MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-107E12
Chromosome	9 (Build37)
Map Location	54,945,095 - 54,945,334
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Cyp19a1, LOC100039064, Gldn, Dmxl2, 4933412E14Rik, Cib2, Idh3a, Acsbg1, LOC100039151, EG664850, Dnaja4, Wdr61, Crabp1, Rab7-ps1, Ireb2, C630028N24Rik, AY074887, Psma4, Chrna5, Chrna3, Chrnb4, EG640554, LOC664897
Downstream gene	1700071A11Rik, Ube2q2, Fbxo22, Nrg4, AI118078, Etfa, LOC546133, Isl2, Zfp291, LOC664980, 4930563M21Rik, LOC664995, LOC665005, Rcn2, Pstpip1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyp19a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13075 MGI:88587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039064 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Gldn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235379 MGI:2388361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235380 MGI:2444630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 2 Proteins

name	4933412E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244885 MGI:2441692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cib2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56506 MGI:1929293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Idh3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67834 MGI:1915084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acsbg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94180 MGI:2385656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039151 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs

name	EG664850 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664850 MGI:3643487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 111 ESTs, 5 Proteins pseudo : _no_value

name	Dnaja4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58233 MGI:1927638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66317 MGI:1917493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Crabp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12903 MGI:88490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab7-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19350 MGI:1276565
definition	note : RAB7, member RAS oncogene family, pseudogene 1 pseudo : _no_value

name	Ireb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64602 MGI:1928268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C630028N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235386 MGI:2443139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AY074887 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246735 MGI:3575512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psma4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26441 MGI:1347060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110835 MGI:87889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110834 MGI:87887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrnb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108015 MGI:87892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640554 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640554 MGI:3648923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC664897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	1700071A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76611 MGI:1923861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ube2q2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109161 MGI:2388672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71999 MGI:1926014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83961 MGI:1933833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI118078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244886 MGI:2142980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110842 MGI:106092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 133 ESTs, 23 Proteins pseudo : _no_value

name	Isl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104360 MGI:109156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp291 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244891 MGI:1925976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664980 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein pseudo : _no_value

name	4930563M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75258 MGI:1922508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC665005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins pseudo : _no_value

name	Rcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26611 MGI:1349765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pstpip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19200 MGI:1321396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp19a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373634 GeneID:13075 MGI:88587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 19, subfamily a, polypeptide 1 transcript_id : NM_007810.2

name	Gldn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366344 GeneID:235379 MGI:2388361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gliomedin transcript_id : NM_177350.3

name	Dmxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386111 GeneID:235380 MGI:2444630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 2 Proteins product : Dmx-like 2 transcript_id : XM_358382.5

name	4933412E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802668 GeneID:244885 MGI:2441692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933412E14 gene transcript_id : NM_173778.3

name	Cib2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364837 GeneID:56506 MGI:1929293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium and integrin binding family member 2 transcript_id : NM_019686.4

name	Idh3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560055 GeneID:67834 MGI:1915084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isocitrate dehydrogenase 3 (NAD+) alpha transcript_id : NM_029573.2

name	Acsbg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891660 GeneID:94180 MGI:2385656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase bubblegum family member 1 transcript_id : NM_053178.2

name	LOC100039151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259974 GeneID:100039151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : hypothetical protein LOC100039151 transcript_id : XM_001472234.1

name	Dnaja4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348312 GeneID:58233 MGI:1927638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily A, member 4 transcript_id : NM_021422.3

name	Wdr61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778818 GeneID:66317 MGI:1917493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 61 transcript_id : NM_023191.2

name	Wdr61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778823 GeneID:66317 MGI:1917493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 61 transcript_id : NM_001025376.1

name	Wdr61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778816 GeneID:66317 MGI:1917493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 61 transcript_id : NM_001025375.1

name	Crabp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891818 GeneID:12903 MGI:88490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular retinoic acid binding protein I transcript_id : NM_013496.2

name	Ireb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349648 GeneID:64602 MGI:1928268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iron responsive element binding protein 2 transcript_id : NM_022655.2

