MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-048A15
Chromosome	9 (Build37)
Map Location	119,581,300 - 119,730,528
singlet/doublet	doublet
Overlap gene	Scn10a, Scn11a
Upstream gene	Itga9, LOC100039768, Ctdspl, Vill, Plcd1, Dlec1, Acaa1b, EG546165, Slc22a14, Slc22a13, 9330176C04Rik, Oxsr1, Myd88, Acaa1a, Xylb, Acvr2b, Endogl1, Scn5a
Downstream gene	LOC100039837, Wdr48, Gorasp1, Ttc21a, Axud1, Cmya1, Cx3cr1, Ccr8, Slc25a38, Rpsa, Snora62, EG546166, Mobp, LOC100039898, Myrip, LOC666044, Eif1b, LOC638068, Entpd3, Rpl14, 5830454E08Rik, LOC100040010
Link	Open Mouse BAC browser

Click to get alignment info.

name	Itga9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104099 MGI:104756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039768 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ctdspl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69274 MGI:1916524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vill (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22351 MGI:1201781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18799 MGI:97614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320256 MGI:2443671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	Acaa1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235674 MGI:3605455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546165 MGI:3648969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 410 ESTs, 25 Proteins pseudo : _no_value

name	Slc22a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382113 MGI:2685974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102570 MGI:2143107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9330176C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109280 MGI:1924762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oxsr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108737 MGI:1917378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myd88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17874 MGI:108005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acaa1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113868 MGI:2148491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xylb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102448 MGI:2142985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acvr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11481 MGI:87912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Endogl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208194 MGI:2143333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20271 MGI:98251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20264 MGI:108029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24046 MGI:1345149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Wdr48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67561 MGI:1914811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gorasp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74498 MGI:1921748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc21a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74052 MGI:1921302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Axud1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215418 MGI:2387989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmya1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22437 MGI:1333878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cx3cr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13051 MGI:1333815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12776 MGI:1201402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208638 MGI:2384782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16785 MGI:105381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104433 MGI:2148179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546166 MGI:3647932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100039898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Myrip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245049 MGI:2384407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	Eif1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68969 MGI:1916219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638068 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638068
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 9 Proteins pseudo : _no_value

name	Entpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215446 MGI:1321386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67115 MGI:1914365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830454E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76100 MGI:1923350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	LOC100040010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Itga9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526903 GeneID:104099 MGI:104756
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 9 transcript_id : NM_133721.1

name	LOC100039768 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260346 GeneID:100039768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039768 transcript_id : XM_001473463.1

name	Ctdspl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801847 GeneID:69274 MGI:1916524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like transcript_id : NM_133710.2

name	Vill (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956063 GeneID:22351 MGI:1201781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : villin-like transcript_id : NM_011700.1

name	Plcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130605 GeneID:18799 MGI:97614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 1 transcript_id : NM_019676.2

name	Dlec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386588 GeneID:320256 MGI:2443671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : deleted in lung and esophageal cancer 1, transcript variant 1 transcript_id : XM_486268.3

name	Acaa1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130202 GeneID:235674 MGI:3605455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A acyltransferase 1B transcript_id : NM_146230.3

name	Slc22a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379445 GeneID:382113 MGI:2685974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 14 transcript_id : NM_001037749.2

name	Slc22a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381622 GeneID:102570 MGI:2143107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 13 transcript_id : NM_133980.2

name	9330176C04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46810286 GeneID:109280 MGI:1924762
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9330176C04 gene transcript_id : NM_175420.1

name	Oxsr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626164 GeneID:108737 MGI:1917378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidative-stress responsive 1 transcript_id : NM_133985.1

name	Myd88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543276 GeneID:17874 MGI:108005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid differentiation primary response gene 88 transcript_id : NM_010851.2

name	Acaa1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131053 GeneID:113868 MGI:2148491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A acyltransferase 1A transcript_id : NM_130864.3

name	Xylb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131121 GeneID:102448 MGI:2142985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xylulokinase homolog (H. influenzae) transcript_id : NM_001033209.2

name	Acvr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131001 GeneID:11481 MGI:87912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activin receptor IIB transcript_id : NM_007397.2

name	Endogl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625969 GeneID:208194 MGI:2143333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endonuclease G-like 1 transcript_id : NM_172456.2

name	Scn5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130439 GeneID:20271 MGI:98251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type V, alpha transcript_id : NM_021544.3

name	Scn10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131889983 GeneID:20264 MGI:108029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type X, alpha transcript_id : NM_009134.2

name	Scn11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133987590 GeneID:24046 MGI:1345149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type XI, alpha transcript_id : NM_011887.3

name	LOC100039837 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260349 GeneID:100039837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039837 transcript_id : XM_001473638.1

name	Wdr48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365403 GeneID:67561 MGI:1914811
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 48 transcript_id : NM_026236.2

