MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-085E13
Chromosome	9 (Build37)
Map Location	50,640,182 - 50,640,452
singlet/doublet	singlet
Overlap gene	Alg9
Upstream gene	EG667975, LOC100042806, LOC100043346, LOC672372, 1600029D21Rik, Pts, Bcdo2, Tex12, Il18, Sdhd, Timm8b, AU019823, Pih1d2, Dlat, Dixdc1, 2310030G06Rik, Hspb2, Cryab, 1110032A03Rik, D630004A14Rik
Downstream gene	Ppp2r1b, Snf1lk2, Layn, 4833427G06Rik, Btg4, LOC100042825, Pou2af1, Gm684, 1810046K07Rik, LOC100042854, LOC640374, LOC668070, Arhgap20
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG667975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667975 MGI:3643311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	LOC100042806 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042806
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC100043346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 1709 ESTs, 10 Proteins

name	LOC672372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	1600029D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76509 MGI:1923759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pts (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19286 MGI:1338783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcdo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170752 MGI:2177469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66654 MGI:1913904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16173 MGI:107936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdhd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66925 MGI:1914175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30057 MGI:1353424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU019823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270156 MGI:2143205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pih1d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72614 MGI:1919864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235339 MGI:2385311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dixdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330938 MGI:2679721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310030G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66952 MGI:1914202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69253 MGI:1916503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12955 MGI:88516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110032A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68721 MGI:1915971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630004A14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382137 MGI:3584513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alg9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102580 MGI:1924753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73699 MGI:1920949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Snf1lk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235344 MGI:2445031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Layn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244864 MGI:2685357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 4 Proteins

name	4833427G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235345 MGI:1921013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56057 MGI:1860140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pou2af1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18985 MGI:105086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270157 MGI:2685530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	1810046K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69809 MGI:1917059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 2 Proteins

name	LOC100042854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC640374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 933 ESTs, 23 Proteins

name	LOC668070 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 811 ESTs, 5 Proteins pseudo : _no_value

name	Arhgap20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244867 MGI:2445175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259958 GeneID:100043346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 1709 ESTs, 10 Proteins product : similar to QM protein transcript_id : XM_001480010.1

name	1600029D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286796 GeneID:76509 MGI:1923759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600029D21 gene transcript_id : NM_029639.2

name	Pts (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982767 GeneID:19286 MGI:1338783
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-pyruvoyl-tetrahydropterin synthase transcript_id : NM_011220.2

name	Bcdo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131019 GeneID:170752 MGI:2177469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-carotene 9', 10'-dioxygenase 2 transcript_id : NM_133217.2

name	Tex12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380389 GeneID:66654 MGI:1913904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 12 transcript_id : NM_025687.2

name	Il18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680412 GeneID:16173 MGI:107936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 18 transcript_id : NM_008360.1

name	Sdhd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130258 GeneID:66925 MGI:1914175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate dehydrogenase complex, subunit D, integral membrane protein transcript_id : NM_025848.2

name	Timm8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305578 GeneID:30057 MGI:1353424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 8 homolog b (yeast) transcript_id : NM_013897.1

name	AU019823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059060 GeneID:270156 MGI:2143205
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU019823 transcript_id : NM_212449.1

name	Pih1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794141 GeneID:72614 MGI:1919864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PIH1 domain containing 2 transcript_id : NM_028300.1

name	Dlat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801999 GeneID:235339 MGI:2385311
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) transcript_id : NM_145614.3

name	Dixdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559409 GeneID:330938 MGI:2679721
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIX domain containing 1 transcript_id : NM_178118.1

name	2310030G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981164 GeneID:66952 MGI:1914202
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310030G06 gene transcript_id : NM_025865.2

name	Hspb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098126 GeneID:69253 MGI:1916503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 2 transcript_id : NM_024441.2

name	Cryab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892993 GeneID:12955 MGI:88516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, alpha B transcript_id : NM_009964.2

name	1110032A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803197 GeneID:68721 MGI:1915971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110032A03 gene transcript_id : NM_023483.3

name	D630004A14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68051722 GeneID:382137 MGI:3584513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D630004A14 gene transcript_id : NM_198675.2

name	Alg9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527201 GeneID:102580 MGI:1924753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase) transcript_id : NM_133981.1

name	Ppp2r1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539769 GeneID:73699 MGI:1920949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform transcript_id : NM_001034085.1

name	Ppp2r1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539775 GeneID:73699 MGI:1920949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform transcript_id : NM_028614.2

name	Snf1lk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38569496 GeneID:235344 MGI:2445031
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF1-like kinase 2 transcript_id : NM_178710.3

name	Layn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259960 GeneID:244864 MGI:2685357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 4 Proteins product : layilin transcript_id : XM_146887.7

name	4833427G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344151 GeneID:235345 MGI:1921013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833427G06 gene transcript_id : NM_177702.3

name	Btg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353275 GeneID:56057 MGI:1860140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell translocation gene 4 transcript_id : NM_019493.3

name	LOC100042825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259929 GeneID:100042825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042825 transcript_id : XM_001478900.1

name	Pou2af1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130242 GeneID:18985 MGI:105086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, associating factor 1 transcript_id : NM_011136.2

name	Gm684 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386104 GeneID:270157 MGI:2685530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 684, (NCBI) transcript_id : XM_196479.4

name	1810046K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259962 GeneID:69809 MGI:1917059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 2 Proteins product : RIKEN cDNA 1810046K07 gene, transcript variant 1 transcript_id : XM_134800.6