name	C630028N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345498 GeneID:235386 MGI:2443139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C630028N24 gene transcript_id : NM_177351.3

name	AY074887 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842406 GeneID:246735 MGI:3575512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY074887 transcript_id : NM_145229.2

name	Psma4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129984 GeneID:26441 MGI:1347060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, alpha type 4 transcript_id : NM_011966.3

name	Chrna5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559779 GeneID:110835 MGI:87889
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 5 transcript_id : NM_176844.3

name	Chrna3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778735 GeneID:110834 MGI:87887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 3 transcript_id : NM_145129.2

name	Chrnb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227209 GeneID:108015 MGI:87892
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 4 transcript_id : NM_148944.3

name	EG640554 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386114 GeneID:640554 MGI:3648923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640554 transcript_id : XM_973282.1

name	1700071A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386116 GeneID:76611 MGI:1923861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700071A11 gene transcript_id : XM_973359.1

name	Ube2q2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344098 GeneID:109161 MGI:2388672
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2Q (putative) 2 transcript_id : NM_180600.2

name	Fbxo22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948464 GeneID:71999 MGI:1926014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 22 transcript_id : NM_028049.2

name	Nrg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14030776 GeneID:83961 MGI:1933833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuregulin 4 transcript_id : NM_032002.1

name	AI118078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350526 GeneID:244886 MGI:2142980
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI118078 transcript_id : NM_172923.2

name	Etfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351839 GeneID:110842 MGI:106092
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : electron transferring flavoprotein, alpha polypeptide transcript_id : NM_145615.3

name	Isl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802238 GeneID:104360 MGI:109156
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin related protein 2 (islet 2) transcript_id : NM_027397.2

name	Zfp291 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486796 GeneID:244891 MGI:1925976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 291 transcript_id : NM_001081341.1

name	4930563M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147096 GeneID:75258 MGI:1922508
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930563M21 gene transcript_id : NM_183111.1

name	Rcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205427 GeneID:26611 MGI:1349765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulocalbin 2 transcript_id : NM_011992.2

name	Pstpip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469104 GeneID:19200 MGI:1321396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-serine-threonine phosphatase-interacting protein 1 transcript_id : NM_011193.1

name	Cyp19a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681099 CCDS:CCDS23187.1 GeneID:13075 MGI:88587
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 19, aromatase product : cytochrome P450, family 19, subfamily a, polypeptide 1 protein_id : NP_031836.1

name	Gldn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893493 CCDS:CCDS23189.1 GeneID:235379 MGI:2388361
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : olfactomedin-related protein; cancer related gene - liver 2; collomin product : gliomedin protein_id : NP_796324.1

name	Dmxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386112 GeneID:235380 MGI:2444630
definition	codon_start : 1 product : Dmx-like 2 protein_id : XP_358382.5

name	4933412E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424641 CCDS:CCDS23190.1 GeneID:244885 MGI:2441692
definition	codon_start : 1 product : hypothetical protein LOC244885 protein_id : NP_776139.1

name	Cib2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790085 GeneID:56506 MGI:1929293
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 note : calcium binding protein Kip 2; calcium binding protein Kip2 product : kinase interacting protein 2 protein_id : NP_062660.1

name	Idh3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18250284 CCDS:CCDS23191.1 GeneID:67834 MGI:1915084
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004449 - isocitrate dehydrogenase (NAD+) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016652 - oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 product : isocitrate dehydrogenase 3 (NAD+) alpha protein_id : NP_083849.1

name	Acsbg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716465 CCDS:CCDS23192.1 GeneID:94180 MGI:2385656
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence ISS] [Evidence IMP]; GO:0031957 - very-long-chain-fatty-acid-CoA ligase activity [Evidence ISS] GO_process : GO:0001676 - long-chain fatty acid metabolism [Evidence ISS] [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0042552 - myelination [Evidence ISS]; GO:0000038 - very-long-chain fatty acid metabolism [Evidence ISS] codon_start : 1 note : bubblegum; lipidosis-related protein lipidosin; gonadotropin-regulated long chain acyl CoA synthetase product : lipidosin protein_id : NP_444408.1