name	Gorasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130573 GeneID:74498 MGI:1921748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi reassembly stacking protein 1 transcript_id : NM_028976.2

name	Ttc21a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375896 GeneID:74052 MGI:1921302
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 21A transcript_id : NM_028735.2

name	Axud1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130102 GeneID:215418 MGI:2387989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AXIN1 up-regulated 1 transcript_id : NM_153287.3

name	Cmya1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486754 GeneID:22437 MGI:1333878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiomyopathy associated 1 transcript_id : NM_001081339.1

name	Cx3cr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299631 GeneID:13051 MGI:1333815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X3-C) receptor 1 transcript_id : NM_009987.3

name	Ccr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331154 GeneID:12776 MGI:1201402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 8 transcript_id : NM_007720.2

name	Slc25a38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450144 GeneID:208638 MGI:2384782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 38 transcript_id : NM_144793.1

name	Rpsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347305 GeneID:16785 MGI:105381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein SA transcript_id : NM_011029.3

name	EG546166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803427 GeneID:546166 MGI:3647932
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546166 transcript_id : NM_001024730.2

name	Mobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543261 GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated oligodendrocytic basic protein transcript_id : NM_008614.2

name	Mobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108860693 GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated oligodendrocytic basic protein transcript_id : NM_001039364.2

name	Mobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802901 GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated oligodendrocytic basic protein transcript_id : NM_001039365.2

name	Myrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802457 GeneID:245049 MGI:2384407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin VIIA and Rab interacting protein transcript_id : NM_144557.3

name	Eif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803572 GeneID:68969 MGI:1916219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 1B transcript_id : NM_026892.2

name	Entpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380176 GeneID:215446 MGI:1321386
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 3 transcript_id : NM_178676.3

name	Rpl14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373739 GeneID:67115 MGI:1914365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L14 transcript_id : NM_025974.2

name	5830454E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260352 GeneID:76100 MGI:1923350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : RIKEN cDNA 5830454E08 gene transcript_id : XM_001473897.1

name	LOC100040010 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260354 GeneID:100040010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040010 transcript_id : XM_001473936.1

name	Itga9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526904 CCDS:CCDS23604.1 GeneID:104099 MGI:104756
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : integrin alpha 9 protein_id : NP_598482.1

name	LOC100039768 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260347 GeneID:100039768
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473513.1

name	Ctdspl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016121 CCDS:CCDS23605.1 GeneID:69274 MGI:1916524
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like protein_id : NP_598471.2

name	Vill (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956064 CCDS:CCDS23606.1 GeneID:22351 MGI:1201781
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 exception : mismatches in translation note : villin-like protein product : villin-like protein_id : NP_035830.1

name	Plcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790167 CCDS:CCDS23607.1 GeneID:18799 MGI:97614
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0001890 - placenta development [Evidence IGI] codon_start : 1 note : phospholipase C delta-1; PLC-delta 1 product : phospholipase C, delta 1 protein_id : NP_062650.1

name	Dlec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386589 GeneID:320256 MGI:2443671
definition	codon_start : 1 product : deleted in lung and esophageal cancer 1 isoform 1 protein_id : XP_486268.2

name	Acaa1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122797 CCDS:CCDS23608.1 GeneID:235674 MGI:3605455
definition	EC_number : 2.3.1.16 GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : thiolase B product : 3-ketoacyl-CoA thiolase B protein_id : NP_666342.1

name	Slc22a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627689 CCDS:CCDS23609.1 GeneID:382113 MGI:2685974
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic cation transporter like 4 product : solute carrier family 22 (organic cation transporter), member 14 protein_id : NP_001032838.1

name	Slc22a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527200 GeneID:102570 MGI:2143107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : organic cation transporter-like 3 product : solute carrier family 22 (organic cation transporter), member 13 protein_id : NP_598741.1

name	9330176C04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810287 GeneID:109280 MGI:1924762
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC109280 protein_id : NP_780629.1

name	Oxsr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626165 GeneID:108737 MGI:1917378
definition	GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0006979 - response to oxidative stress [Evidence IDA] codon_start : 1 product : oxidative-stress responsive 1 protein_id : NP_598746.1

name	Myd88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754772 CCDS:CCDS23612.1 GeneID:17874 MGI:108005
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence TAS]; GO:0006955 - immune response [Evidence TAS]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045351 - interferon type I biosynthesis [Evidence IMP]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IMP]; GO:0009615 - response to virus [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence TAS] codon_start : 1 product : myeloid differentiation primary response gene 88 protein_id : NP_034981.1

name	Acaa1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700004 CCDS:CCDS23613.1 GeneID:113868 MGI:2148491
definition	EC_number : 2.3.1.16 GO_component : GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003985 - acetyl-CoA C-acetyltransferase activity [Evidence TAS] GO_process : GO:0006631 - fatty acid metabolism [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : 3-ketoacyl-CoA thiolase A; peroxisomal 3-oxoacyl-Coenzyme A thiolase; peroxisomal 3-ketoacyl-CoA thiolase product : acetyl-Coenzyme A acyltransferase 1 protein_id : NP_570934.1