name	LOC640374 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259963 GeneID:640374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 933 ESTs, 23 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001480150.1

name	Arhgap20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47575839 GeneID:244867 MGI:2445175
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 20 transcript_id : NM_175535.3

name	LOC100043346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259959 GeneID:100043346
definition	codon_start : 1 product : similar to QM protein protein_id : XP_001480060.1

name	1600029D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286797 GeneID:76509 MGI:1923759
definition	codon_start : 1 product : placenta expressed transcript 1 protein_id : NP_083915.2

name	Pts (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110709 CCDS:CCDS23164.1 GeneID:19286 MGI:1338783
definition	GO_function : GO:0003874 - 6-pyruvoyltetrahydropterin synthase activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : 6-pyruvoyl-tetrahydropterin synthase protein_id : NP_035350.1

name	Bcdo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875374 GeneID:170752 MGI:2177469
definition	GO_component : GO:0005622 - intracellular [Evidence IC] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IDA] [Evidence IEA] GO_process : GO:0016119 - carotene metabolism [Evidence IDA]; GO:0042574 - retinal metabolism [Evidence NAS]; GO:0042573 - retinoic acid metabolism [Evidence NAS] codon_start : 1 note : beta-diox-II; b,b-carotene-9',10'-dioxygenase; beta-carotene 9',10'-dioxygenase 2 product : beta-carotene 9', 10'-dioxygenase 2 protein_id : NP_573480.1

name	Tex12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385150 GeneID:66654 MGI:1913904
definition	codon_start : 1 note : testis exprtessed gene 12 product : testis expressed gene 12 protein_id : NP_079963.1

name	Il18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680413 GeneID:16173 MGI:107936
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] [Evidence ISS]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence ISS]; GO:0042033 - chemokine biosynthesis [Evidence ISS]; GO:0042253 - granulocyte macrophage colony-stimulating factor biosynthesis [Evidence ISS]; GO:0006955 - immune response [Evidence TAS]; GO:0008625 - induction of apoptosis via death domain receptors [Evidence TAS]; GO:0042095 - interferon-gamma biosynthesis [Evidence IMP]; GO:0042231 - interleukin-13 biosynthesis [Evidence TAS]; GO:0042094 - interleukin-2 biosynthesis [Evidence ISS]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence ISS]; GO:0030155 - regulation of cell adhesion [Evidence ISS]; GO:0030431 - sleep [Evidence ISS] codon_start : 1 product : interleukin 18 protein_id : NP_032386.1

name	Sdhd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229021 GeneID:66925 MGI:1914175
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 product : succinate dehydrogenase complex, subunit D, integral membrane protein protein_id : NP_080124.1

name	Timm8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305579 GeneID:30057 MGI:1353424
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042719 - mitochondrial intermembrane space protein transporter complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0045039 - protein import into mitochondrial inner membrane [Evidence IEA] codon_start : 1 product : translocase of inner mitochondrial membrane 8 homolog b protein_id : NP_038925.1

name	AU019823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059061 CCDS:CCDS23166.1 GeneID:270156 MGI:2143205
definition	codon_start : 1 product : hypothetical protein LOC270156 protein_id : NP_997614.1

name	Pih1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794142 CCDS:CCDS23167.1 GeneID:72614 MGI:1919864
definition	codon_start : 1 product : PIH1 domain containing 2 protein_id : NP_082576.1

name	Dlat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542559 CCDS:CCDS23168.1 GeneID:235339 MGI:2385311
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0045254 - pyruvate dehydrogenase complex [Evidence TAS]; GO:0005967 - pyruvate dehydrogenase complex (sensu Eukaryota) [Evidence TAS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004742 - dihydrolipoyllysine-residue acetyltransferase activity [Evidence TAS]; GO:0031405 - lipoic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006086 - acetyl-CoA biosynthesis from pyruvate [Evidence IC]; GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dihydrolipoamide S-acetyltransferase product : dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) protein_id : NP_663589.2

name	Dixdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559410 CCDS:CCDS23169.1 GeneID:330938 MGI:2679721
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA] codon_start : 1 product : DIX domain containing 1 protein_id : NP_835219.1

name	2310030G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385350 CCDS:CCDS23170.1 GeneID:66952 MGI:1914202
definition	codon_start : 1 product : hypothetical protein LOC66952 protein_id : NP_080141.1

name	Hspb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098127 CCDS:CCDS23171.1 GeneID:69253 MGI:1916503
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0007525 - somatic muscle development [Evidence IGI] codon_start : 1 exception : mismatches in translation note : heat shock 27kD protein 2 product : heat shock protein 2 protein_id : NP_077761.2

name	Cryab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753530 CCDS:CCDS23172.1 GeneID:12955 MGI:88516
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence TAS] GO_process : GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0007517 - muscle development [Evidence IGI]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 note : crystallin, alpha 2; alpha B-crystallin product : crystallin, alpha B protein_id : NP_034094.1

name	1110032A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560116 CCDS:CCDS23173.1 GeneID:68721 MGI:1915971
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68721 protein_id : NP_075972.2

name	D630004A14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68051723 CCDS:CCDS23174.1 GeneID:382137 MGI:3584513
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004826 - phenylalanine-tRNA ligase activity [Evidence IEA] GO_process : GO:0006432 - phenylalanyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC382137 protein_id : NP_941077.2

