCACCATCC  250

seq1  TCATCAGCATCTCATGCAGAAGAGGTGGATTTCAAATGAGATATTTTGCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCAGCATCTCATGCAGAAGAGGTGGATTTCAAATGAGATATTTTGCC  300

seq1  TTCAGCTATTGGCTAGTGGGATTACATTTTTAAGTGAATTTAGAGAGCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCTATTGGCTAGTGGGATTACATTTTTAAGTGAATTTAGAGAGCTT  350

seq1  TATGTTGAATATATCATTTTTTTATGGAAATGACATTAGTGTCTACAATG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTTGAATATATCATTTTTTTATGGAAATGACATTAGTGTCTACAATG  400

seq1  TAATAATAGAAACTTAATGGAAATTACCTTTTGTTACATAGCTCAGTTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAATAGAAACTTAATGGAAATTACCTTTTGTTACATAGCTCAGTTTT  450

seq1  TATTTTTGAACTGTCCTGAATTAAAATTCAATATGTGAAGAGCCAACACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTTGAACTGTCCTGAATTAAAATTCAATATGTGAAGAGCCAACACA  500

seq1  TCGAGTTTTAATTTACTGACATGAAGAATAATCATACACCCATTTATTTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAGTTTTAATTTACTGACATGAAGAATAATCATACACCCATTTATTTA  550

seq1  GACAGGTAAAATGACAATTCCATGTATGCAGGCAATTCTAGGATAATATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGTAAAATGACAATTCCATGTATGCAGGCAATTCTAGGATAATATT  600

seq1  TAGCCAGAGACCAAATGGCAGGAATATACATACATACATACATACATACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCAGAGACCAAATGGCAGGAATATACATACATACATACATACATACA  650

seq1  TACATACATACATACATGCATGCATACATACATACATACATCTCAGTAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATACATACATACATGCATGCATACATACATACATACATCTCAGTAAA  700

seq1  TTAAGGTCAAAATTGAGCCATTTTATAGGATTATGCAAAAGGAGTATGTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGGTCAAAATTGAGCCATTTTATAGGATTATGCAAAAGGAGTATGTG  750

seq1  ATGCTGAACAGTCATTTGTTCTGAGAACTGGGATCAAATACTATATGGCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTGAACAGTCATTTGTTCTGAGAACTGGGATCAAATACTATATGGCA  800

seq1  AAAAGAAACTACAGTCTGCCTCAACAGATAACGATATTTATTAGTACATG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAACTACAGTCTGCCTCAACAGATAACGATATTTATTAGTACATG  850

seq1  CAATGAGAGAAAACCTCTCTCCCAGGGGAAATTAAGAAGCCTCCAAGGTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGAGAGAAAACCTCTCTCCCAGGGGAAATTAAGAAGCCTCCAAGGTA  900

seq1  GGTCTAGCTCACATACTCTGTAAGGGTAGAAGAGGTGCTTGGGAAAGAGG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTAGCTCACATACTCTGTAAGGGTAGAAGAGGTGCTTGGGAAAGAGG  950

seq1  AATTTGAGTCAATTGTGGAGCCTCTGTGAGGATCTATGATCTCTTTTTCC  1000
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  AATTTGAGTCAATTGTGGAGCCTCTGTGAGGATCTATGATCTC-TTTTCC  999

seq1  AGGAAATATTTGCTTCAT-GGAAAGCAGATTATATTGGAACCTAGGTTGC  1049
      |||||||||||||||||| ||||||||||||||| ||||  ||||  |||
seq2  AGGAAATATTTGCTTCATGGGAAAGCAGATTATA-TGGA--CTAG--TGC  1044

seq1  CTCTATAAGCATTTGACTGTGAGTTGTGGCTGACTGAAAAGGTTGGTCCA  1099
      |||||| |||||||||||||||| ||| |||||||||||  | |||| ||
seq2  CTCTAT-AGCATTTGACTGTGAG-TGT-GCTGACTGAAA--GGTGGT-CA  1088

seq1  GGTCAGCTGTAATACTATA-GGTTTCCTGTTTAACAACTGAGACACA-CT  1147
      |||||||||| |||||||| ||||||||| ||||| ||||||||||| ||
seq2  GGTCAGCTGT-ATACTATAGGGTTTCCTG-TTAAC-ACTGAGACACACCT  1135

seq1  ATCAATGCCAGCCTGGG  1164
      ||| ||| |||||||||
seq2  ATCCATG-CAGCCTGGG  1151

seq1: chr9_3921136_3921925
seq2: B6Ng01-336J16.g_386_1162

seq1  TTTGGTTCCAGAGTGGGGAGTGCTCCTACCAGGAGCTACAATAAACATTC  50
      ||||||||||||| |||||||||||||||||||||| | || ||||||||
seq2  TTTGGTTCCAGAGCGGGGAGTGCTCCTACCAGGAGCCATAACAAACATTC  50