name	LOC100039151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259975 GeneID:100039151
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472284.1

name	Dnaja4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11496255 CCDS:CCDS23193.1 GeneID:58233 MGI:1927638
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : heat shock protein, DNAJ-like 4 protein_id : NP_067397.1

name	Wdr61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778817 CCDS:CCDS23194.1 GeneID:66317 MGI:1917493
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; meiotic recombination protein REC14 product : WD repeat domain 61 isoform a protein_id : NP_001020546.1

name	Wdr61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277350 CCDS:CCDS23194.1 GeneID:66317 MGI:1917493
definition	codon_start : 1 note : isoform a is encoded by transcript variant 2; meiotic recombination protein REC14 product : WD repeat domain 61 isoform a protein_id : NP_075680.1

name	Wdr61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778824 GeneID:66317 MGI:1917493
definition	codon_start : 1 note : isoform b is encoded by transcript variant 3; meiotic recombination protein REC14 product : WD repeat domain 61 isoform b protein_id : NP_001020547.1

name	Crabp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304975 CCDS:CCDS23195.1 GeneID:12903 MGI:88490
definition	GO_function : GO:0016918 - retinal binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence TAS] codon_start : 1 product : cellular retinoic acid binding protein I protein_id : NP_038524.1

name	Ireb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098149 CCDS:CCDS23196.1 GeneID:64602 MGI:1928268
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003994 - aconitate hydratase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030350 - iron-responsive element binding [Evidence IDA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0030371 - translation repressor activity [Evidence TAS] GO_process : GO:0006879 - iron ion homeostasis [Evidence IDA]; GO:0006445 - regulation of translation [Evidence TAS] codon_start : 1 exception : mismatches in translation product : iron responsive element binding protein 2 protein_id : NP_073146.1

name	C630028N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893487 CCDS:CCDS23197.1 GeneID:235386 MGI:2443139
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC235386 protein_id : NP_796325.1

name	AY074887 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644595 CCDS:CCDS23198.1 GeneID:246735 MGI:3575512
definition	codon_start : 1 product : cleft palate-related protein 1 protein_id : NP_660264.1

name	Psma4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755196 GeneID:26441 MGI:1347060
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, alpha type 4 protein_id : NP_036096.1

name	Chrna5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559780 GeneID:110835 MGI:87889
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nicotinic acetylcholine receptor alpha5 subunit product : cholinergic receptor, nicotinic, alpha polypeptide 5 protein_id : NP_789814.2

name	Chrna3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778736 CCDS:CCDS23199.1 GeneID:110834 MGI:87887
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : alpha 3; neuronal nicotinic acetylcholine receptor, alpha 3 subunit product : cholinergic receptor, nicotinic, alpha polypeptide 3 protein_id : NP_660111.2

name	Chrnb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563301 CCDS:CCDS23200.1 GeneID:108015 MGI:87892
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : nicotinic acetylcholine receptor beta4 subunit product : cholinergic receptor, nicotinic, beta polypeptide 4 protein_id : NP_683746.1

name	EG640554 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386115 GeneID:640554 MGI:3648923
definition	codon_start : 1 product : similar to eukaryotic translation initiation factor 3, subunit 12 protein_id : XP_978376.1

name	1700071A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386117 GeneID:76611 MGI:1923861
definition	codon_start : 1 product : hypothetical protein LOC76611 protein_id : XP_978453.1

name	Ube2q2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725841 CCDS:CCDS23201.1 GeneID:109161 MGI:2388672
definition	EC_number : 6.3.2.19 GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin-conjugating enzyme E2Q 2 protein_id : NP_850931.1

name	Fbxo22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948465 CCDS:CCDS23202.1 GeneID:71999 MGI:1926014
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 22 product : F-box protein 22 protein_id : NP_082325.2

name	Nrg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14030777 GeneID:83961 MGI:1933833
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : neuregulin 4 protein_id : NP_114391.1

name	AI118078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370422 CCDS:CCDS23203.1 GeneID:244886 MGI:2142980
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC244886 protein_id : NP_766511.1