name	Alg9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527202 CCDS:CCDS23175.1 GeneID:102580 MGI:1924753
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : disrupted in bipolar disorder 1 homolog protein_id : NP_598742.1

name	Ppp2r1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539770 GeneID:73699 MGI:1920949
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform isoform a protein_id : NP_001029257.1

name	Ppp2r1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539776 GeneID:73699 MGI:1920949
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform isoform b protein_id : NP_082890.2

name	Snf1lk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38569497 GeneID:235344 MGI:2445031
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0046626 - regulation of insulin receptor signaling pathway [Evidence IDA] codon_start : 1 note : salt induceable kinase 2 product : SNF1-like kinase 2 protein_id : NP_848825.2

name	Layn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259961 GeneID:244864 MGI:2685357
definition	codon_start : 1 product : layilin protein_id : XP_146887.7

name	4833427G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244154 GeneID:235345 MGI:1921013
definition	codon_start : 1 product : hypothetical protein LOC235345 protein_id : NP_808370.1

name	Btg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982714 GeneID:56057 MGI:1860140
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0045930 - negative regulation of progression through mitotic cell cycle [Evidence IDA] codon_start : 1 product : B-cell translocation gene 4 protein_id : NP_062366.2

name	LOC100042825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259930 GeneID:100042825
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478950.1

name	Pou2af1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755128 CCDS:CCDS23176.1 GeneID:18985 MGI:105086
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : POU domain, class 2, associating factor 1 protein_id : NP_035266.1

name	Gm684 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38090334 GeneID:270157 MGI:2685530
definition	codon_start : 1 product : similar to LOC120376 protein protein_id : XP_196479.2

name	1810046K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20888581 GeneID:69809 MGI:1917059
definition	codon_start : 1 product : hypothetical protein LOC69809 isoform 1 protein_id : XP_134800.1

name	LOC640374 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259964 GeneID:640374
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001480200.1

name	Arhgap20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47575840 CCDS:CCDS23177.1 GeneID:244867 MGI:2445175
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 20 protein_id : NP_780744.2

name	EG667975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667975
definition	number : 1 pseudo : _no_value

name	LOC100042806 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042806
definition	number : 1 pseudo : _no_value

name	LOC672372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672372
definition	number : 1 pseudo : _no_value

name	LOC672372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672372
definition	number : 2 pseudo : _no_value

name	LOC672372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672372
definition	number : 3 pseudo : _no_value

name	LOC672372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672372
definition	number : 4 pseudo : _no_value

name	LOC672372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672372
definition	number : 5 pseudo : _no_value

name	LOC100042854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042854
definition	number : 2 pseudo : _no_value

name	LOC100042854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042854
definition	number : 1 pseudo : _no_value

name	LOC668070 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259965 GeneID:668070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 811 ESTs, 5 Proteins product : similar to ribosomal protein L9 pseudo : _no_value transcript_id : XR_034563.1