name	Xylb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794607 CCDS:CCDS23614.1 GeneID:102448 MGI:2142985
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004856 - xylulokinase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0042732 - D-xylose metabolism [Evidence IEA] codon_start : 1 product : xylulokinase homolog (H. influenzae) protein_id : NP_001028381.1

name	Acvr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680634 CCDS:CCDS23615.1 GeneID:11481 MGI:87912
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048185 - activin binding [Evidence IPI] [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0019838 - growth factor binding [Evidence IPI] [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004712 - protein threonine/tyrosine kinase activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0050431 - transforming growth factor beta binding [Evidence IDA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI] [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0048617 - embryonic foregut morphogenesis [Evidence IMP]; GO:0048276 - gastrulation (sensu Vertebrata) [Evidence IGI]; GO:0007507 - heart development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IGI]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP] [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IEA] codon_start : 1 product : activin receptor IIB protein_id : NP_031423.1

name	Endogl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369613 CCDS:CCDS23616.1 GeneID:208194 MGI:2143333
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : endonuclease G-like 1 protein_id : NP_766044.1

name	Scn5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875498 GeneID:20271 MGI:98251
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA] codon_start : 1 note : sodium channel, voltage-gated, type V, alpha polypeptide product : voltage-gated sodium channel type V alpha protein_id : NP_067519.2

name	Scn10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131889984 GeneID:20264 MGI:108029
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sodium channel, voltage-gated, type X, alpha protein_id : NP_033160.2

name	Scn11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133987591 GeneID:24046 MGI:1345149
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium channel, voltage-gated, type XI, alpha polypeptide; voltage-gated sodium channel NAV1.9b product : sodium channel, voltage-gated, type XI, alpha protein_id : NP_036017.3

name	LOC100039837 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260350 GeneID:100039837
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473688.1

name	Wdr48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468987 CCDS:CCDS23618.1 GeneID:67561 MGI:1914811
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] codon_start : 1 product : WD repeat domain 48 protein_id : NP_080512.1

name	Gorasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30350202 CCDS:CCDS23619.1 GeneID:74498 MGI:1921748
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : Golgi reassembly stacking protein 1 protein_id : NP_083252.1

name	Ttc21a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037343 GeneID:74052 MGI:1921302
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tetratricopeptide repeat-containing hedgehog modulator 2 product : tetratricopeptide repeat domain 21A protein_id : NP_083011.1

name	Axud1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23463295 CCDS:CCDS23620.1 GeneID:215418 MGI:2387989
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA] codon_start : 1 note : TGF-beta induced apoptosis protein 3 product : AXIN1 up-regulated 1 protein_id : NP_695019.1

name	Cmya1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486755 GeneID:22437 MGI:1333878
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA] codon_start : 1 note : cardiac morphogenesis; mXin alpha product : cardiomyopathy associated 1 protein_id : NP_001074808.1

name	Cx3cr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299632 GeneID:13051 MGI:1333815
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : C-X3-C chemokine receptor 1 product : chemokine (C-X3-C) receptor 1 protein_id : NP_034117.3

name	Ccr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671774 CCDS:CCDS23621.1 GeneID:12776 MGI:1201402
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA] [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-C) receptor 8; C-C motif chemokine receptor 8 product : chemokine (C-C motif) receptor 8 protein_id : NP_031746.1

name	Slc25a38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450145 CCDS:CCDS23622.1 GeneID:208638 MGI:2384782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 38 protein_id : NP_659042.1

name	Rpsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560560 CCDS:CCDS23623.1 GeneID:16785 MGI:105381
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P40-3, functional; P40-8, functional; laminin receptor 1 (67kD, ribosomal protein SA) product : laminin receptor 1 (ribosomal protein SA) protein_id : NP_035159.2

name	EG546166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701562 GeneID:546166 MGI:3647932
definition	codon_start : 1 product : hypothetical protein LOC546166 protein_id : NP_001019901.1

name	Mobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86355497 GeneID:17433 MGI:108511
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0019911 - structural constituent of myelin sheath [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 2 product : myelin-associated oligodendrocytic basic protein isoform a protein_id : NP_001034453.1

name	Mobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678910 GeneID:17433 MGI:108511
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0019911 - structural constituent of myelin sheath [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : myelin-associated oligodendrocytic basic protein isoform a protein_id : NP_032640.1

name	Mobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86355503 CCDS:CCDS23626.1 GeneID:17433 MGI:108511
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0019911 - structural constituent of myelin sheath [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 3 product : myelin-associated oligodendrocytic basic protein isoform b protein_id : NP_001034454.1

