MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-096K21
Chromosome	9 (Build37)
Map Location	57,961,805 - 57,962,071
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Sin3a, Man2c1, Neil1, Commd4, 1700041C23Rik, Trcg1, 1700017B05Rik, EG330948, Ppcdc, Scamp5, D9Wsu149, LOC620603, Rpp25, Cox5a, 2310046O06Rik, Mpi1, Scamp2, Ulk3, Cplx3, Lman1l, Csk, Cyp1a2, Cyp1a1, Edc3, Clk3, Arid3b, LOC665235, LOC677423, LOC100039509, Ubl7, Sema7a, Cyp11a1, 4930535E21Rik
Downstream gene	Stra6, Islr, Islr2, LOC665268, Pml, Stoml1, Loxl1, Tbc1d21, 6030419C18Rik, Cd276, Nptn, 2410076I21Rik, Hcn4, Neo1, LOC100040186
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sin3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20466 MGI:107157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73744 MGI:1920994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72774 MGI:1920024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Commd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66199 MGI:1913449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67319 MGI:1914569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs

name	Trcg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:541610 MGI:3576664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700017B05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74211 MGI:1921461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330948 MGI:3647258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1131 ESTs, 7 Proteins

name	Ppcdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66812 MGI:1914062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scamp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56807 MGI:1928948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D9Wsu149 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28014 MGI:107281
definition	gene_synonym : D9Wsu149e note : DNA segment, Chr 9, Wayne State University 149 pseudo : _no_value

name	LOC620603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 313 ESTs, 15 Proteins pseudo : _no_value

name	Rpp25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102614 MGI:2143151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12858 MGI:88474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310046O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78323 MGI:1925573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110119 MGI:97075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24044 MGI:1346518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ulk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71742 MGI:1918992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 29 ESTs, 4 Proteins

name	Cplx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235415 MGI:2384571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lman1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235416 MGI:2667537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12988 MGI:88537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13077 MGI:88589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13076 MGI:88588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353190 MGI:2142951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102414 MGI:1098670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56380 MGI:1930768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 10 Proteins pseudo : _no_value

name	LOC677423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100039509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ubl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69459 MGI:1916709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20361 MGI:1306826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp11a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13070 MGI:88582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930535E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382077 MGI:1922464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20897 MGI:107742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Islr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26968 MGI:1349645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Islr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320563 MGI:2444277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Pml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18854 MGI:104662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stoml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69106 MGI:1916356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16949 MGI:106096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74286 MGI:1921536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030419C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319477 MGI:2442108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102657 MGI:2183926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nptn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20320 MGI:108077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410076I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73673 MGI:1920923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein

name	Hcn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330953 MGI:1298209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18007 MGI:1097159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040186 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Sin3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106406 GeneID:20466 MGI:107157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional regulator, SIN3A (yeast) transcript_id : NM_011378.1

name	Man2c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130507 GeneID:73744 MGI:1920994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase, alpha, class 2C, member 1 transcript_id : NM_028636.2

name	Neil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130491 GeneID:72774 MGI:1920024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nei endonuclease VIII-like 1 (E. coli) transcript_id : NM_028347.2

name	Commd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803184 GeneID:66199 MGI:1913449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 4 transcript_id : NM_025417.2

name	1700041C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259989 GeneID:67319 MGI:1914569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs product : RIKEN cDNA 1700041C23 gene transcript_id : XM_001473583.1

name	Trcg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480099 GeneID:541610 MGI:3576664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor protein 1 transcript_id : NM_001014398.1

name	1700017B05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625982 GeneID:74211 MGI:1921461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700017B05 gene transcript_id : NM_028820.1

name	EG330948 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259991 GeneID:330948 MGI:3647258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1131 ESTs, 7 Proteins product : predicted gene, EG330948, transcript variant 1 transcript_id : XM_284504.6

name	Ppcdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725348 GeneID:66812 MGI:1914062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphopantothenoylcysteine decarboxylase transcript_id : NM_176831.4

name	Scamp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543673 GeneID:56807 MGI:1928948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 5 transcript_id : NM_020270.2

name	Rpp25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527203 GeneID:102614 MGI:2143151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease P 25 subunit (human) transcript_id : NM_133982.1