clone name	MSMg01-271K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346G08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-085E13.T7 (MSMg01no085_e13.b1)	MSMg01-085E13.TJ (MSMg01no085_e13.g1)
ACC	AG304915	AG304916
length	2,743	1,286
length of high quality (start - end)	---	272 (122 - 393)
definition	CHROMAT_FILE: MSMg01no085_e13.b1 PHD_FILE: MSMg01no085_e13.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:35:51 2005	CHROMAT_FILE: MSMg01no085_e13.g1 PHD_FILE: MSMg01no085_e13.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:35:51 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	AATCAGTGATAGGTAGGGNGATTATAGAAAGTGTGGGGAGGGAGAATAGG TAGATTAATGAGTGATGGGTAGAGGAGAGAAAAGAGGTGAGAGAAGGAGA TTAGAGTAGGGAGTAGAGGATGAAGGAGGCTGTTTAGAGAGGATGGGTAG TGGCTAGTAATATGATGGAAGTAGAGAGGAGAGTGGTGTAGATAGAATCG GGACTTATGTGAGAGAGAGAGCGGTCGACCCGCCCCAGATTTAGTGTGTG TGTGGTGAGTGATAGTGAGTAGTAGATGTAAAGTGGAAGATAGAGAGTAG TAGATAAGGTAGAGAGGAAGTATAGAGTAGTAAGATATATGTGGTATGTG TGGGAATGGATGGTGTATGAGTATAGGATGATGATAGATGATGAGTGTGA TAGAAGAAGTGTAACTTCGATGAGAGATAATGTGCATTAGGTAGGAAGTA ATGGGTAGTAGAGTAGGAATAGTGTGTGAGTTATAGAGGTGTTTGTGATT GAGTGGGTGTGGATAGTGTATGATATTAGAAAGAGGAGATGTATTGCAGT ATGTTAAATATAGATGAAGAGGANAGAAGAGTTGATGTGTGGATTAAGTG TAGTAGTATGTGTGTATAGAAGGACTTGTATAGAGGTAGAGTTTAATTAG TGAGATGCAAGATGTGTGAGATAGATGTAGGTTAATGGAGGTAAGAATAT GGTATATAGTGTGAGAGGGTAGGGAGTAGTGTTAGTGCTAGGATGTGATG CAGCTTGAGGGGGAGTGTAGTGGTGAGTTGGAAGANATAAGGTNTGTGAT GTTATGATGAGGATAAAGAGGATGAGGAGGATGAGGGATAGATATAGAGG AAGTATGATGAGTGACTTATAAGNTGAGTAATGTGTTGTGAGATGTGAAT AAAGTGTTTAGTGAAGAATAGAATGGATTTGATGGTTATGTAAATTAAGT GGGGATGGTAATGATGTATGAATGGGGAGTAATTAGGTTATGTGGAGTCT TAGGTGGTATAGAGTGAGTGGGATTGAGTGCAGAAGTTAAAGTAGGTAAT GTATATTATAATAGTTGTCGANAGTTAGAGAGAGTAGCTGCTAGTGATAG TGANGTGATATATGNGTGAGAACGTGTGAGTTATAGGTGTAGTGAGTGAT ATANATTAAGACAGTCCGACTAGGAGTGTATATGTATAATATATGAATAT GATGATGTTAGTATGCATGCCCTTGAGTAGTGGTGGAGATGATGTCTGTG TTATGATGTGATATACATGTGATGTGTGATGTTAATGAGGTATGAAGATA TAGATGTAGGAGGTGAGTGTGTAGATGTAGATGTAGTNGATAGGAAGATG GAGATTGAGGTAGGGTGTTCAAGTTACAGAGGAGTAGGTAGATATGGTGA AGAGAGTGTGAATGGTANCTGGAGTAGAGAGTTATTAGTGTATATGTTAT AGAGTGTTATNGTGGTATGTGTATTTATGATGTGAGTGGTAGAGGTAGTA TATGTGCTGTATCTGTGTGTGATAGTGTGTTAGTAGAATAGTAGTAGGAG CAGAATATNAGTAGTGGGGTGAGGAGTTATAGAAGAAGNGTGATTAGGGT TAGGGTGGNTAGTGAGAGTTATAAGAGATGGGAGTGAGTGAGAGAGANGT AGGCTATTGTAGTAGAAGATAATGATTATTACTATATAGATGAGTGTGAG ATATGATGGANGATAGTAGGTATATGAGGTGTTAGAGTAGAGATATGATA GATGGACAGTGGAGTACTGTATGATAGTATGTGCGGGTGATAGAAGATGG TGTAGATTGATGGNTGTATGGTGATGTGCGTAGTAGAGAAGAATGGATAT ATGATGAGGTGTTAGATGTGAAGATTTTAGATGGAGTGTGTTAGGTGATG AAGAGTGTAATAGATAGAATNGTGTATTGGGTGATGTTGAGGAGAGAGAC TATGATGATATATAGTGCTAGAGAGTATGTGTATTGTATTATGATGGATA GTGTATGAGCGAGATTGTCGTGNTAGTGAATAGTTATGATATGAATGTCG TATTGNANTGTAGGTATNTGGGTAGAGAGTGATGGTGTGATAGATGGTAT ANGNTAGNGCTGTGTNTGAGTAGTGCGTGTAGTGTGTGNATAGAGTGATA GTTGTAGATAGTATANATGTGTANGTGATCTACGTAGTGAGAGATAGTAA TATTTAGAGTTATAAGAGTGTTGTGTGATAGTATGTAGATAAGAGNTATA GTAAGATAGGTAGTANTGTATTGTATAGGTGAGAGTAAGTGTGCTATAGG GATGCTGATGNNNTGATATAGAATAGTANTAGGTAGTGNATGTGTTTAGT GTGTATGCTATATGAGAGGTAGAGTAGATGTATAGATAGAGGAGTGTGTA TGTGTGATAGTGTGAGTGTAGAGATGAGTAGTTGTAGATAGTGTATAGTG TACAGAGATAAACTGAGTACTGNTGAAGTGTGGATAGATAGTAGTAATGT ATGAGTGATGTGTGTTGAGTGTATAGTATGTATANATGAGGAGTATATGT AAGAATGAGATAGGAGAGTATGTATACGATATATATGAGATGAGTAGTGA NTGTAGTAGTGAGATATAGTAACGNATGTATNTGGAGATGGTGTATAGTG AGTGTGNTAGAGAGNTGTAGTGAGATAGTAGNGATGANTGATGTGTGAGA NCTGTGTATATGTAATAAGTATAGGTAGAGTTANANGCTAGTG	AGATGTGAGCCTGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXCCTTTAATGGATGGGGCCCCAGAATGCTCCAAAATGGA AGACCCTTAGATGGAACCCATGCAAACAAAACGGAAGTGCGTATGCGCAG CGCCCACAGGTAGAGGGTGTCACACAAAGCAGTGCAGAGACTTTAGACCA