name	Etfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981826 CCDS:CCDS23204.1 GeneID:110842 MGI:106092
definition	GO_component : GO:0017133 - electron transfer flavoprotein complex (sensu Eukaryota) [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence TAS]; GO:0050660 - FAD binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Alpha-ETF product : electron transferring flavoprotein, alpha polypeptide protein_id : NP_663590.2

name	Isl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386228 CCDS:CCDS23205.1 GeneID:104360 MGI:109156
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : insulin gene enhancer protein ISL-2; islet 2 product : insulin related protein 2 (islet 2) protein_id : NP_081673.1

name	Zfp291 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486797 GeneID:244891 MGI:1925976
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger protein 291 protein_id : NP_001074810.1

name	4930563M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147097 GeneID:75258 MGI:1922508
definition	GO_function : GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75258 protein_id : NP_898934.1

name	Rcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205428 CCDS:CCDS23206.1 GeneID:26611 MGI:1349765
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 note : taipoxin-associated calcium binding protein 49 product : reticulocalbin 2 protein_id : NP_036122.2

name	Pstpip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469105 GeneID:19200 MGI:1321396
definition	GO_component : GO:0005826 - contractile ring [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019903 - protein phosphatase binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0000910 - cytokinesis [Evidence IC] codon_start : 1 exception : mismatches in translation product : proline-serine-threonine phosphatase-interacting protein 1 protein_id : NP_035323.1

name	LOC100039064 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039064
definition	number : 1 pseudo : _no_value

name	LOC664897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664897
definition	number : 2 pseudo : _no_value

name	LOC664897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664897
definition	number : 1 pseudo : _no_value

name	LOC664995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664995
definition	number : 1 pseudo : _no_value

name	LOC664995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664995
definition	number : 2 pseudo : _no_value

name	EG664850 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94386113 GeneID:664850 MGI:3643487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 111 ESTs, 5 Proteins product : predicted gene, EG664850 pseudo : _no_value transcript_id : XR_001655.1

name	LOC546133 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259979 GeneID:546133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 133 ESTs, 23 Proteins product : similar to DnaJ (Hsp40) homolog, subfamily B, member 6 pseudo : _no_value transcript_id : XR_030911.1

name	LOC664980 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259982 GeneID:664980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : similar to XY body protein pseudo : _no_value transcript_id : XR_030988.1

name	LOC665005 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259976 GeneID:665005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : similar to XY body protein pseudo : _no_value transcript_id : XR_030731.1