name	Cox5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181181 GeneID:12858 MGI:88474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit Va transcript_id : NM_007747.2

name	2310046O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370984 GeneID:78323 MGI:1925573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310046O06 gene transcript_id : NM_175273.3

name	Mpi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345292 GeneID:110119 MGI:97075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose phosphate isomerase 1 transcript_id : NM_025837.2

name	Scamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560286 GeneID:24044 MGI:1346518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 2 transcript_id : NM_022813.2

name	Ulk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386134 GeneID:71742 MGI:1918992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 29 ESTs, 4 Proteins product : unc-51-like kinase 3 (C. elegans), transcript variant 1 transcript_id : XM_620754.3

name	Cplx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542187 GeneID:235415 MGI:2384571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complexin 3 transcript_id : NM_146223.2

name	Lman1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351955 GeneID:235416 MGI:2667537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, mannose-binding 1 like transcript_id : NM_199222.2

name	Csk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560711 GeneID:12988 MGI:88537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-src tyrosine kinase transcript_id : NM_007783.2

name	Cyp1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803352 GeneID:13077 MGI:88589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 1, subfamily a, polypeptide 2 transcript_id : NM_009993.3

name	Cyp1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801730 GeneID:13076 MGI:88588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 1, subfamily a, polypeptide 1 transcript_id : NM_009992.3

name	Edc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386565 GeneID:353190 MGI:2142951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enhancer of mRNA decapping 3 homolog (S. cerevisiae) transcript_id : NM_153799.2

name	Clk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801904 GeneID:102414 MGI:1098670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC-like kinase 3 transcript_id : NM_007713.4

name	Arid3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130594 GeneID:56380 MGI:1930768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 3B (Bright like) transcript_id : NM_019689.2

name	Ubl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349643 GeneID:69459 MGI:1916709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 7 (bone marrow stromal cell-derived) transcript_id : NM_027086.2

name	Sema7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254572 GeneID:20361 MGI:1306826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A transcript_id : NM_011352.2

name	Cyp11a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358369 GeneID:13070 MGI:88582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 11, subfamily a, polypeptide 1 transcript_id : NM_019779.2

name	4930535E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370859 GeneID:382077 MGI:1922464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930535E21 gene transcript_id : NM_029212.2

name	Stra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678170 GeneID:20897 MGI:107742
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stimulated by retinoic acid gene 6 transcript_id : NM_009291.1

name	Islr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802019 GeneID:26968 MGI:1349645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily containing leucine-rich repeat transcript_id : NM_012043.3

name	Islr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793431 GeneID:320563 MGI:2444277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily containing leucine-rich repeat 2 transcript_id : NM_177193.4

name	LOC665268 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259985 GeneID:665268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Rpl17 protein transcript_id : XM_975751.2

name	Pml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227252 GeneID:18854 MGI:104662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : promyelocytic leukemia transcript_id : NM_178087.3

name	Pml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227241 GeneID:18854 MGI:104662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : promyelocytic leukemia transcript_id : NM_008884.3

name	Stoml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754034 GeneID:69106 MGI:1916356
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stomatin-like 1 transcript_id : NM_026942.2

name	Loxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45598389 GeneID:16949 MGI:106096
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysyl oxidase-like 1 transcript_id : NM_010729.2

name	Tbc1d21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375523 GeneID:74286 MGI:1921536
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 21 transcript_id : NM_028854.2

name	6030419C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379324 GeneID:319477 MGI:2442108
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030419C18 gene transcript_id : NM_176921.3

name	Cd276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362675 GeneID:102657 MGI:2183926
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD276 antigen transcript_id : NM_133983.3

name	Nptn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677896 GeneID:20320 MGI:108077
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroplastin transcript_id : NM_009145.1

name	2410076I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386142 GeneID:73673 MGI:1920923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein product : RIKEN cDNA 2410076I21 gene, transcript variant 1 transcript_id : XM_134948.5

name	Hcn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487124 GeneID:330953 MGI:1298209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyperpolarization-activated, cyclic nucleotide-gated K+ 4 transcript_id : NM_001081192.1

name	Neo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363083 GeneID:18007 MGI:1097159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neogenin transcript_id : NM_001042752.1