seq1  CATTGAACTGGAAGCTCAGACTTCCCCCTGGTCATTTTGGGCTTCTAACG  100
      |||||||||||||||||||||||||||||||||||||||||||||| |  
seq2  CATTGAACTGGAAGCTCAGACTTCCCCCTGGTCATTTTGGGCTTCTCATC  100

seq1  CCCTTAAAACAACAGGCTAAGAAAGGAATAACAGTGTTAGGAGGGGTGAT  150
      |||||||| |||||| ||    |||||||||||||||||||| |||||||
seq2  CCCTTAAACCAACAGACT----AAGGAATAACAGTGTTAGGAAGGGTGAT  146

seq1  AGATTCAGATTACCATGGGGAAATTGGATTACCTCTCCACAATGGAGGTA  200
      |||| ||||||||||||||||||||||||||||| |||||||| ||||||
seq2  AGATCCAGATTACCATGGGGAAATTGGATTACCTATCCACAATTGAGGTA  196

seq1  AGCAAGATTATGTCTGGAATGCAGGAGATCCCTTAGGGCATCTCTTAGTA  250
      | |||||||||||||||||||||||||||||||| |||||||||||||||
seq2  AACAAGATTATGTCTGGAATGCAGGAGATCCCTTCGGGCATCTCTTAGTA  246

seq1  CTACCATGTCCTGTGATTAAAGTCAA-GGGAAATTACAACAGCCTAATCC  299
      |||||||||||||||||||||||||| |||||| |||| |||||||||||
seq2  CTACCATGTCCTGTGATTAAAGTCAATGGGAAACTACACCAGCCTAATCC  296

seq1  AAGGTGGATGACAAAGGACAAAGACCCATCAGGAATGAAGGTATGGGTCA  349
      |||  ||||||||||||||| ||||||||||||||||||||| |||||||
seq2  AAGCAGGATGACAAAGGACACAGACCCATCAGGAATGAAGGTGTGGGTCA  346

seq1  ATCCTCCAGGAGAACAGCCAAGACCTGCTGAGGTGCTTGCCGAGGGTGAA  399
      ||||||||||| || |||||||| ||||||||||||||||| ||| ||||
seq2  ATCCTCCAGGAAAAGAGCCAAGATCTGCTGAGGTGCTTGCCAAGGATGAA  396

seq1  GGAAATACAGAATGGGTAGTAGAGGACGGTAGTTATAGATAACAATTAAG  449
      |||||||||||||||||||||||||| |||||||||| ||| ||| ||||
seq2  GGAAATACAGAATGGGTAGTAGAGGAAGGTAGTTATAAATACCAACTAAG  446

seq1  GCCATGTATCCAGTTGCAGAAACGAGGATTTTAAAGTAATATGAATGCTT  499
      ||||  || |||||||||||||| |||||| |||||||||||||||||||
seq2  GCCACATAACCAGTTGCAGAAACAAGGATTATAAAGTAATATGAATGCTT  496

seq1  CTGTCTTATTTTGCTAACAAATACATTTGTCTTTCTTCCAATTTCTTTAA  549
      |||||||||||||||||| ||||||||  |||||||||||||||||||||
seq2  CTGTCTTATTTTGCTAACGAATACATTCATCTTTCTTCCAATTTCTTTAA  546

seq1  CATCAATTGGTATTTAAGTTGAGGCACTAAAATGATGTTCCCAAGGGACA  599
      |||||||| ||||     ||||| |||||||| ||||||||||||| |||
seq2  CATCAATTTGTAT-----TTGAGACACTAAAAGGATGTTCCCAAGGAACA  591

seq1  TTGCCCCATTGTAAATTTCCAAATACATTTGTGATCGTACGAGGAATAGT  649
       ||||||||||||||||| |||||   ||||  || ||||||||||||| 
seq2  ATGCCCCATTGTAAATTTACAAATGTGTTTGCAATTGTACGAGGAATAG-  640

seq1  TATATCATGTTAGGCATATTCA-CACCTTGTTATTGTTTCATGTGAACAT  698
      ||||||||| ||||||||||||  ||||||||||||||||||||||||||
seq2  TATATCATGATAGGCATATTCATGACCTTGTTATTGTTTCATGTGAACAT  690

seq1  GAGATATTATTTGTGTCAAGTTGACAAGTGGTGGATTGTAGTGGCTATTC  748
      |||||||||||||||||||| |||| || |||||||  |||| |||||  
seq2  GAGATATTATTTGTGTCAAG-TGAC-AGGGGTGGATGTTAGT-GCTAT--  735

seq1  CTGGTTGTCAACTTGACTATATCTGGAATGAAC-TACAGTCCA  790
      |||| ||||||||||||| ||||| | |||||| |||||||||
seq2  CTGG-TGTCAACTTGACTGTATCTTGGATGAACTTACAGTCCA  777

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information