name	Myrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362371 CCDS:CCDS23627.1 GeneID:245049 MGI:2384407
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017022 - myosin binding [Evidence ISS] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0017137 - Rab GTPase binding [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0030050 - vesicle transport along actin filament [Evidence TAS] codon_start : 1 note : exophilin 8; rab effector MYRIP product : myosin VIIA and Rab interacting protein protein_id : NP_653140.1

name	Eif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312159 CCDS:CCDS23628.1 GeneID:68969 MGI:1916219
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : translation factor sui1 homolog protein_id : NP_081168.1

name	Entpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520059 CCDS:CCDS23629.1 GeneID:215446 MGI:1321386
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0009134 - nucleoside diphosphate catabolism [Evidence IDA]; GO:0009143 - nucleoside triphosphate catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : CD39 antigen-like 3 product : ectonucleoside triphosphate diphosphohydrolase 3 protein_id : NP_848791.1

name	Rpl14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385472 GeneID:67115 MGI:1914365
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L14 protein_id : NP_080250.1

name	5830454E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260353 GeneID:76100 MGI:1923350
definition	codon_start : 1 product : hypothetical protein LOC76100 protein_id : XP_001473947.1

name	LOC100040010 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260355 GeneID:100040010
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473986.1

name	LOC100039898 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039898
definition	number : 1 pseudo : _no_value

name	LOC100039898 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039898
definition	number : 2 pseudo : _no_value

name	EG546165 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260348 GeneID:546165 MGI:3648969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 410 ESTs, 25 Proteins product : predicted gene, EG546165 pseudo : _no_value transcript_id : XR_031269.1

name	Snora62 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604693 GeneID:104433 MGI:2148179
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 62 transcript_id : NR_002902.1

name	LOC666044 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260412 GeneID:666044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to Ribosomal protein L19 pseudo : _no_value transcript_id : XR_035008.1

name	LOC638068 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260351 GeneID:638068
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 9 Proteins product : similar to Interleukin-1 receptor-associated kinase 2d pseudo : _no_value transcript_id : XR_031411.1