name	Neo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363081 GeneID:18007 MGI:1097159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neogenin transcript_id : NM_008684.2

name	Sin3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106407 CCDS:CCDS23216.1 GeneID:20466 MGI:107157
definition	GO_component : GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transcriptional regulator, SIN3 yeast homolog A product : transcriptional regulator, SIN3A protein_id : NP_035508.1

name	Man2c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794150 GeneID:73744 MGI:1920994
definition	GO_function : GO:0015923 - mannosidase activity [Evidence IEA] GO_process : GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : cytosolic alpha-D-mannosidase product : mannosidase, alpha, class 2C, member 1 protein_id : NP_082912.1

name	Neil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094129 CCDS:CCDS23217.1 GeneID:72774 MGI:1920024
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence IDA]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0016829 - lyase activity [Evidence IDA]; GO:0008534 - oxidized purine base lesion DNA N-glycosylase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : endonuclease VIII product : nei endonuclease VIII-like 1 protein_id : NP_082623.1

name	Commd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384806 GeneID:66199 MGI:1913449
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : COMM domain containing 4 protein_id : NP_079693.1

name	1700041C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259990 GeneID:67319 MGI:1914569
definition	codon_start : 1 product : hypothetical protein LOC67319 protein_id : XP_001473633.1

name	Trcg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480100 CCDS:CCDS23218.1 GeneID:541610 MGI:3576664
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : taste receptor protein 1 protein_id : NP_001014420.1

name	1700017B05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625983 CCDS:CCDS23219.1 GeneID:74211 MGI:1921461
definition	codon_start : 1 product : hypothetical protein LOC74211 protein_id : NP_083096.1

name	EG330948 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28491531 GeneID:330948 MGI:3647258
definition	codon_start : 1 product : similar to ribosomal protein S8 isoform 1 protein_id : XP_284504.1

name	Ppcdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849879 CCDS:CCDS23221.1 GeneID:66812 MGI:1914062
definition	GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004633 - phosphopantothenoylcysteine decarboxylase activity [Evidence IEA] GO_process : GO:0015937 - coenzyme A biosynthesis [Evidence IEA] codon_start : 1 product : phosphopantothenoylcysteine decarboxylase protein_id : NP_789801.1

name	Scamp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937988 GeneID:56807 MGI:1928948
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 5 protein_id : NP_064666.1

name	Rpp25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527204 CCDS:CCDS23222.1 GeneID:102614 MGI:2143151
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004526 - ribonuclease P activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : ribonuclease P 25kDa subunit protein_id : NP_598743.1

name	Cox5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181182 CCDS:CCDS23223.1 GeneID:12858 MGI:88474
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase, subunit Va protein_id : NP_031773.2

name	2310046O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424930 GeneID:78323 MGI:1925573
definition	codon_start : 1 product : hypothetical protein LOC78323 protein_id : NP_780482.1

name	Mpi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206392 GeneID:110119 MGI:97075
definition	EC_number : 5.3.1.8 GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004476 - mannose-6-phosphate isomerase activity [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IC] codon_start : 1 note : phosphomannose isomerase product : mannose phosphate isomerase 1 protein_id : NP_080113.1

name	Scamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12331398 CCDS:CCDS23224.1 GeneID:24044 MGI:1346518
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 2 protein_id : NP_073724.1

name	Ulk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386135 GeneID:71742 MGI:1918992
definition	codon_start : 1 product : unc-51-like kinase 3 isoform 1 protein_id : XP_620754.3

name	Cplx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122785 CCDS:CCDS23226.1 GeneID:235415 MGI:2384571
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005326 - neurotransmitter transporter activity [Evidence IMP]; GO:0000149 - SNARE binding [Evidence IDA]; GO:0019905 - syntaxin binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0046928 - regulation of neurotransmitter secretion [Evidence IDA]; GO:0016079 - synaptic vesicle exocytosis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : lectin, mannose-binding, 1 like product : complexin III protein_id : NP_666335.1

name	Lman1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363805 GeneID:235416 MGI:2667537
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : sublingual acinar membrane protein product : lectin, mannose-binding, 1 like protein_id : NP_954692.1