TTTCCAAAGCTGCACACAGACCCCACTCTTCAGAAGGCCAATGTCAACTG CCTGGAGAGGCATTCCCACCAGGCTCTGGGGCTCTGCACTCACCACTGAG CCACTGGTTTATTCCAGCACTCTCCTTCACCCCTCTCAGGGACTCTTAGA CGAGATATTACATCCATCCACATGTCAAGCTACTTTATACAACTAGTTTT TATGTCCTGGTTCAAAGAATTAATAAAAAAACAACCCCTTGTTTAACAAA GGCCGTAACCTGGTTTGGTTACAGGACCGCAAATCTGAACATTTTCGGCT GGGGCTGTATCGATGTCCCCTCAGTTAAAAGCCCTGGCTTCTTCTCCAGA AACTCCTTCAATTCCCAGATCCCATGTGGACTCTTACTTCCATCTGCAAC TTCTATTGCCAGTGTCTGTTGACACCCTCTTCTGGCCTTGGAGCTTACCA GGCTCATTGTCCTATCTACCTCAGCCAGACTTCGTCGTGAGATGCTCCCC GTCTTATAATTTTGCTTCTATACCTTAACTCCCTTAGTACTATACTGCTT GTTTGGCCCCTGAATTCTCCTGCCCTGATTGCTCTATTTTAAAATATTTT GTTTTCTGTATGTTCTCTGGATATGCTCATAATCTCTTTTTTTAAATTAT ATTTCTCTGCTCTTCTTGTTCCTCATCGATTGGATTTATGCCTCCTTTAT TCTCTACTTCTCTGTTTTTCACTTTTAAATCCTTTTTATTATTTATTTTT TCTACCACTTGTTATTAATGGTTTTTCTTTTCTTATTTCATACTTTTCCT CTTTTCCCTATTCCTTGTCTTTTATATCTTTATTATGCTTTCCCCTCTTG TATTTTTTTTCCTCATTATCTTTCTTCTTTTAGGTATTTTTATTCCCTCT GTTCTCTTTCTCTTTACTTATCTCTTATTGGCTTCCTTCTGTATCATTTC AATTCCTCTTTCTACTTACTCTTATCTGTATATTATTGGTCTGTCTTTAT TTATCTTATCTTACTTCTTTCTATATTACTCTTTTTACTTTTTTCTATAT ACATATACTTCATACACTCTTCCTCTATTTCTTCTT
quality values	Open. Hide. 8 8 7 7 7 10 8 8 8 6 6 8 6 8 8 8 12 3 0 3 8 8 7 6 8 8 8 8 8 8 7 7 7 7 9 9 12 10 9 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 9 9 9 8 8 8 9 9 9 11 11 12 15 24 28 25 22 12 10 8 8 8 8 8 8 8 8 9 14 15 17 14 10 11 8 8 8 8 8 8 8 8 11 8 8 6 6 6 8 8 8 8 8 8 8 10 12 10 10 8 8 8 8 8 8 6 8 6 6 6 8 8 8 8 8 6 6 8 6 8 8 8 8 8 9 9 8 8 8 8 8 8 8 8 8 6 6 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 6 6 8 6 8 15 15 19 10 12 9 9 7 8 8 8 8 8 8 8 8 9 9 9 8 8 6 6 8 7 7 6 7 6 8 8 10 10 8 8 8 8 8 8 9 9 9 11 11 6 6 6 6 7 6 6 6 7 14 15 10 10 9 9 10 10 10 10 10 9 10 10 10 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 13 7 7 7 8 8 8 8 11 8 8 8 8 6 8 6 6 6 6 6 9 6 6 8 8 11 11 10 9 10 10 10 10 10 10 6 6 8 8 8 8 9 9 8 8 8 10 6 6 8 8 7 6 6 6 8 8 8 8 8 8 10 8 8 8 6 6 8 10 10 6 6 6 8 7 6 7 6 9 10 9 7 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 9 15 13 11 8 10 10 15 15 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 10 8 8 6 6 6 6 8 6 6 6 6 8 6 8 8 8 8 8 10 8 8 8 9 9 9 9 6 6 6 8 8 8 8 8 8 8 8 8 8 10 10 10 10 6 6 6 6 8 8 8 8 8 13 8 8 8 8 8 8 8 7 6 6 6 8 8 8 8 8 8 10 12 10 12 8 8 8 8 8 10 10 11 8 8 8 8 8 8 6 6 10 10 8 8 6 8 8 10 8 8 8 7 7 8 9 10 10 8 8 6 7 8 6 8 8 8 8 10 6 6 8 6 8 8 8 8 8 8 8 7 9 9 9 11 9 8 9 9 9 9 9 9 8 8 8 8 8 8 8 11 10 8 8 8 8 8 8 8 8 8 10 10 10 3 0 3 8 6 6 6 6 6 6 6 8 10 10 10 10 9 9 6 6 6 6 8 10 10 10 10 8 8 8 8 8 6 6 6 6 8 8 10 10 10 8 8 6 6 6 6 8 6 8 8 8 8 8 10 8 10 8 8 10 11 8 10 10 10 8 9 9 9 9 9 9 9 9 6 8 6 6 6 6 6 7 6 10 7 7 7 8 8 10 10 10 8 6 6 6 8 10 8 8 8 7 8 6 6 6 6 8 8 10 8 8 6 6 8 6 9 9 11 8 8 6 6 8 6 10 10 11 11 11 8 8 8 8 6 6 8 8 7 6 8 6 6 8 6 11 9 11 10 10 10 8 8 8 8 8 8 8 8 8 10 12 10 8 6 6 6 6 8 6 8 8 8 8 8 8 10 8 8 6 6 6 6 7 7 12 6 10 6 6 6 6 8 8 8 10 8 8 8 8 8 8 6 6 8 8 13 10 8 8 8 8 3 0 3 8 8 6 6 6 3 0 3 8 8 9 9 9 9 9 7 6 6 8 8 8 8 8 8 10 10 10 8 8 6 6 8 8 8 8 8 8 9 8 8 8 8 10 8 8 8 6 7 10 10 10 6 6 6 6 8 8 8 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 10 7 7 6 3 0 3 6 6 8 6 9 9 10 8 8 8 8 8 13 12 9 10 10 10 10 16 13 10 8 8 8 8 8 8 6 8 6 6 8 8 8 8 8 8 9 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 7 6 6 6 8 6 6 8 8 8 8 7 6 6 9 6 6 8 8 8 9 8 6 6 6 6 10 10 13 10 8 8 8 8 6 6 6 6 8 8 8 6 6 6 6 8 8 9 8 8 13 13 15 10 10 9 9 10 10 8 8 8 8 13 8 10 8 6 8 6 6 10 10 8 8 8 8 8 8 19 11 8 8 8 8 10 8 8 8 6 6 8 6 8 8 10 12 8 8 8 8 7 7 7 8 7 7 6 6 7 8 8 8 8 8 6 6 6 6 6 9 10 10 10 10 8 8 8 8 10 8 7 7 8 8 8 8 8 8 10 8 3 0 3 9 8 9 10 10 10 10 10 10 10 8 8 6 6 6 6 7 7 7 9 6 6 8 8 8 8 8 8 8 3 0 3 10 10 13 11 8 8 6 6 3 0 3 11 11 9 13 9 