clone name	MSMg01-334H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185I12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-341K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-489M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-299O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-048A15.T7 (MSMg01no048_a15.b1)	MSMg01-048A15.TJ (MSMg01no048_a15.g1)
ACC	AG277907	AG277908
length	1,194	1,341
length of high quality (start - end)	499 (35 - 533)	264 (74 - 337)
definition	CHROMAT_FILE: MSMg01no048_a15.b1 PHD_FILE: MSMg01no048_a15.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 12:08:31 2005	CHROMAT_FILE: MSMg01no048_a15.g1 PHD_FILE: MSMg01no048_a15.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 12:08:31 2005
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(119,730,140 - 119,730,528)	(119,581,300 - 119,581,563)
sequence	CTATGGGCCTAXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCTTTATA TGGGATGTTATCCATTGAGATCTCTTGGGTTGATTGCTGGTGACTCTCTG ACCTCTGGAGCAGCCTGCCCCCTTCTTTCACCATTTTCATTATATCACAG TATTGGGATCAACTGCTGTGCTGGGATGGACATATGCTCCACTTTCAAAC ATCTTAATTTTATTGAAAACAACTGTTTTATATGTATCGGCATTTTGCCT ACATGTATGTCTGTACACTACATGCATGAAACGCCCAAGACCAGAAGAGG GTGTTGGAACCTTGGAGCTGGATTTATGAATCACTATCAGCCACTGTGTG GGTGCTGGGAATTGAACCCAGGTCCTCTGGAAGAACAGAGCCCTTATCAC CGTGCCATCTCTACAGCCCCATATTTTCTGCTTTCATGTGACACTCTTTC TAGGAACAGCTTTTCTCTTAAAGATGCACCTTGAGGTTTGGGCTATTTCA AATGGCATTTTGTAGTACTTTCCTTGTTACATCTCTAACAACATTTTACT ACATTCCGCCCCCACCCCTCCTCATTCCATAGCATGGTGTGTAAATTATA AGCTACTTATTGTTTTGCTTCTCTTCTTCCTCCACATGTTTCTAGGGCTT TGAACTTATATTATCATCCGTAGTGTTAATCATCTTTACCCACTGAGTCT ACTTCTCAATCCCTTTGTGTATTCTTTTGATTAAGTCTTTTCATTTATTA TTATTCTTTTTAAAATTTTTTTTTTTTTTTTTCTCCCTTATTATCATATT ATTTTTTCATATTTCTTTCTCCTTTTTTTATTTTATTTCTTCTTTCTTTT TTGTTTTTATATATACTTTTCTTCTTTCTTTTTTTTTTATTTTTTTTTTC TTATTTTTATATCTTTTTATTTTTATTTTACTTCATATTTTATCTTTTAT TATTTTTTTTCATTCTTTCCTTATAATATTTTCTTCTTTACTTATTTATT TTCTTTTTTTTCATTATTTCATCTTTATCCTTTTTTTTCTATTTTTTTTA TAATCATTCTTACTTGTCACTAATTTTTCCTTTATTTAACATTTTATTTA TCTTATTATTTATTTTTTTTTTTATTACTTATCTATTATCTCTATCTTCC TTTCTTTCTTCTTTCTTATTTATTTTATATTTTCTATTCTTCTT	TTTTTAAGAGTGTAGCTGGGGCGCCXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXCCTCTTTTAGACAAAACCCTCTTGCCAGTATCTTTA TCAGAGCCTCGAAGGTGTAAACCCCCGTGAAGGCATACCTGGGGGGAGGT CAAGAGGGGGGACATTAACTCTGGGACAGAGGGGCCTCAGGAGCGTCCTC TGCCAGCAGTGAGAATGGAATCACCGTGGCTGTTCCTAGGGGACACATAC AAAGACCACTGCCAAGGCGGTGGAGGAAAAGGATGAAGAGTCCTGCAAGT GGATAGGGTAGGTGGAGAGAGAGTGAGAGCAAGGCTGCGAGGGGTCAGTT TTTCCTTTTTTTTTTCTTTTTTTCTTTTGTCTCTNTTTTTTTTTTTTTTT TTTTTTTTTTTTTTCTCTTTTCCTCTTCTTTTTTTTTTTCATTTTTTTTT TTTTCCCCCCCTTTTTTTTTCTTCTCTTTTTCTCTTTTTTTCTCTTNTCT TTTTTCTATCTTTTTTTATTTTTTTTCTTTCCTTTCCTTTCTTTTTTTTT CTTCTTTATCTCCCTTTTTTTCTTCTTCCTCTTTTTTTTTTTATGTTTTC GTTGTTTTCTTTTTTTTTCTTTTTTCTTTTTCTATTTTTTTTTTTTCTTT CTTTTTTTTTTGTTTTTTCCTTTTTCCTTTTTACTCTTTCTTCTCTTTTT TTTTTTTTATTTTTTTTTCATTTTTCTTTTTATCCCTNTTTTTTTTTATG TTATAGTGTTTTATTTATCGTTTATCTATTTTTATTTTATTTTTCTTATT TTTTTTTATCTATTTCTCTCTTTTTTTTTTTCTTTTTTATTTTATTTTTT TTATTTCGNTTTTTTATTTTATTTTTTATATATTTTTTTATTTTATTATT ATTTAATTTATTTTTTTTGATTATACTTTATTNTTTTTTTGTTTTNTTTT TATATTTTTTTTTTTTTTTTTTTTTTTTTAATTTTTTTTTTTTTTATTTT TTTTATTTTTTTATTTTTTTTTTTATATTTTTTTTATATTTTTTTTTTTT TATTTTATTTTTCTCTTGTTTCTTTTTTTTTTTATTTATTTTTTTTTTTC TTTTTTTTATTATTTTTTTTTTTTTTTTCTTCTTTCTTTTTTTCTTTTAT TTCTTTTCTTCTTTTTTTTTTCTTATCTCTTTCTTTTTTTCTTATTTCTA TTTTTTCTGTCTCTCTTTTCTTCTTTTATTTCTTCATTTCTCTTCTCCAT ATTGTATTTATTTTTTTCTTTTTTCGCTTCTCTTTTTTATTTCTTTTTTC TATTTTTTATCTCTTCTTTTTTTTTTTTCTCTTTTACTTAT