name	Csk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560712 CCDS:CCDS23228.1 GeneID:12988 MGI:88537
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IC] [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence TAS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] [Evidence TAS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] [Evidence TAS]; GO:0008285 - negative regulation of cell proliferation [Evidence IGI] [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS] [Evidence IEA]; GO:0050863 - regulation of T cell activation [Evidence TAS] codon_start : 1 product : c-src tyrosine kinase protein_id : NP_031809.2

name	Cyp1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753566 CCDS:CCDS23229.1 GeneID:13077 MGI:88589
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 1a2, aromatic compound inducible product : cytochrome P450, family 1, subfamily a, polypeptide 2 protein_id : NP_034123.1

name	Cyp1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753564 CCDS:CCDS23230.1 GeneID:13076 MGI:88588
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 1a1, aromatic compound inducible; cytochrome P450 subfamily I, polypeptide 1 product : cytochrome P450, family 1, subfamily a, polypeptide 1 protein_id : NP_034122.1

name	Edc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418913 CCDS:CCDS23231.1 GeneID:353190 MGI:2142951
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : enhancer of mRNA decapping 3 protein_id : NP_722494.1

name	Clk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745112 CCDS:CCDS23232.1 GeneID:102414 MGI:1098670
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : cdc2/CDC28-like protein kinase 3 product : CDC-like kinase 3 protein_id : NP_031739.3

name	Arid3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790033 CCDS:CCDS23233.1 GeneID:56380 MGI:1930768
definition	codon_start : 1 note : bright and dead ringer gene product homologous protein Bdp product : dead ringer homolog 2 protein_id : NP_062663.1

name	Ubl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312294 CCDS:CCDS23234.1 GeneID:69459 MGI:1916709
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin-like 7 (bone marrow stromal cell-derived) protein_id : NP_081362.1

name	Sema7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755466 CCDS:CCDS23235.1 GeneID:20361 MGI:1306826
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : H-Sema K1; Semaphorin K1 product : semaphorin 7A protein_id : NP_035482.1

name	Cyp11a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358370 GeneID:13070 MGI:88582
definition	EC_number : 1.14.15.6 GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008386 - cholesterol monooxygenase (side-chain-cleaving) activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 11a, cholesterol side-chain cleavage; cytochrome P450 side-chain cleavage enzyme; cholesterol side-chain cleavage enzyme; cholesterol desmolase; cholesterol side chain cleavage product : cytochrome P450, family 11, subfamily a, polypeptide 1 protein_id : NP_062753.2

name	4930535E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41581458 GeneID:382077 MGI:1922464
definition	codon_start : 1 note : speriolin-binding factor product : RIKEN cDNA 4930535E21 protein_id : NP_083488.1

name	Stra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678171 CCDS:CCDS23236.1 GeneID:20897 MGI:107742
definition	codon_start : 1 exception : mismatches in translation product : stimulated by retinoic acid gene 6 protein_id : NP_033317.1

name	Islr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754374 CCDS:CCDS23237.1 GeneID:26968 MGI:1349645
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : immunoglobulin superfamily containing leucine-rich repeat protein_id : NP_036173.1

name	Islr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119145 CCDS:CCDS23238.1 GeneID:320563 MGI:2444277
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : immunoglobulin superfamily containing leucine-rich repeat 2 protein_id : NP_796167.2

name	LOC665268 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259986 GeneID:665268
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980845.2

name	Pml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017403 CCDS:CCDS23239.1 GeneID:18854 MGI:104662
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030578 - PML body organization and biogenesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : promyelocytic leukemia isoform 2 protein_id : NP_835188.1

name	Pml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506979 CCDS:CCDS23240.1 GeneID:18854 MGI:104662
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030578 - PML body organization and biogenesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : promyelocytic leukemia isoform 1 protein_id : NP_032910.2

name	Stoml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754035 CCDS:CCDS23241.1 GeneID:69106 MGI:1916356
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : stomatin-like 1 protein_id : NP_081218.2

name	Loxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45598390 GeneID:16949 MGI:106096
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016641 - oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor [Evidence IDA]; GO:0004720 - protein-lysine 6-oxidase activity [Evidence IEA] codon_start : 1 note : lysyl oxidase-like product : lysyl oxidase-like 1 protein_id : NP_034859.2