clone name	MSMg01-360M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358L24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349P24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229I17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-107E12.T7 (MSMg01no107_e12.b1)	MSMg01-107E12.TJ (MSMg01no107_e12.g1)
ACC	AG321134	AG321135
length	1,329	1,702
length of high quality (start - end)	240 (141 - 380)	---
definition	CHROMAT_FILE: MSMg01no107_e12.b1 PHD_FILE: MSMg01no107_e12.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:08:56 2005	CHROMAT_FILE: MSMg01no107_e12.g1 PHD_FILE: MSMg01no107_e12.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:08:56 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CTTTTTTTNNNCCCCCATTGGGCGCTAAAGACTCCTATAGGGAGAGGATC CGCGGAATTCCCCATTTACCTTTGAACCCTTTTGGGTTCCATCAGATATA TCGTAGGGAAAGGACATGCCCCTTTAAAATCTCCCCTTATATAATCCAAG TCTGTCATTCAAAACAGAAAACCATCTCTATCCCATCGCTAACAGCTAAC TCCTCATCCTCCTCCTGACCCTTCACAAGGGAGTGTAAGAGGTTACTAAT GCTTGCCTAACTCTTGCGGAGCCTGTGGCTCTCCGACAGTGTCTACCTGC ACTTCTGCTCTGCTTCTGGTCAAAAGCCCTTGCTGTTTTGTTATTTGTGT GTGCTGCTTCAGTTTCTTCCATTCTTTAAGCTCATTACTGTGAACCTGAC AGAGGCCACTCTTTTTTTCCTCTCCAGAAAGATCTGCATCCCATTCTCAT CGCTCGGAAGGCCTTTTTTTTCCCCCCCCCACAGAATGTATGTCACCTCG TATAAAAAAGGGAGGTTACAGATACCTTGATGGGTCTATGTGACTAAATG ATCTTTTAAATATGAGAGTCTCACAGGATTGATGATTTCTTTGTGATACT TCACTGCTTTTTCTAGCTTTATTTGCCTACACTTTATTTTTCTCTGTTTT TGACTCGCTATTTAACTTCCTATGGTATCACTTTTCTTATTCCCACTTAC TTCTTGTTGTTGTCTCTACACTGCCCCCTTTTCATGTTGTTCTTGTTCTT TAAATCTTTTCTTTTTTTTTTTATTTTTTTCTCTCCCTCTTCCTTTATTT CTCTTTTTTATTAACCTCTTCCTCTTTTTTTCCTTATTCCTTTTTCTTTT ACCTATTTCATTTTTTTTTCTCTCTCTGCTATCCTGTTCTTCAGTCTCCT TTTTCTTCTCTTTTTCTTCTTTATTTTTTTCTGATTTCTTCTTTTTTCTT TTTCTTTTTTTTTTTCTACTTTTTGTCTTCTTATTATTTTATCATTTTTT CTCCTTCTTCATTTACTTCTTCATATTTTTATCCTTCTTATTTTTTTTTA TTATTTTCCCCTTTTTTTTTTTTTTTTTTATCCCCCCCCCCGCCCCCCCC TTTTATTCTTATTTATTTTCTTTTTCTTTTTTACCTATTCTCTACCCTTA TTTGTTCATCTTCATCTTTATTTCTTTTTACACTTCCTTCTATATATTTC ACTTTCTCATTCTCGCTCTCTCTTTCCTCCTTCTTACCACTTTCTCTTTA TTCCATCCCTTTACTTCTTCTCTCCTATTTACTGTATATTCTCTAATGCT CTTTCTCTCCTACTTATCTTCTCTATCAT	NCGAAGAAAAATNNNTTAGAAAGATAAGGTAGGCAGAGAGGCCCGCCTGA GACCTCTTACATATTAGAGTGTACACATATTATGAAGAGATAGAGAAGGG ACCCTCTTTAAAAAGTCAGCAAAATTGTTAAGATTCCCTTGGGGCGTGTN TAAAGCCCCTTATAAAGAGATTCTTCATTATAAGTAATTTCNATGAAAAG AATCTCCTTCTCCTTGTTGAATTAGCATGTAAATTATTAAAAGGTAAACA TAATCTCACAATGAATTCTGCAATATTATGAACATATACATTAATTCTAA