quality values	Open. Hide. 6 6 6 10 8 10 10 9 8 10 10 10 8 8 10 17 21 28 17 14 8 8 8 19 21 36 33 36 33 36 37 48 42 42 42 41 44 44 37 32 32 37 41 37 37 37 33 33 33 33 36 33 50 50 50 47 36 27 23 11 12 11 11 11 11 16 12 12 15 15 32 30 48 48 50 57 57 57 50 53 53 53 53 53 53 50 50 50 47 42 42 42 47 47 47 47 44 43 37 28 33 37 37 37 37 37 28 30 32 34 37 41 30 23 15 11 11 12 12 16 16 11 11 15 21 30 32 33 53 53 38 38 53 53 53 53 53 53 53 53 53 53 53 53 53 53 57 57 50 50 50 53 53 48 59 48 48 48 57 57 68 68 68 68 68 68 50 50 50 68 68 68 57 57 59 59 59 59 34 34 21 21 28 44 44 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 38 38 15 15 13 38 38 57 57 54 54 52 57 57 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 59 59 57 57 57 59 59 59 59 59 59 57 57 57 57 45 45 45 43 43 43 43 52 52 52 52 43 43 24 24 24 28 28 11 11 11 28 28 59 59 59 52 52 59 57 44 59 35 35 35 44 44 57 57 57 57 59 59 57 57 57 57 57 57 59 59 57 57 57 57 59 59 59 59 59 59 59 59 59 59 57 59 59 43 43 33 32 32 43 43 57 57 57 57 57 57 57 47 41 38 38 38 40 27 27 27 20 15 32 24 37 42 44 46 44 43 30 30 14 18 23 23 16 12 12 12 15 19 26 30 44 57 57 59 59 68 68 59 57 57 57 54 57 57 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 48 47 47 28 26 12 16 8 8 8 8 8 23 30 59 59 59 59 39 37 37 32 28 28 23 28 30 43 27 27 11 11 11 27 23 37 28 28 33 40 47 57 54 54 54 48 48 43 43 36 36 25 31 31 37 28 23 23 23 31 40 37 32 27 20 20 28 32 34 17 17 17 19 24 44 44 46 41 36 26 20 20 19 19 15 28 24 24 33 43 40 37 43 13 13 9 9 9 21 12 11 11 27 24 24 12 11 11 11 27 27 11 11 11 24 24 32 27 27 27 18 18 18 14 14 17 20 18 20 20 28 18 12 8 8 8 8 12 13 24 29 21 15 15 12 12 12 12 12 12 24 16 16 11 11 11 15 15 15 15 12 12 15 11 11 15 12 9 8 8 10 12 19 19 19 10 14 10 10 11 21 22 19 19 24 33 33 43 33 32 23 19 19 22 21 15 10 10 10 8 8 7 6 7 7 10 8 10 12 12 11 9 8 8 8 8 10 13 11 11 11 22 22 35 36 29 22 13 9 9 8 10 10 8 8 8 8 8 8 8 17 12 12 8 8 6 6 8 10 19 30 34 17 12 8 8 8 8 10 10 12 9 9 8 8 8 8 8 8 8 8 12 10 11 11 10 10 10 10 10 10 10 12 8 8 6 6 11 8 10 10 13 8 7 8 6 6 8 8 8 8 8 8 8 10 8 6 6 8 8 8 9 8 8 8 8 10 8 10 9 9 9 10 10 15 19 10 10 8 8 8 8 8 8 10 16 18 16 24 19 18 11 9 9 10 11 16 8 8 8 10 8 8 8 8 8 9 11 11 11 11 9 8 8 8 8 10 10 10 10 10 8 6 6 8 8 9 8 10 9 9 9 9 10 16 16 10 10 10 10 10 10 8 8 9 10 8 10 8 8 8 8 8 8 8 8 6 6 8 8 9 10 10 10 12 12 13 9 9 9 9 10 9 9 9 9 10 10 13 15 13 13 14 17 8 8 7 7 7 7 10 11 10 10 8 8 8 7 7 8 8 8 8 8 6 6 13 10 9 10 10 10 10 13 9 8 8 6 7 7 9 10 13 6 6 8 8 8 8 8 10 8 10 11 10 10 10 11 11 9 9 9 6 8 8 8 8 8 11 12 13 8 8 8 10 8 6 6 8 8 10 13 8 10 9 9 8 8 8 8 8 14 10 15 16 8 8 8 8 10 8 9 10 9 10 10 10 11 11 11 13 10 9 8 8 8 10 7 6 8 6 8 8 8 8 8 8 8 10 10 10 9 9 9 8 8 8 8 8 8 9 16 17 11 11 11 8 8 8 8 10 8 10 8 8 6 6 8 8 9 9 8 8 8 8 8 9 11 16 16 18 8 10 6 6 8 8 8 8 10 9 9 8 10 6 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 10 10 9 12 12 12 10 10 10 8 8 7 8 9 9 9 10 9 8 8 7 7 8 8 8 8 8 8 8 8 8 8 8 7 6 6 8 6 6 8 10 12 12 12 9 9 12 13 13 14 19 23 17 11 11 9 10 8 8 8 8 10 10 10 9 9 8 8 8 8 6 6 8 8 10 8 8 8 8 8 8 10 8 6 6 8 10 9 10 11 10 10 8 11 8 8 8 8 10 8 8 8 8 8 8 11 9 9 8 8 8 8 8 8 9 9 9 13 11 7 7 8 8 8 8	Open. Hide. 24 25 25 25 12 12 9 6 8 6 6 6 6 6 10 11 6 6 8 8 9 12 13 9 7 9 9 13 12 19 19 19 10 10 10 21 21 28 28 28 35 23 22 10 10 12 24 22 28 30 30 36 57 53 59 59 59 59 59 47 37 27 20 11 12 11 11 12 13 12 16 16 12 18 20 30 32 43 48 59 53 53 53 53 