name	Tbc1d21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249224 GeneID:74286 MGI:1921536
definition	codon_start : 1 product : TBC1 domain family, member 21 protein_id : NP_083130.1

name	6030419C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892717 CCDS:CCDS23243.1 GeneID:319477 MGI:2442108
definition	codon_start : 1 product : hypothetical protein LOC319477 protein_id : NP_795895.1

name	Cd276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527206 CCDS:CCDS23244.1 GeneID:102657 MGI:2183926
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005102 - receptor binding [Evidence IMP] [Evidence IDA] GO_process : GO:0050728 - negative regulation of inflammatory response [Evidence IMP]; GO:0045077 - negative regulation of interferon-gamma biosynthesis [Evidence IMP] [Evidence IDA]; GO:0045085 - negative regulation of interleukin-2 biosynthesis [Evidence IDA]; GO:0042130 - negative regulation of T cell proliferation [Evidence IDA] [Evidence IMP]; GO:0030501 - positive regulation of bone mineralization [Evidence IMP]; GO:0045669 - positive regulation of osteoblast differentiation [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP] codon_start : 1 note : B7 homlog 3 product : B7-H3 protein_id : NP_598744.1

name	Nptn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677897 CCDS:CCDS23245.1 GeneID:20320 MGI:108077
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0000299 - integral to membrane of membrane fraction [Evidence ISS]; GO:0045211 - postsynaptic membrane [Evidence ISS]; GO:0042734 - presynaptic membrane [Evidence ISS] GO_function : GO:0050839 - cell adhesion molecule binding [Evidence ISS] GO_process : GO:0007156 - homophilic cell adhesion [Evidence ISS]; GO:0048170 - positive regulation of long-term neuronal synaptic plasticity [Evidence ISS]; GO:0030155 - regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation product : stromal cell derived factor receptor 1 protein_id : NP_033171.1

name	2410076I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82930137 GeneID:73673 MGI:1920923
definition	codon_start : 1 product : hypothetical protein LOC73673 isoform 1 protein_id : XP_134948.4

name	Hcn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487125 GeneID:330953 MGI:1298209
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : hyperpolarization-activated, cyclic nucleotide-gated K+ 3 product : hyperpolarization-activated, cyclic nucleotide-gated K+ 4 protein_id : NP_001074661.1

name	Neo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363084 GeneID:18007 MGI:1097159
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0045296 - cadherin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007520 - myoblast fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : neogenin isoform 2 protein_id : NP_001036217.1

name	Neo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363082 CCDS:CCDS23246.1 GeneID:18007 MGI:1097159
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0045296 - cadherin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007520 - myoblast fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : neogenin isoform 1 protein_id : NP_032710.2

name	LOC677423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677423
definition	number : 1 pseudo : _no_value

name	LOC100039509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039509
definition	number : 1 pseudo : _no_value

name	LOC100039509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039509
definition	number : 2 pseudo : _no_value

name	LOC100040186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040186
definition	number : 2 pseudo : _no_value

name	LOC100040186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040186
definition	number : 1 pseudo : _no_value

name	LOC620603 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259993 GeneID:620603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 313 ESTs, 15 Proteins product : similar to Fatty acid binding protein 5, epidermal pseudo : _no_value transcript_id : XR_031387.1

name	LOC665235 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260000 GeneID:665235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 10 Proteins product : similar to hCG1642689 pseudo : _no_value transcript_id : XR_031650.1