TAGCTCAGGTGTATTTAGGAATGTCTGAATTCAGAATTTGTATTTCTAAT TAGAATTGAATATATGTACAAAATCCTAGTAAGTCTGTGATGCTCTTTCT ATGATAAGATTGGTAGATTATTAATATCACCTCATGTTAGTTATGATCGA ATAGTACTATGTATAATAATATTCTTTGATAATAAATAGTATGATTTGTA TACATAAATATGAGAGATATTAAAGTATAATGTATTTTTTTTGTTAAATA AGTTCACATAAAGACTCTGAATATGTAATTATAGGATTATAGTATACTTA TTTTTTTTTTCTTCCCCCCCCCCCCCAATTAGTATTTTTTATTCTTCTTT AAAAAAAAAAAGGGGGGGGGGTGTTTATTAATAATGTTATATTATAGTTA ATTATTATATATAATTGATTTGATATGATAAATAATAACTCATTCATTAG AATAAATTTAGTAATTAATAATATTAATGTACTTATAGAAAATAAAAATA TTGTATTAAATTTAAAAATACTTAAATCTTTCAGAAGGTAATCTATTAAA ACTGAAAATACATAATTATACTACTATTTCAAAATATGTAATAATTATAA TTTATTTTTTATAATATACTTATATATATTATAAAAAATTAAAATTTTAT TATAATTTAATAAAATAACTATAATATATATTAAATAAATATAATTTTGA TATATATATTTTTTAAAATTATATTAAGTTTAGTTATAATTTATATAATA TTTATCGGAAATTAAAAACACTATTTAATATTTTATTATAATATAAAATG TATATATTTTAAATATTTATATTTTAAATATTATAGAAATATATTACTAC AGAAATAATAAATTAATACAATATGAATATAATATCTATTTATATTTTAT TTTTCAATCAATAATTTTTAATGTTCTATATATTTCTGATCTATAATAAA TTATTTATAATTAATTTATTAAAATATATAAAATGGCATAATATTACTGT ATATGTAAGTATAATAATTAAAACTTTTATTGTGTTATATATTTTATATT ATATATTATATTGAAATTATATCAATTCTTATTTAATATAATAATAGAAA TAGTTGTATAAACTATTATATATAATATACATTATGATTATTAAATAATA AATTATATTAGTGATTACTATTATCATGTACTATTATTAAATAACTAATA TTATTTATTANTTATTATATTATATAAAGTTAAATATTAAGGATAATGAT ATTAAATCAAGAAGAATACATATAGCTATAACTATTAATTTATATTCACT TGTAACTAGGACATAATAGTGTTATTAAATTAACTAGTTTAATTAGTATG TAATAAATTAATACTTTTATTATATTATAAGTAATATTATATTACATATT TA
quality values	Open. Hide. 9 9 9 9 11 10 13 3 0 0 0 3 9 6 6 6 6 6 6 8 8 8 10 12 12 13 8 6 6 8 10 15 12 10 8 8 8 8 10 10 17 19 28 24 26 23 24 28 29 29 28 20 20 26 26 34 24 24 17 20 20 22 36 36 28 28 28 37 37 33 33 19 15 8 6 6 6 8 8 11 9 9 10 8 6 8 8 8 8 10 10 18 19 23 28 36 37 37 41 41 27 17 8 8 8 8 12 13 30 30 29 22 20 9 9 12 9 9 11 13 12 15 13 14 11 11 11 13 8 8 6 6 6 6 6 10 14 15 22 33 28 18 21 19 39 46 57 53 38 38 31 31 24 22 25 33 33 33 37 28 28 23 23 31 28 30 24 24 18 18 12 19 12 14 14 28 26 47 41 46 42 39 39 37 37 31 32 19 20 20 36 36 37 42 42 37 42 43 43 42 42 33 33 33 32 32 37 43 43 57 47 42 42 41 41 39 50 43 43 35 37 37 37 26 26 14 14 13 21 12 13 18 24 27 27 38 32 23 23 43 43 43 52 52 52 52 52 52 52 52 52 52 52 52 43 37 43 43 22 20 20 32 38 43 43 28 33 23 23 23 38 26 27 24 13 13 12 12 18 32 38 19 23 20 32 28 24 17 12 10 10 10 15 27 27 54 38 38 14 14 14 16 24 32 43 43 37 33 32 43 43 32 35 35 43 43 43 43 19 19 19 19 27 36 43 41 41 21 41 32 