MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-347M20
Chromosome	9 (Build37)
Map Location	35,571,299 - 35,571,581
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Kirrel3, St3gal4, Dcps, Tirap, Foxred1, Srpr, C030004A17Rik, Rpusd4, EG434394, Cdon, Ddx25, Pus3, EG627480, LOC100042442, Svs7, Gm846
Downstream gene	D730048I06Rik, 9230110F15Rik, LOC100041605, 9230113P08Rik, EG546123, LOC100041618, LOC100042485, EG639025, LOC671003, EG434396, A630095E13Rik, Acrv1, Chek1, Stt3a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Kirrel3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67703 MGI:1914953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St3gal4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20443 MGI:1316743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69305 MGI:1916555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tirap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117149 MGI:2152213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxred1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235169 MGI:2446262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srpr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67398 MGI:1914648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030004A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109229 MGI:1924483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpusd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71989 MGI:1919239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434394 MGI:3644422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 230 ESTs, 9 Proteins

name	Cdon (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57810 MGI:1926387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30959 MGI:1353582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pus3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67049 MGI:1914299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627480 MGI:3643568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Svs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56872 MGI:1930790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm846 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330921 MGI:2685692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D730048I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68171 MGI:1915421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230110F15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77080 MGI:1924330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100041605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	9230113P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77908 MGI:1925158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	EG546123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546123 MGI:3643162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100041618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042485 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG639025 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639025 MGI:3647831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC671003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG434396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434396 MGI:3647347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630095E13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235973 MGI:3055869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acrv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11451 MGI:104590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chek1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12649 MGI:1202065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stt3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16430 MGI:105124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kirrel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892291 GeneID:67703 MGI:1914953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kin of IRRE like 3 (Drosophila) transcript_id : NM_026324.2

name	St3gal4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361976 GeneID:20443 MGI:1316743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 4 transcript_id : NM_009178.3

name	Dcps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352443 GeneID:69305 MGI:1916555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : decapping enzyme, scavenger transcript_id : NM_027030.2

name	Tirap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905130 GeneID:117149 MGI:2152213
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-interleukin 1 receptor (TIR) domain-containing adaptor protein transcript_id : NM_054096.1

name	Foxred1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986604 GeneID:235169 MGI:2446262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FAD-dependent oxidoreductase domain containing 1 transcript_id : NM_172291.1

name	Srpr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27229035 GeneID:67398 MGI:1914648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle receptor ('docking protein') transcript_id : NM_026130.1

name	C030004A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802761 GeneID:109229 MGI:1924483
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030004A17 gene transcript_id : NM_175411.3

name	C030004A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34787416 GeneID:109229 MGI:1924483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030004A17 gene transcript_id : NM_194257.1

name	Rpusd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386869 GeneID:71989 MGI:1919239
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA pseudouridylate synthase domain containing 4 transcript_id : NM_028040.2

name	EG434394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259897 GeneID:434394 MGI:3644422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 230 ESTs, 9 Proteins product : predicted gene, EG434394 transcript_id : XM_486208.4

name	Cdon (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946653 GeneID:57810 MGI:1926387
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell adhesion molecule-related/down-regulated by oncogenes transcript_id : NM_021339.1

name	Ddx25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801077 GeneID:30959 MGI:1353582
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 25 transcript_id : NM_013932.3

name	Pus3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385846 GeneID:67049 MGI:1914299
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pseudouridine synthase 3 transcript_id : NM_023292.3

name	EG627480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82929843 GeneID:627480 MGI:3643568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG627480 transcript_id : XM_892150.1

name	LOC100042442 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259899 GeneID:100042442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001478345.1

name	Svs7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922641 GeneID:56872 MGI:1930790
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 7 transcript_id : NM_020264.2

name	Gm846 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352358 GeneID:330921 MGI:2685692
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 846, (NCBI) transcript_id : NM_001033421.2

name	D730048I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301194 GeneID:68171 MGI:1915421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D730048I06 gene transcript_id : NM_026593.3

name	9230110F15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386056 GeneID:77080 MGI:1924330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9230110F15 gene transcript_id : XM_134713.4

name	LOC100041605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259867 GeneID:100041605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041605 transcript_id : XM_001476672.1

name	9230113P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259903 GeneID:77908 MGI:1925158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : RIKEN cDNA 9230113P08 gene transcript_id : XM_001478373.1