clone name	MSMg01-540A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297J17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-539C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-418D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133D15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-096K21.T7 (MSMg01no096_k21.b1)	MSMg01-096K21.TJ (MSMg01no096_k21.g1)
ACC	AG313300	AG313301
length	739	786
length of high quality (start - end)	---	267 (133 - 399)
definition	CHROMAT_FILE: MSMg01no096_k21.b1 PHD_FILE: MSMg01no096_k21.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:53:07 2005	CHROMAT_FILE: MSMg01no096_k21.g1 PHD_FILE: MSMg01no096_k21.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:53:07 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CCCCCCTTCTNNTNCCTCTATAACCCTCTATCCTCGCCCGCGACTCAAAT TGGGCGCCAAAGACCACTCATTCGCACTGNNGGAANNNGGNGGTTGCGGC ACGGGGGANAGANNNGNNANNNNNNGAAGANGNNNAACNNANCNNCCCCA GAGCCAGAACNNAGAGNAGCCAGAGCCNNAGGAAAAACCNCAAAGGGCCC AAAACGGGACCANCNGGGGACAANNCNNAAGGACGCGGNGAAACCACACC NGGGGGGGGGCCGGCCCCTTGTTGACCAGGCCCCACCCAGGCGGCCANAA ACAGGGACACCCACCGAAGCGAACGAACGCCCCCTTTTTTTTTTCCACAA CANGACGGACGGACGAGGAAACAAGCCTGCCCCCCCACCCGGACCGCAAG ACCACAGGCAAGGCGAAGCACNACGACAAANNCGCCNCGGACAAAAGGGG ACAGGNAGACGAAAAGAGAAGAAACACGGGAAGAAAGAAAAAAGGACCCG GGGCCCGGAGACACCCACAGGAGGGGGAAAACAAAGGCACAAAGGCGGGG AGGCGGAGACACGCCCACCCCAAGGCGGAGGCCAAGGACCCCCCGACGAG GCGAAGGCCGGGCCGGGGGCGGCACAGCAGCACACACACCAAAGGGGGGA GCGAAGGCCCGCAACCACCAAAAGAGTTTTTTTTCTTTTAGGACTTTTGG CCGTGGAGATGCCCACCCTGCTTGGGAAGGATACCCCGC	CTTTTTTTTTATTNNCATTCCCTCTTATCTTACCTTCTCTACCNNCTTTA TATCNCNNCCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTTGCTCATAGTTCCGGG GGCCACCTTGGGGATTCCTGCGATTTTGAACCGTAATTTCCTCCCGCAAG ACCCTGCGGTCCAGGTTCCTGTGGAAGAGGGAGGAGGGTGTGATGAGATC GACCCCGCAGTACCTCTTCCAAACAATCATGGTTTTGTTTCATGGAAATG ATTCTGTTTCCCTGGAGCCTTTTAAAAGACGCTTTTAATTTTTTTTTATT TCTTCCATTTAAAACACCTTTTCATTTATTTATTTATTTTTGCCCCAGAG GAGCAGGAACAGAAAGAAAAAAAGATGATAGCTAACCACGCACTCACTAA ATGATAAGCACCTGGCTCGAAGCCTGTGGCTTCTAACTGTAGCTCTGGCA CTAAGAAGGTGGGGGCTTTTATTAACAAGTGGAGGATAACCAAGTGCCTA GGAGAGGGCGGAGTGCCTAGCTCACCTCCCCCCTCTGTCCCTACCCCTTG GTGGTAACCCTTTGCCTTTCCCTTTGGTCCCTCTCTCTCCCCACCCCCAT CCTGCCCTGTTTCTTCCTGCGTCCCGTTTCTGGCTTATAGCGGCCCGGCT CGCTCCTTTCGCCGTTCTCTGGTAACCTTTCTTCCTTCCTCTTTATTGCT GTCTTTTTTCCCCCTCCCTCTCCTGCCATGCCATAT
quality values	Open. Hide. 19 19 14 10 9 9 9 8 7 3 0 0 3 0 3 18 25 8 8 8 6 15 8 6 7 6 6 6 8 12 12 16 9 6 6 8 8 8 8 8 8 6 6 6 6 10 10 8 9 8 8 8 13 15 17 16 11 14 9 11 15 19 12 12 12 19 8 8 8 6 6 9 6 6 6 6 8 8 3 0 0 3 21 21 3 0 0 0 3 3 0 3 9 9 9 9 9 9 9 6 6 6 6 6 6 7 8 3 0 3 17 3 0 0 0 3 0 0 3 0 0 0 0 0 0 3 11 11 11 3 0 3 0 0 0 3 17 3 0 0 3 0 3 0 0 3 10 10 8 13 13 19 12 17 19 17 10 10 10 3 0 0 3 23 17 3 0 3 15 15 20 22 23 16 11 13 3 0 0 3 13 7 9 9 9 16 11 13 3 0 3 8 12 20 34 41 46 40 40 40 40 39 39 21 18 9 9 9 7 8 9 3 0 3 0 3 8 7 19 22 19 9 3 0 0 3 0 0 3 6 6 7 6 6 6 7 7 3 0 3 17 10 11 8 17 7 9 9 17 3 0 3 7 7 9 9 9 9 9 9 9 9 9 9 8 13 11 8 8 7 6 6 7 6 6 6 6 6 6 7 7 15 15 9 9 9 19 15 9 9 9 9 9 9 6 6 3 0 3 25 23 23 16 9 9 9 9 18 43 41 23 23 9 9 9 9 9 9 9 9 9 9 9 9 8 15 8 8 8 10 9 9 9 10 9 13 15 22 9 12 9 9 9 6 8 8 8 9 11 15 8 3 0 3 17 10 9 8 6 6 6 8 6 9 6 6 6 9 8 15 14 22 12 12 9 11 12 17 20 28 31 30 19 9 9 6 6 6 8 8 11 12 11 11 14 