9 9 9 9 10 13 10 8 8 10 9 8 8 8 8 8 8 8 8 9 12 15 10 10 19 10 9 8 10 8 8 3 0 3 6 8 8 6 6 8 8 8 8 8 10 8 8 6 6 6 8 8 8 8 8 9 10 9 9 9 8 10 8 8 8 8 8 8 8 10 11 7 15 6 6 8 6 6 8 8 8 8 8 8 8 8 8 8 11 15 15 8 8 7 9 9 11 9 8 6 6 7 9 9 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 10 8 8 7 7 7 8 8 8 8 6 6 8 8 11 11 10 11 9 8 8 8 7 7 9 9 11 11 10 8 8 8 8 8 8 10 8 8 11 8 8 8 9 9 9 8 8 8 8 6 6 6 6 6 8 8 10 9 7 6 8 7 7 11 6 6 6 6 6 6 8 8 10 8 8 8 10 11 12 10 9 7 8 8 8 8 8 8 8 8 8 8 10 10 10 3 0 3 8 8 6 6 8 8 10 8 8 8 8 6 6 6 8 8 10 9 9 9 6 7 7 6 8 8 8 6 6 6 6 8 8 8 8 8 10 10 10 12 7 6 8 6 8 10 8 10 11 15 7 7 7 7 8 8 8 8 8 8 9 9 9 6 10 6 6 8 6 8 8 10 8 10 9 9 11 3 0 3 8 8 8 8 8 8 8 8 8 12 19 15 10 8 8 8 8 8 12 10 10 10 8 8 6 6 6 6 6 8 8 8 9 7 8 8 8 8 8 8 3 0 3 6 6 8 8 8 8 6 6 6 6 8 8 8 10 10 12 10 8 8 6 6 8 8 8 8 8 6 6 8 8 6 6 8 6 8 8 8 8 8 8 8 8 12 8 8 8 8 11 10 10 10 10 11 11 10 10 9 9 10 8 8 6 8 8 8 8 8 8 6 8 8 8 9 10 9 9 9 9 9 9 10 9 9 9 8 7 7 8 8 12 10 11 9 9 9 3 0 3 11 11 16 13 12 8 8 8 10 8 8 7 6 8 8 11 12 8 8 8 8 6 6 6 6 8 8 3 0 3 10 10 9 9 8 8 8 8 6 6 8 10 8 8 8 10 9 3 0 3 13 13 17 15 10 10 9 8 8 8 8 11 10 15 8 6 6 6 8 6 6 6 6 6 8 7 8 10 10 19 15 17 10 8 7 7 3 0 3 8 8 8 6 6 9 9 9 9 7 10 10 10 8 10 11 13 8 10 8 8 8 12 10 12 10 8 8 8 8 6 6 8 8 8 10 7 7 8 8 8 8 9 9 10 10 10 10 9 12 11 9 10 9 12 8 8 8 8 8 3 0 3 12 10 10 10 10 8 8 8 10 10 18 11 11 9 10 6 6 6 6 6 6 8 10 10 8 6 6 8 10 14 13 12 10 9 10 10 10 10 8 8 8 8 6 6 6 6 8 10 8 8 8 8 8 6 6 8 8 8 8 8 10 9 9 8 7 7 8 10 7 9 9 9 9 9 9 7 8 8 8 10 11 9 9 7 8 8 8 8 8 10 9 13 13 17 11 10 10 9 9 9 3 0 3 9 7 9 8 8 10 12 12 11 9 9 10 6 6 6 6 8 6 6 8 10 8 8 8 8 8 8 8 8 10 6 6 6 8 8 8 10 8 8 8 8 10 10 8 8 7 6 6 6 6 8 12 7 7 6 6 6 6 6 6 8 8 8 8 6 6 7 7 8 8 9 16 16 10 8 10 8 8 8 8 8 8 7 9 9 10 8 8 6 6 8 8 8 8 8 8 8 6 7 8 8 8 9 10 3 0 3 6 7 7 6 6 6 6 11 17 12 12 11 11 16 15 6 6 6 6 8 8 10 11 9 8 8 6 6 6 6 6 8 8 6 6 6 6 8 8 10 10 8 6 6 6 6 8 7 7 8 8 8 15 8 8 6 6 6 6 8 8 8 8 6 7 6 6 8 6 7 6 6 8 8 6 6 6 7 10 10 8 8 8 8 8 8 6 6 6 6 8 6 6 10 6 6 6 6 8 3 0 3 7 8 7 6 6 6 6 8 8 10 10 10 9 9 9 9 6 8 6 6 8 8 10 9 9 9 9 9 10 10 3 0 3 0 3 8 11 6 6 6 6 8 3 0 3 6 6 6 6 11 10 10 8 6 6 6 8 10 11 10 15 13 14 14 10 12 6 6 6 8 8 8 8 8 8 8 3 0 3 0 3 10 3 0 3 9 9 8 8 8 3 0 3 8 8 10 11 10 8 8 8 6 6 7 11 6 6 8 8 8 13 9 10 3 0 3 8 8 8 8 8 7 6 8 6 10 7 6 8 8 6 6 8 8 8 8 8 8 11 10 3 0 3 8 8 8 8 8 3 0 3 8 9 8 8 7 9 7 7 7 8 8 8 8 8 8 8 8 6 6 6 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 6 8 6 9 13 13 11 11 11 9 9 9 8 8 8 8 10 10 10 8 13 8 8 8 8 8 8 10 10 3 0 3 10 10 8 10 10 10 10 9 11 9 8 10 10 9 8 10 9 3 0 3 6 8 8 8 8 8 9 6 8 6 6 8 8 10 11 8 8 10 8 10 10 8 8 8 8 7 8 7 8 8 8 6 7 7 6 8 8 7 7 8 10 16 3 0 0 0 3 6 6 6 6 10 10 10 8 10 8 8 13 10 3 0 3 10 8 8 8 8 8 8 3 0 3 9 10 9 9 8 6 6 6 15 11 9 9 8 8 8 8 10 13 10 9 8 8 11 11 8 7 7 7 6 6 6 6 8 8 6 6 8 8 8 8 7 7 10 10 10 8 8 8 8 8 8 8 8 13 8 10 10 10 10 9 9 9 11 10 16 16 8 8 6 6 8 12 19 19 11 11 8 15 10 8 8 8 8 8 8 8 6 6 10 6 7 6 6 6 6 6 8 8 6 6 11 8 10 8 8 8 10 12 13 15 10 9 9 9 10 11 11 6 6 6 6 6 6 6 6 9 13 8 6 6 6 3 0 3 6 6 6 6 6 8 8 8 8 8 15 10 10 10 8 8 6 6 8 8 6 6 6 6 13 6 8 8 8 6 7 9 9 8 10 8 9 10 10 6 6 6 6 8 6 9 10 9 10 9 9 8 8 8 8 10 9 8 8 3 0 3 6 6 7 8 8 8 8 8 10 8 7 7 8 8 8 8 8 10 11 17 15 19 9 9 7 7 8 6 8 8 8 6 6 6 6 8 8 10 8 6 6 6 8 8 10 11 12 12 10 9 9 8 7 7 9 9 12 12 11 15 8 10 7 3 0 3 8 8 8 6 8 13 10 8 8 8 7 7 7 8 8 8 10 7 7 6 6 3 0 3 8 8 6 7 3 0 3 8 8 8 8 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 6 3 0 3 10 8 8 8 6 3 0 3 8 6 6 8 12 8 7 10 8 8 6 6 8 7 3 0 3 6 8 6 3 0 3 7 6 6 6 6 8 10 8 6 6 3 0 3 9 9 9 9 8 8 11 7 8 7 6 8 8 8 10 8 8 8 10 10 8 8 8 10 9 10 9 8 8 9 3 0 3 0 3 7 6 6 6 8 