38 38 43 43 50 47 50 50 50 50 50 53 47 47 47 53 53 53 44 44 46 32 27 28 28 21 28 31 34 34 37 33 33 33 33 25 23 12 12 12 12 11 11 11 13 22 27 37 39 37 37 41 36 36 38 57 57 57 57 48 48 48 57 59 59 59 59 59 59 59 43 41 30 30 43 43 68 68 68 68 50 53 47 47 47 57 57 57 57 54 54 54 54 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 68 68 59 59 57 57 57 57 57 57 57 57 57 59 68 68 68 44 44 32 37 32 38 38 68 68 68 68 68 68 68 59 59 59 59 35 43 43 59 59 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 59 59 59 59 68 68 68 68 68 68 57 57 41 41 18 17 17 41 41 59 57 48 48 59 59 59 59 57 57 57 57 46 46 43 43 39 44 47 54 59 59 68 68 68 68 43 34 19 11 11 25 25 37 28 23 23 28 23 32 34 28 21 12 11 11 12 17 12 10 10 10 10 10 9 9 10 12 16 19 20 17 17 9 10 8 15 12 17 12 12 12 7 9 10 10 18 17 11 8 8 8 8 11 8 6 6 6 8 6 3 0 3 10 13 26 22 18 10 10 10 12 12 14 16 19 28 28 23 23 32 24 20 19 19 11 12 12 10 16 8 10 9 15 12 10 13 7 6 8 8 8 8 8 11 11 10 10 10 11 22 21 13 12 8 8 6 6 8 8 9 9 19 20 22 25 16 13 8 6 7 7 12 8 12 10 10 10 9 11 11 10 19 20 20 22 19 12 10 8 8 8 6 7 8 8 8 8 8 8 6 7 14 13 28 26 19 14 14 10 10 8 3 0 3 10 8 10 15 17 10 8 8 8 10 8 8 9 9 10 12 12 9 9 9 9 10 13 15 13 12 17 12 12 8 8 8 7 7 8 8 8 7 7 8 8 8 13 13 14 18 18 14 19 13 10 13 9 9 14 9 9 13 8 10 10 13 9 9 8 8 10 8 8 10 8 6 6 6 8 7 6 8 6 8 8 8 8 8 11 16 18 17 17 15 10 11 13 8 8 8 8 8 10 8 8 6 8 8 8 6 6 10 6 8 8 8 8 10 12 11 10 10 12 8 7 7 8 8 10 10 10 11 13 18 18 11 11 9 9 9 9 15 10 10 10 16 12 12 10 11 11 10 10 9 10 8 8 10 13 10 10 10 15 11 22 13 8 6 6 8 8 8 11 8 8 8 8 8 9 17 13 12 12 13 13 13 13 11 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 9 9 9 15 9 9 9 13 9 13 10 10 19 15 17 9 9 8 8 8 8 8 8 10 9 8 8 7 6 8 8 8 8 10 8 8 8 9 3 0 3 13 10 11 12 9 8 8 6 6 8 8 8 7 6 8 8 8 8 6 8 10 18 10 10 10 10 11 8 8 8 8 10 13 8 8 8 8 8 9 8 12 15 13 7 6 6 10 12 9 10 10 21 22 10 8 8 8 8 8 10 17 18 16 13 9 9 9 9 10 9 8 8 8 7 14 12 13 8 10 10 14 14 9 9 8 9 9 9 13 10 9 9 9 9 9 10 12 13 9 8 8 8 8 8 8 8 10 10 10 10 10 10 11 11 11 8 9 6 3 0 3 7 9 8 8 8 8 8 12 12 10 9 9 10 10 15 13 8 8 8 6 6 7 10 12 12 10 10 9 8 8 8 8 13 8 8 8 8 9 9 9 9 8 13 10 8 8 8 10 13 15 10 11 17 15 16 10 10 6 6 6 8 8 8 9 9 9 9 16 12 12 8 3 0 3 8 8 12 9 9 9 9 9 10 10 3 0 3 12 12 10 11 8 6 6 6 15 15 10 10 11 17 8 9 9 11 11 15 37 37 32 33 22 19 11 11 11 17 17 8 8 8 8 8 8 10 8 8 10 12 11 11 20 19 12 13 13 10 13 10 11 12 8 8 6 6 8 13 10 9 9 7 7 7 6 12 12 13 11 9 9 9 15 12 8 8 8 9 9 12 17 32 26 13 10 8 8 6 6 8 8 12 12 9 8 10 10 10 14 18 25 15 14 10 11 9 12 9 9 11 11 10 10 10 10 8 10 8 8 10 13 6 6 8 10 13 10 10 8 10 13 9 9 9 10 8 8 6 6 8 8 12 12 15 12 15 12 10 11 10 10 10 10 16 16 14 7 13 9 9 7 10 6 6 8 10 11 9 10 13 16 19 16 16 16 24 22 15 8 6 6 8 8 8 8 7 6 8 7 11 14 11 8 8 7 7 13 10 8 8 8 12 13 24 24 14 13 9 7 8 8 8 12 8 8 10 13 10 10 10 8 10 12 12 9 9 10 8 8 12 10 11 10 14 14 14 11 11 8 8 8 8 8 8 6 6 8 8 6 6 6 8 8 10 12 19 8 8 8 7 7 8 8 6 6 7 8 8 10 15 8 8 6 6 8 12 14 10 10 8 8 6 6 11 8 8 12 8 12 8 8 8 8 10 6 8 8 8 7 6 8 8 8 8 8 8 8 8 8 8 9 9 9 11 11 12 12 15 12 10 16 16 8 8 6 6 8 8 10 9 6 8 6 6 8 8 7 7 6 8 8 8 8 8 8 10 10 10 12 12 10 10 10 10 15 15 15 17 8 8 6 6 8 8 8 8 8 10 16 16 25 15 15 15 18 19 22 13 10 8 8 8 8 10 13 7 9 8 8 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no048_a15.b1 MSMg01no048_a15.b1 CHROMAT_FILE:
MSMg01no048_a15.b1 PHD_FILE: MSMg01no048_a15.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 12:08:31 2005
         (499 letters)