12 8 6 6 7 7 13 9 9 9 9 9 18 22 30 13 8 8 8 8 8 8 9 8 8 3 0 3 13 8 8 8 6 6 3 0 0 3 7 7 3 0 3 9 8 10 15 15 10 10 20 25 28 30 26 19 17 9 9 3 0 3 10 10 10 10 13 19 13 13 8 8 8 8 8 12 16 9 9 9 9 9 11 18 23 37 37 41 41 37 32 23 20 20 20 28 28 12 10 8 8 6 8 8 9 9 9 15 13 8 8 6 6 6 13 10 8 8 8 8 9 8 8 9 11 12 12 12 14 23 16 12 12 14 15 13 13 8 8 8 8 10 8 8 8 8 9 9 10 10 10 7 7 7 9 14 9 9 9 8 7 7 6 10 8 8 8 8 8 8 15 8 8 6 8 8 8 8 8 12 11 11 10 15 10 9 10 12 12 10 9 10 15 18 20 18 16 13 13 9 9 9 9 9 9 12 9 9 9 10 10 8 13 7 9 8 6 10 8 7 7 8 13 8 7 6 9 7 8 6 6 6 6 6 10 12 16 12 12 9 13 12 10 10 10 10 8 6 6 6 7 7 8 8 8 10 10 12 10 7 7 7 7 6 6 9 9 9 9 15 9 9 7 8 8 10 8 8 8 8 8 10 19 21 17 17 15 15 9 9 7 10 8 11 8 8 8 8 8 8 13 9 8 8 8 8 8 7 7 6 8 8 11 11 18 15 10 8 8 8 8 8 8 8 8 8 8 8 10 8 8 9 9 14 17 16 11 14 12 18 12 12 12 12	Open. Hide. 7 7 13 8 9 9 13 21 19 8 10 10 3 0 0 3 13 16 15 21 19 9 11 15 12 11 11 12 9 8 8 19 11 11 12 14 14 11 10 8 9 9 3 0 0 3 9 9 8 8 6 6 8 3 0 3 0 0 3 8 8 10 13 8 10 10 10 10 15 15 12 10 10 10 17 15 29 25 31 30 31 33 37 39 40 47 40 41 27 23 11 9 9 9 12 9 10 8 8 8 8 9 9 15 16 16 12 10 10 10 9 10 9 23 23 39 34 27 18 19 11 11 12 12 10 12 12 19 15 18 22 25 34 37 43 43 43 43 57 57 57 57 57 43 43 43 47 47 46 57 57 48 48 48 47 43 43 57 57 48 43 41 41 41 42 47 41 57 48 48 47 47 47 48 48 48 44 44 37 37 41 31 18 14 14 15 26 38 42 54 57 57 57 47 47 43 44 43 43 43 43 43 43 57 57 57 48 44 44 43 43 44 50 50 54 54 57 57 57 50 43 43 43 43 35 32 32 35 43 42 37 37 43 50 43 52 37 52 52 43 37 35 37 37 50 50 57 57 57 57 57 57 57 57 57 57 52 59 59 57 57 52 57 57 57 59 68 57 57 57 57 57 57 52 52 52 52 52 52 52 52 45 45 42 44 43 52 52 43 43 43 43 35 35 35 35 35 35 42 43 52 52 57 57 57 57 52 52 52 57 59 44 44 35 35 35 43 47 57 57 57 43 43 35 43 43 38 43 43 57 50 47 46 43 43 42 35 35 50 59 50 50 54 54 48 48 48 48 48 48 48 48 57 57 57 44 43 43 57 46 39 39 37 37 42 44 44 42 42 44 42 42 37 30 30 32 37 43 39 37 37 39 28 32 15 15 15 30 32 43 43 43 47 42 34 29 18 18 18 26 19 12 8 8 8 8 21 19 17 13 13 18 14 13 13 12 12 12 12 11 12 12 11 10 10 10 10 10 11 12 12 21 15 14 12 11 11 11 11 11 13 12 12 18 15 13 15 21 15 15 15 8 13 8 8 8 8 10 12 21 16 24 24 23 23 23 32 31 22 21 12 12 13 21 28 18 18 9 12 12 17 21 29 40 36 36 33 37 37 32 35 32 33 36 30 30 24 23 20 27 26 21 12 12 12 15 24 24 24 14 14 14 18 17 18 18 32 32 33 30 22 20 20 10 10 10 11 12 12 21 23 30 30 21 22 11 11 11 18 15 9 9 11 12 16 19 24 21 19 14 14 14 15 23 28 32 28 20 20 16 19 16 13 10 10 10 10 15 12 10 10 10 19 18 30 30 28 16 13 11 11 15 21 28 22 16 16 16 16 19 25 26 26 14 10 8 15 11 9 10 11 10 12 12 21 10 10 8 8 8 8 9 11 11 12 10 12 9 9 9 14 15 18 17 16 11 10 10 8 9 9 9 19 18 30 12 10 10 12 12 9 9 10 10 12 9 17 17 17 22 23 25 37 28 24 19 13 15 14 13 8 8 8 8 8 9 19 14 6 6 6 8 8 9 11 10 10 8 8 8 8 8 8 9 8 8 8 8 8 9 9 10 10 10 8 8 8 8 8 8 10 8 8 8 8 8 10 13 11 9 9 10 21 10 10 11 13 13 10 9 9 9 12 11 8 8 10 8 8 8 9 9 9 9 9 10 10 8 8 8 8 8 8 6 6 10 6 8 8 8 9 11 8 8 8 15 10 11 11 11 14 9 11 13 11 17 10 13 8 9 8 8 8 8 9 8 9 8 8 10 8 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no096_k21.g1 MSMg01no096_k21.g1 CHROMAT_FILE:
MSMg01no096_k21.g1 PHD_FILE: MSMg01no096_k21.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:53:07 2005
         (267 letters)