6	Open. Hide. 6 6 6 8 7 6 6 6 8 9 9 8 8 8 8 17 9 10 8 8 13 10 12 8 12 14 14 16 19 28 33 33 31 29 29 12 12 12 19 19 28 28 29 29 34 34 34 28 28 32 39 37 48 48 41 37 37 21 23 12 9 9 10 10 10 11 9 14 9 9 9 12 15 15 12 15 15 16 15 20 28 26 33 34 34 34 34 50 36 36 33 32 35 37 33 33 33 33 33 29 17 10 8 8 8 10 12 12 11 11 16 19 19 19 17 18 15 18 15 18 15 28 26 25 23 28 23 23 28 28 28 35 33 33 32 32 30 30 32 41 41 43 43 42 39 35 32 32 30 32 32 41 44 43 36 32 28 28 28 28 40 36 43 43 23 19 8 8 8 19 18 39 42 42 42 32 24 15 18 18 19 15 30 24 28 23 23 32 30 21 43 43 32 32 29 29 35 43 43 54 54 57 57 57 54 52 52 52 52 52 43 43 32 29 29 35 43 43 43 43 43 52 52 52 52 52 52 52 50 38 32 16 15 14 24 21 20 20 38 28 27 38 27 27 43 43 28 38 22 18 23 38 38 35 35 35 39 39 39 35 33 43 38 38 32 33 31 43 38 28 24 11 11 12 26 38 43 43 26 38 26 26 13 22 23 32 32 43 43 62 43 39 39 43 43 43 43 43 31 31 35 43 39 39 39 43 31 43 43 57 43 57 52 43 39 39 39 43 35 35 43 43 43 43 43 43 44 27 27 20 34 34 43 35 28 21 32 24 24 14 14 14 27 26 37 26 28 11 10 9 10 10 17 16 20 17 19 36 36 37 37 39 42 43 38 39 38 43 32 32 29 28 28 43 43 43 42 35 35 50 50 54 57 57 50 50 36 30 19 12 10 10 10 10 10 11 11 13 17 19 16 15 12 32 24 30 16 16 12 11 11 12 16 12 17 11 9 9 11 24 22 19 15 13 12 12 12 13 11 10 10 12 15 15 17 20 20 20 20 37 40 48 32 27 15 12 12 12 12 12 12 10 10 10 10 10 11 11 11 12 21 12 12 10 10 8 8 6 6 8 8 9 11 21 21 12 15 12 11 12 12 15 15 23 24 25 19 14 23 14 16 16 17 14 8 8 8 10 17 21 21 18 20 15 19 21 19 13 10 9 10 10 10 23 18 12 11 9 8 8 8 8 8 10 8 11 8 8 8 11 9 9 8 8 9 10 9 9 26 26 16 16 9 9 9 10 11 11 12 13 8 8 6 7 10 8 10 10 10 10 10 10 19 11 12 10 10 10 10 10 10 11 12 11 11 11 15 11 7 6 6 8 8 8 12 8 10 8 8 8 9 21 15 12 12 12 11 11 12 15 26 21 15 14 12 14 9 9 9 9 8 8 8 8 8 8 12 10 9 10 12 12 10 10 10 10 12 16 27 22 12 11 10 10 10 8 8 10 15 10 8 8 8 8 10 15 13 15 12 11 11 11 13 10 10 8 8 8 8 8 8 8 7 7 6 8 6 6 6 8 8 8 8 8 8 8 8 8 9 8 8 10 10 8 9 9 10 11 12 10 11 10 10 10 10 10 12 10 14 10 10 9 11 10 9 9 12 12 14 15 15 8 8 8 8 10 10 10 10 10 8 8 8 6 6 8 8 8 10 8 8 10 8 9 9 9 12 12 8 8 6 6 8 6 6 8 6 9 9 10 9 9 11 8 8 8 6 9 9 9 11 13 11 11 10 10 13 8 9 9 9 9 10 10 8 8 8 8 8 8 12 10 10 9 9 9 9 10 8 8 8 8 8 8 10 13 16 8 8 8 8 8 8 9 9 10 9 10 10 9 10 10 10 10 10 13 17 13 10 9 9 9 9 10 8 8 8 10 10 10 10 8 8 6 6 6 6 8 11 16 11 11 13 8 8 8 8 8 8 6 6 8 8 6 7 10 12 8 10 8 9 8 8 8 10 10 11 10 8 8 8 8 8 9 9 8 8 6 8 10 8 9 9 9 9 10 9 9 10 10 11 11 8 8 6 6 8 6 10 10 10 10 11 11 11 11 11 12 12 15 12 9 9 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 10 9 9 11 10 8 8 8 8 8 10 10 11 11 11 10 10 10 10 10 9 9 9 11 10 10 8 8 6 6 8 8 10 8 10 12 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 13 13 8 8 8 8 8 8 8 9 13 13 10 8 8 7 6 8 10 9 9 9 8 8 6 6 8 8 6 6 8 8 6 6 8 10 10 10 10 11 11 11 11 13 10 8 8 6 8 8 8 8 8 8 10 12 9 8 8 6 6 6 8 10 10 8 6 6 8 8 10 13 12 10 6 7 7 6 8 8 15 10 10 10 10 11 11 11 11 11 11 11 11 9 9 10 8 8 6 6 10 8 11 10 8 8 6 6 8 6 10 8 8 8 8 8 8 8 8 6 7 10 10 10 6 8 8 8 8 12 12 10 11 9 8 8 8 8 8 8 8 8 8 8 9 12 9 10 9 10 8 8 8 6 6 6 8 8 8 8 6 7 8 8 10 10 8 8 8 8 8 8 10 9 9 10 12 13 10 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 10 10 10 10 9 6 8 6 6 8 12 13 11 12 6 6 8 8 8 8 8 8 10 8 11 8 8 8 8 10 10 10 10 9 8 8 7 6 6 6 8 8 8 10 13 10 8 7 7 8 8 14 9 8 8 8 8 6 6 8 8 9 10 10 15 12 10 8 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 6 7 8 8 8 10 8 6 8 6 6 8 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no085_e13.g1 MSMg01no085_e13.g1 CHROMAT_FILE:
MSMg01no085_e13.g1 PHD_FILE: MSMg01no085_e13.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:35:51 2005
         (272 letters)