name	EG546123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386057 GeneID:546123 MGI:3643162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG546123 transcript_id : XM_620739.3

name	LOC100041618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259869 GeneID:100041618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041618 transcript_id : XM_001476695.1

name	LOC100042485 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259907 GeneID:100042485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to sc328 transcript_id : XM_001478386.1

name	EG639025 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386058 GeneID:639025 MGI:3647831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG639025 transcript_id : XM_986261.1

name	LOC671003 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259871 GeneID:671003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to secreted seminal vesicle Ly-6 protein 1 transcript_id : XM_001476733.1

name	EG434396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381555 GeneID:434396 MGI:3647347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434396 transcript_id : NM_001033783.2

name	A630095E13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485647 GeneID:235973 MGI:3055869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630095E13 gene transcript_id : NM_001033325.2

name	Acrv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326405 GeneID:11451 MGI:104590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acrosomal vesicle protein 1 transcript_id : NM_007391.2

name	Chek1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801678 GeneID:12649 MGI:1202065
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : checkpoint kinase 1 homolog (S. pombe) transcript_id : NM_007691.3

name	Stt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367166 GeneID:16430 MGI:105124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) transcript_id : NM_008408.3

name	Kirrel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29824425 GeneID:67703 MGI:1914953
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0030165 - PDZ domain binding [Evidence NAS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030097 - hemopoiesis [Evidence IDA] codon_start : 1 note : X kin of IRRE like 3 product : membrane protein mKirre protein_id : NP_080600.1

name	St3gal4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543703 CCDS:CCDS22956.1 GeneID:20443 MGI:1316743
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : sialyltransferase 4c; ST3Gal IV; sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase); sialyltransferase 4C (beta-galactoside alpha-2,3-sialytransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 4 protein_id : NP_033204.2

name	Dcps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312256 CCDS:CCDS22957.1 GeneID:69305 MGI:1916555
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA] codon_start : 1 note : mRNA decapping enzyme product : histidine triad protein member 5 protein_id : NP_081306.1

name	Tirap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905131 GeneID:117149 MGI:2152213
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007257 - activation of JNK activity [Evidence ISS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS] [Evidence IPI]; GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence ISS] [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0030099 - myeloid cell differentiation [Evidence IMP]; GO:0009617 - response to bacterium [Evidence ISS] codon_start : 1 note : Toll-like receptor 4 adaptor protein; TIR domain-containing adapter protein; MyD88-adapter-like product : Toll-interleukin 1 receptor domain-containing adaptor protein protein_id : NP_473437.1

name	Foxred1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986605 CCDS:CCDS22958.1 GeneID:235169 MGI:2446262
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : FAD-dependent oxidoreductase domain containing 1 protein_id : NP_758495.1

name	Srpr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229036 CCDS:CCDS22959.1 GeneID:67398 MGI:1914648
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005785 - signal recognition particle receptor complex [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005047 - signal recognition particle binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006614 - SRP-dependent cotranslational protein targeting to membrane [Evidence IEA] codon_start : 1 product : signal recognition particle receptor ('docking protein') protein_id : NP_080406.1

name	C030004A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425122 CCDS:CCDS22960.1 GeneID:109229 MGI:1924483
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC109229 isoform 2 protein_id : NP_780620.1

name	C030004A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34787417 CCDS:CCDS22961.1 GeneID:109229 MGI:1924483
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC109229 isoform 1 protein_id : NP_919233.1

name	Rpusd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037279 CCDS:CCDS22962.1 GeneID:71989 MGI:1919239
definition	GO_function : GO:0009982 - pseudouridine synthase activity [Evidence IEA]; GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : RNA pseudouridylate synthase domain containing 4 protein_id : NP_082316.1

name	EG434394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51827816 GeneID:434394 MGI:3644422
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486208.1

name	Cdon (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946654 CCDS:CCDS22964.1 GeneID:57810 MGI:1926387
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001708 - cell fate specification [Evidence IGI]; GO:0010172 - embryonic body morphogenesis [Evidence IGI] [Evidence IMP]; GO:0007520 - myoblast fusion [Evidence IMP]; GO:0016202 - regulation of striated muscle development [Evidence ISS]; GO:0007224 - smoothened signaling pathway [Evidence ISS] [Evidence IGI] codon_start : 1 exception : mismatches in translation note : immunoglobulin superfamily member CDO; CAM-related/down-regulated by oncogenes; oncogene-regulated cell adhesion molecule product : cell adhesion molecule-related/down-regulated by oncogenes protein_id : NP_067314.1