>mm_chr9_57961605_57962271
          Length = 667

 Score =  516 bits (267), Expect = e-151
 Identities = 267/267 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   cttgctcatagttccgggggccaccttggggattcctgcgattttgaaccgtaatttcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 467 cttgctcatagttccgggggccaccttggggattcctgcgattttgaaccgtaatttcct 408

                                                                       
Query: 61  cccgcaagaccctgcggtccaggttcctgtggaagagggaggagggtgtgatgagatcga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 cccgcaagaccctgcggtccaggttcctgtggaagagggaggagggtgtgatgagatcga 348

                                                                       
Query: 121 ccccgcagtacctcttccaaacaatcatggttttgtttcatggaaatgattctgtttccc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347 ccccgcagtacctcttccaaacaatcatggttttgtttcatggaaatgattctgtttccc 288

                                                                       
Query: 181 tggagccttttaaaagacgcttttaatttttttttatttcttccatttaaaacacctttt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287 tggagccttttaaaagacgcttttaatttttttttatttcttccatttaaaacacctttt 228

                                      
Query: 241 catttatttatttatttttgccccaga 267
           |||||||||||||||||||||||||||
Sbjct: 227 catttatttatttatttttgccccaga 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 267
Length of database: 667
Length adjustment: 9
Effective length of query: 258
Effective length of database: 658
Effective search space:   169764
Effective search space used:   169764
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information