43 33 35 35 29 28 37 37 36 37 35 35 37 42 44 42 37 35 33 24 22 17 17 30 34 32 39 32 37 32 37 35 37 42 44 46 43 41 41 41 30 27 27 24 28 28 28 19 17 17 15 21 19 13 11 11 15 18 15 13 12 23 19 25 25 22 21 23 15 15 13 13 12 15 12 15 13 20 20 18 18 17 12 9 12 10 8 8 8 10 11 19 15 23 15 15 13 13 13 18 26 28 35 35 26 28 12 12 11 19 15 14 14 18 23 28 30 25 23 24 21 17 19 17 26 16 13 11 11 11 16 11 11 12 12 12 22 19 18 17 12 13 9 10 11 15 15 13 11 11 9 11 11 12 11 13 10 11 9 8 10 8 8 8 8 8 8 8 8 8 6 6 8 8 19 13 10 10 10 10 11 11 11 10 10 10 10 13 10 10 10 10 10 10 10 16 22 15 12 8 8 8 8 8 11 11 11 10 8 10 8 8 8 8 9 12 12 12 15 21 15 15 14 14 17 26 19 13 9 9 9 9 12 13 11 10 8 8 8 10 10 8 10 10 12 8 8 8 8 8 8 12 12 10 10 12 17 11 10 15 15 13 13 12 12 12 12 12 15 15 13 10 9 10 10 10 10 10 17 17 15 10 10 9 9 9 9 9 12 10 10 10 10 8 8 8 8 8 9 8 8 8 8 8 8 9 12 16 9 9 9 9 10 10 10 10 9 8 8 15 12 10 8 9 8 8 6 6 8 8 8 8 8 8 8 8 10 10 8 8 6 6 6 6 8 8 8 8 11 10 10 10 8 8 8 6 6 8 8 8 8 8 6 6 8 8 8 10 10 10 9 9 12 10 12 10 10 9 12 8 8 8 8 8 10 9 8 8 8 8 8 12 10 9 9 8 12 10 12 10 12 10 9 11 13 13 19 12 12 11 12 11 11 11 11 11 11 11 11 11 13 8 12 10 10 10 10 8 8 8 8 12 15 18 24 18 17 11 10 10 11 11 12 16 19 13 10 10 8 8 6 6 8 8 9 9 8 8 6 6 6 6 10 10 8 9 9 8 8 8 10 10 10 13 15 13 11 11 10 8 8 10 12 11 10 10 12 10 10 11 11 8 8 8 8 10 8 10 8 10 8 8 8 8 9 9 9 8 8 8 8 8 9 8 8 8 8 11 11 9 9 9 9 10 10 8 8 8 8 8 10 10 11 12 10 9 9 9 11 8 8 8 8 8 8 8 6 6 8 8 9 8 8 7 6 8 8 10 8 8 8 10 8 6 7 10 10 8 12 12 18 10 8 8 6 6 8 6 6 8 8 10 12 12 9 9 8 8 8 9 8 8 6 6 8 8 9 9 10 10 10 8 8 8 8 10 8 9 10 10 10 10 17 19 28 24 23 28 24 28 29 29 14 14 16 19 12 12 12 12 12 15 18 8 8 8 8 8 8 10 8 10 10 8 8 9 8 8 10 10 8 8 10 10 10 10 9 8 8 15 8 8 8 8 8 9 10 10 10 6 6 8 8 8 8 10 8 10 10 10 10 8 8 8 8 6 6 8 8 8 8 8 6 6 8 8 9 9 12 15 17 10 10 6 6 8 8 8 10 8 8 11 13 20 23 12 10 10 6 6 8 10 10 10 12 14 27 25 25 25 21 21 18 31 37 37 19 12 11 11 11 18 23 23 21 20 16 17 7 6 6 7 7 25 22 30 32 30 19 15 6 6 6 8 9 19 16 19 12 11 13 10 10 11 6 8 7 7 11 11 7 7 6 8 11 12 12 8 8 8 6 6 8 10 6 6 8 10 10 10 10 12 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 11 8 11 11 11 9 9 8 8 8 8 11 11 11 11 12 8 8 8 8 8 8 8 8 12 8 8 8 6 6 10 10 10 8 8 9 9 13 8 8 8 8 8 8 8 10 9 11 8 8 8 8 8 8 9 8 8 6 6 8 8 6 6 8 6 6 6 6 8 6 7 8 6 8 8 8 6 6 8 8 8 8 8 8 8 10 10 10 10 10 13 13 10 10 10 10 8 9 9 9 9 9 9 10 9 8 8 8 10 8 8 9 10 10 