name	Ddx25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304995 GeneID:30959 MGI:1353582
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 25; gonadotropin-regulated testicular RNA helicase; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 25 protein_id : NP_038960.1

name	Pus3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981121 CCDS:CCDS22965.1 GeneID:67049 MGI:1914299
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0016439 - tRNA-pseudouridine synthase activity [Evidence IDA] GO_process : GO:0008033 - tRNA processing [Evidence IEA]; GO:0031119 - tRNA pseudouridine synthesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : pseudouridine synthase 3 protein_id : NP_075781.2

name	EG627480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82929844 GeneID:627480 MGI:3643568
definition	codon_start : 1 product : similar to small cell adhesion glycoprotein protein_id : XP_897243.1

name	LOC100042442 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259900 GeneID:100042442
definition	codon_start : 1 product : similar to high mobility group nucleosomal binding domain 2 protein_id : XP_001478395.1

name	Svs7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9931973 CCDS:CCDS22967.1 GeneID:56872 MGI:1930790
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : seminal vesicle protein, secretion 7; SVS VII product : caltrin protein_id : NP_064660.1

name	Gm846 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701929 GeneID:330921 MGI:2685692
definition	codon_start : 1 product : hypothetical protein LOC330921 protein_id : NP_001028593.1

name	D730048I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386080 GeneID:68171 MGI:1915421
definition	codon_start : 1 product : hypothetical protein LOC68171 protein_id : NP_080869.1

name	9230110F15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20884471 GeneID:77080 MGI:1924330
definition	codon_start : 1 product : hypothetical protein LOC77080 protein_id : XP_134713.1

name	LOC100041605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259868 GeneID:100041605
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476722.1

name	9230113P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259904 GeneID:77908 MGI:1925158
definition	codon_start : 1 product : hypothetical protein LOC77908 protein_id : XP_001478423.1

name	EG546123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63586379 GeneID:546123 MGI:3643162
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620739.1

name	LOC100041618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259870 GeneID:100041618
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476745.1

name	LOC100042485 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259908 GeneID:100042485
definition	codon_start : 1 product : similar to sc328 protein_id : XP_001478436.1

name	EG639025 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386059 GeneID:639025 MGI:3647831
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991355.1

name	LOC671003 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259872 GeneID:671003
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476783.1

name	EG434396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702097 GeneID:434396 MGI:3647347
definition	codon_start : 1 product : hypothetical protein LOC434396 protein_id : NP_001028955.1

name	A630095E13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776588 CCDS:CCDS22970.1 GeneID:235973 MGI:3055869
definition	codon_start : 1 product : secreted seminal vesicle Ly-6 protein 1 protein_id : NP_001028497.1

name	Acrv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326406 CCDS:CCDS22971.1 GeneID:11451 MGI:104590
definition	GO_component : GO:0001669 - acrosome [Evidence IDA] codon_start : 1 note : acrosomal vesicle protein 1 (MGD\|MGI:104590 GB\|NM_007391, evidence: BLASTN, 99%, match=1065); putative; acrosomal protein SP-10 product : acrosomal vesicle protein 1 protein_id : NP_031417.2

name	Chek1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542385 CCDS:CCDS22972.1 GeneID:12649 MGI:1202065
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0000077 - DNA damage checkpoint [Evidence IDA] [Evidence IMP]; GO:0006281 - DNA repair [Evidence IDA]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA] codon_start : 1 note : rad27 homolog product : checkpoint kinase 1 homolog protein_id : NP_031717.2

name	Stt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560680 GeneID:16430 MGI:105124
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA]; GO:0004576 - oligosaccharyl transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : intergral membrane protein 1 protein_id : NP_032434.2