>mm_chr9_119730140_119731038
          Length = 899

 Score =  675 bits (349), Expect = 0.0
 Identities = 379/389 (97%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattctttatatgggatgttatccattgagatctcttgggttgattgctggtgactctc 64
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 389 gaattctttatatgggatgttatccattgtgatctcttgggttgattgctggtgactctc 330

                                                                       
Query: 65  tgacctctggagcagcctgcccccttctttcaccattttcattatatcacagtattggga 124
           ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Sbjct: 329 tgacctctggagcagcctgctgccttctttcaccattttcattatatcacagtattggga 270

                                                                       
Query: 125 tcaactgctgtgctgggatggacatatgctccactttcaaacatcttaattttattgaaa 184
           ||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||||
Sbjct: 269 tcaactgctgtgctgagatggacatacgttctactttcaaacatcttaattttattgaaa 210

                                                                       
Query: 185 acaactgttttatatgtatcggcattttgcctacatgtatgtctgtacactacatgcatg 244
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 209 acaactgttttatatgtatcagcattttgcctacatgtatgtctgtacactacatgcatg 150

                                                                       
Query: 245 aaacgcccaagaccagaagagggtgttggaaccttggagctggatttatgaatcactatc 304
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 149 aaacgcccaagaccagaagagggtgttggatccttggagctggatttatgaatcactatc 90

                                                                       
Query: 305 agccactgtgtgggtgctgggaattgaacccaggtcctctggaagaacagagcccttatc 364
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 89  agccactgtgtgggtgctgggaattgaacccaggtcctctggaagaacagagcccttacc 30

                                        
Query: 365 accgtgccatctctacagccccatatttt 393
           |||||||||||||||||||||||||||||
Sbjct: 29  accgtgccatctctacagccccatatttt 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 499
Length of database: 899
Length adjustment: 10
Effective length of query: 489
Effective length of database: 889
Effective search space:   434721
Effective search space used:   434721
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

Query= MSMg01no048_a15.g1 MSMg01no048_a15.g1 CHROMAT_FILE:
MSMg01no048_a15.g1 PHD_FILE: MSMg01no048_a15.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 12:08:31 2005
         (264 letters)



>mm_chr9_119581100_119581763
          Length = 664

 Score =  487 bits (252), Expect = e-142
 Identities = 261/264 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   gacaaaaccctcttgccagtatctttatcagagcctcgaaggtgtaaacccccgtgaagg 60
           |||||||||||||||||||||||||||||||||||||||||||||||||  | |||||||
Sbjct: 201 gacaaaaccctcttgccagtatctttatcagagcctcgaaggtgtaaacaacagtgaagg 260

                                                                       
Query: 61  catacctggggggaggtcaagaggggggacattaactctgggacagaggggcctcaggag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 catacctggggggaggtcaagaggggggacattaactctgggacagaggggcctcaggag 320

                                                                       
Query: 121 cgtcctctgccagcagtgagaatggaatcaccgtggctgttcctaggggacacatacaaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cgtcctctgccagcagtgagaatggaatcaccgtggctgttcctaggggacacatacaaa 380

                                                                       
Query: 181 gaccactgccaaggcggtggaggaaaaggatgaagagtcctgcaagtggatagggtaggt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 gaccactgccaaggcggtggaggaaaaggatgaagagtcctgcaagtggatagggtaggt 440

                                   
Query: 241 ggagagagagtgagagcaaggctg 264
           ||||||||||||||||||||||||
Sbjct: 441 ggagagagagtgagagcaaggctg 464


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 264
Length of database: 664
Length adjustment: 9
Effective length of query: 255
Effective length of database: 655
Effective search space:   167025
Effective search space used:   167025
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information