>mm_chr9_50639982_50640653
          Length = 672

 Score =  501 bits (259), Expect = e-146
 Identities = 268/271 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   gcaaacaaaacggaagtgcgtatgcgcagcgcccacaggtagagggtgtcacacaaagca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 gcaaacaaaacggaagtgcgtatgcgcagcgcccacaggtagagggtgtcacacaaagca 412

                                                                       
Query: 61  gtgcagagactttagaccatttccaaagctgcacacagaccccactcttcagaaggccaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 gtgcagagactttagaccatttccaaagctgcacacagaccccactcttcagaaggccaa 352

                                                                       
Query: 121 tgtcaactgcctggagaggcattcccaccaggctctggggctctgcactcaccactgagc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 tgtcaactgcctggagaggcattcccaccaggctctggggctctgcactcaccactgagc 292

                                                                       
Query: 181 cactggtttattccagcactctccttcacccctctcagggactcttagacgagatattac 240
           ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||
Sbjct: 291 cactggtttattccagcactctccttcactcctctcagggactcttagaggagatattac 232

                                          
Query: 241 atccatccacatgtcaagctactttatacaa 271
           ||||| |||||||||||||||||||||||||
Sbjct: 231 atccacccacatgtcaagctactttatacaa 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 272
Length of database: 672
Length adjustment: 9
Effective length of query: 263
Effective length of database: 663
Effective search space:   174369
Effective search space used:   174369
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information