clone name	MSMg01-423D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-126N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-186H07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-143K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-347M20.b	B6Ng01-347M20.g
ACC	GA129294	GA129295
length	1,241	283
definition	B6Ng01-347M20.b	B6Ng01-347M20.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcatctggaaaatctccagtggtagataagcacctaaagaaatg ttcaatattcttagccaccagggaaatgcaaatcgaaacaacactgagat tccaccacacaccagtcagaatagctaaaatcaaaaaactcaggcaacag cagtgctggtgaggatgtggagaaagaggagcactcctccattgctggtg agatggcaagctgttacaaccactctgtaaatcagtctggcagttcctca gaaaattggacataataatatatatatactcctgggagtatactcagaca catgatctagaatgttcatagcagcctgatttataatatcaggagttgga aacaactcagacatctctcaatagaggaatggacacagaaaaatgtggta catttacacaacggagtagtactcagctattgaaaacaatgacttcatga aattctcaggcaaatgaatggatctagagaatatcatcctgagtgaggtg acccagtcacaaaggaatacatatggtatgtacacactgataaatggata ttagagaaaaggctccattctgatacaatcaaatcatgaaaggcagaggg agggaggtacctaggagaaagaagggggggaatgaaggacaggataagat gtaggaggagatggggaaaagtaaaggatctcagaaaattgaacagaggt gtgtagcaataggggattaaggaaccaggactacccactagaaagtccca gataccaggaaagcaagaggctcccaggacccagtgaggctaacattagc cgaaatacccaataaaggggagatagagcctataaagaccatatccactg attaggcatggcaccacattgagagatggggcatccacccatcttaaaaa tagtaacatagaattcttcctgtctaaagaaaaaataacagggacaaaga gtggagcagaaaattgaaagaacgtccatttggagactgggcccacctag gaattcaaaccatctgcagaaactaaacccagacactattgctgttgcca gaagcttttgctgaataggactgaacagacctggcatgctatctctttga aagtccttatcaaactggaatagacaaatgcttatcagccaccattggaa ctgtagccagcccccctatttaggaatgatctggagtagccgtatggatt tactacctctcatagtaagacacagcccagtatacacttct	aaatccagtctcaactacatatcaagtttcagaccagtcagggctacata gtgagatgaggtgtgtgtgtatgtgtgtgtgtctctctctctgtgtgtgt gtgtgtgtgtgtgtgtttgaagagaggggggaggactcccttctaatcag cagaaatctaagaacagtgctgtctacatgtcacagataaaaagaaaaac ttacccttattttgtgaagccaatagtatttgctggactgtcccattggg tatatactatgttattgtttgtttgttagtttg
quality values	Open. Hide. 41 29 46 28 58 54 58 28 38 62 62 62 62 62 49 62 62 62 47 62 46 62 37 31 62 62 62 62 56 51 56 44 56 56 37 33 56 59 62 62 62 62 62 62 62 62 62 62 59 59 59 54 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 54 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 44 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 58 58 58 58 58 58 54 58 52 58 58 58 54 58 58 58 58 58 58 58 58 52 58 58 58 54 58 58 58 58 58 58 58 58 58 48 54 52 33 40 54 58 58 58 58 58 52 54 58 50 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 40 58 51 49 33 58 58 54 43 58 58 51 39 58 49 42 39 47 54 53 50 58 51 39 58 58 58 52 58 49 39 58 58 58 58 58 58 58 43 38 58 50 49 39 58 51 33 50 39 58 39 49 52 58 53 47 33 58 52 50 40 58 51 28 58 58 46 51 35 58 58 58 51 58 49 58 58 50 47 41 58 58 49 58 41 42 52 53 47 28 16 58 51 49 50 40 53 52 52 42 41 49 37 46 15 44 31 51 52 54 39 42 49 50 32 41 49 32 41 54 54 51 34 20 54 47 33 13 54 25 38 49 46 19 37 47 41 37 42 38 44 39 39 40 52 49 44 32 54 54 39 34 31 35 44 39 30 26 31 28 32 39 42 34 34 41 51 54 39 32 32 31 53 42 51 11 54 23 39 34 37 25 29 23 30 36 27 40 31 21 31 28 32 26 18 40 19 35 21 53 40 31 28 31 32 20 27 31 30 47 52 28 32 29 31 52 34 41 18 14 22 52 20 22 49 46 25 22 17 40 18 39 39 35 29 17 21 30 31 30 16 51 36 31 12 9 22 29 43 31 41 31 31 18 30 30 37 28 37 33 31 15 33 16 27 29 31 42 24 21 36 41 14 31 28 31 22 43 31 25 36 24 27 11 32 46 46 44 25 18 6 25 32 12 21 36 28 22 27 24 26 8 11 46 41 46 34 28 23 28 31 34 25 28 14 27 32 17 33 25 19 24 25 28 28 31 31 26 36 26 36 27 9 41 32 22 33 46 39 41 41 8 24 7 7 8 10 28 37 17 17 19 19 33 26 16 38 17 10 21 16 31 16 19 8 5 6 6 6 6 6 7 24 33 44 30 15 9 33 20 25 36 25 23 10 8 44 36 19 25 32 13 23 21 19 21 31 22 15 16 18 7 5 30 21 22 17 19 27 30 14 10 23 10 33 7 21 20 14 21 31 28 32 17 21 16 23 32 16 20 10 11 23 11 10 14 20 6 13 17 7 5 18 21 22 24 27 28 10 19 27 5 10 18 13 10 13 12 27 26 11 7 12 34 34 27 23 20 11 18 10 16 13 6 11 8 21 20 6 18 13 11 6 3 5 3 5 9 20 16 15 11 7 10 5 3 3 3 6 4 6 5 3 3 3 5 6 14 8 5 6 4 3 4 10 7 7 8 4 11 11 4 8 9 8 25 13 12 6 4 10 8 22 23 13 8 16 5 6 12 6 5 14 7 12 14 16 15 6 14 5 11 14 8 9 8 7 13 9 8 5 7 7 14 9 5 9 8 7 10 5 5 7 3 1 5 18 13 3 6 5 3 2 1 4 9 4 5 4 8 7 13 3 10 11 7 6 13 8 4 2 1 2 11 5 8 5 14 9 8 5 15 12 9 4 24 6 8 5 15 5 3 1 2 4 6 24 7 6 6 5 9 16 4 4 2 1 2 4 3 2 2 3 4 5 4 2 1	Open. Hide. 34 62 62 62 59 59 22 27 32 32 50 49 39 62 62 59 62 59 59 62 62 62 54 62 59 62 62 62 62 59 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 49 49 49 62 62 62 62 62 54 54 54 31 17 31 34 28 38 40 43 46 33 22 24 43 39 23 20 24 18 14 34 24 19 30 27 30 30 39 23 50 34 35 34 19 25 40 35 43 39 23 27 34 30 34 27 36 50 36 27 23 27 33 19 49 24 31 41 27 38 36 19 33 31 27 34 37 27 27 17 14 27 34 38 38 13 22 25 17 23 24 43 29 26 35 38 23 23 27 26 39 34 34 14 25 46 31 26 27 27 23 23 28 23 29 19 40 46 23 28 27 33 24 34 35 40 34 34 33 50 50 45 34 34 27 15 34 27 49 18 28 13 14 18 23 12 17 10 23 14 13 11 10 7 7 12 23 13 18 18 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_35571299_35571581
seq2: B6Ng01-347M20.g_70_352

seq1  AAATCCAGTCTCAACTACATATCAAGTTTCAGACCAGTCAGGGCTACATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCCAGTCTCAACTACATATCAAGTTTCAGACCAGTCAGGGCTACATA  50

seq1  GTGAGATGAGGTGTGTGTGTATGTGTGTGTGTCTCTCTCTCTGTGTGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGATGAGGTGTGTGTGTATGTGTGTGTGTCTCTCTCTCTGTGTGTGT  100

seq1  GTGTGTGTGTGTGTGTTTGAAGAGAGGGGGGAGGACTCCCTTCTAATCAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTTTGAAGAGAGGGGGGAGGACTCCCTTCTAATCAG  150

seq1  CAGAAATCTAAGAACAGTGCTGTCTACATGTCACAGATAAAAAGAAAAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAATCTAAGAACAGTGCTGTCTACATGTCACAGATAAAAAGAAAAAC  200

seq1  TTACCCTTATTTTGTGAAGCCAATAGTATTTGCTGGACTGTCCCATTGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCTTATTTTGTGAAGCCAATAGTATTTGCTGGACTGTCCCATTGGG  250

seq1  TATATACAATGTTTTTGTTTGTTTGTTTGTTTG  283
      ||||||| ||||| ||||||||||||| |||||
seq2  TATATACTATGTTATTGTTTGTTTGTTAGTTTG  283

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information