8 7 6 8 8 8 8 8 8 10 12 16 13 19 11 9 9 8 8 6 6 8 8 9 9 8 8 8 8 8 8 6 6 8 8 8 8 9 9 10 10 12 14 13 10 8 8 8 8 10 9 9 9 9 17 12 9 8 8 6 6 8 8 6	Open. Hide. 0 3 7 8 8 8 8 8 8 10 12 3 0 0 0 3 8 8 9 9 11 6 6 6 6 6 6 8 8 8 8 8 8 10 10 8 6 6 6 6 6 8 8 8 10 6 6 6 6 6 8 8 9 7 8 19 19 18 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 15 15 18 19 16 14 12 15 8 9 6 15 13 10 7 6 10 8 8 8 8 8 6 8 8 8 8 8 13 12 14 9 9 9 11 11 10 14 10 8 7 8 8 8 10 10 11 18 15 20 20 15 15 8 8 6 6 8 8 12 12 16 12 10 15 13 9 8 8 6 8 8 8 8 9 3 0 3 10 10 10 9 9 9 9 9 10 13 9 9 8 11 9 9 7 8 10 10 8 8 8 9 8 10 8 8 8 7 7 6 6 6 11 10 16 11 10 3 0 3 8 6 6 8 10 8 8 10 8 8 8 8 8 8 8 10 8 8 11 8 8 8 7 7 9 9 15 17 22 10 8 6 6 10 10 8 9 13 14 6 6 8 7 8 10 15 12 10 8 13 11 14 14 15 13 10 10 15 19 13 10 8 10 8 8 9 10 10 11 10 10 6 6 8 8 10 11 8 8 7 8 9 9 15 19 16 9 9 9 10 8 10 10 15 12 13 10 10 10 10 16 18 8 10 8 8 8 15 7 6 8 8 10 10 13 15 10 8 8 7 7 10 8 8 8 10 10 8 6 6 8 6 8 10 10 10 8 8 9 6 6 6 6 6 10 8 8 8 15 12 10 10 9 9 9 10 10 9 9 8 8 6 6 8 8 11 11 11 14 14 12 10 8 8 8 8 8 8 8 10 10 8 8 8 8 8 11 12 10 6 6 8 8 8 6 6 6 6 8 8 11 12 8 8 6 6 6 6 6 8 8 8 8 8 8 8 8 8 9 8 8 8 8 8 8 6 7 8 8 10 9 9 9 10 10 8 8 8 8 8 8 12 10 8 8 8 8 10 8 8 8 11 8 6 6 6 8 8 8 12 13 10 10 10 8 8 6 6 8 8 8 8 10 8 8 6 7 8 10 10 10 13 10 9 9 9 8 10 15 10 10 8 8 6 6 8 6 7 10 9 9 12 12 9 12 8 8 6 6 8 6 6 8 8 10 8 8 8 8 6 6 6 6 8 8 8 8 8 8 10 12 12 12 9 9 9 8 8 6 6 8 6 10 17 15 12 8 8 6 6 6 8 9 9 9 10 9 12 13 10 8 8 8 8 8 8 8 8 11 12 11 12 12 8 8 6 6 8 8 8 8 8 6 10 8 9 13 12 8 8 8 8 8 8 8 8 8 8 8 8 6 8 8 8 8 8 13 8 8 11 15 19 24 27 19 17 11 8 6 6 7 13 15 21 23 12 10 10 10 9 10 12 10 10 10 10 10 12 7 6 10 8 8 8 11 8 8 8 8 9 7 8 8 6 6 8 8 9 12 19 33 22 18 11 11 10 15 10 12 12 15 20 19 19 16 8 8 12 8 8 8 8 6 8 8 8 8 8 12 10 10 11 12 8 8 8 8 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 9 9 9 10 11 13 11 12 10 8 8 6 6 8 8 8 8 10 8 8 8 17 11 10 10 10 10 12 10 9 9 10 9 9 8 8 10 10 10 10 12 11 11 8 8 8 8 8 10 10 9 10 10 11 11 11 9 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 9 10 10 9 9 8 8 6 6 8 8 9 8 8 13 13 13 10 8 8 8 8 7 7 8 8 8 8 6 6 8 6 8 8 10 6 7 7 9 9 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 11 12 12 9 10 9 9 9 8 8 8 8 8 8 9 8 8 6 6 8 8 8 8 6 8 8 8 8 8 8 8 8 10 10 10 10 10 10 9 9 10 8 8 6 6 8 12 12 11 10 9 10 9 11 11 16 13 11 9 9 8 8 8 10 10 8 8 8 8 10 10 8 9 8 8 10 10 13 8 8 10 8 8 6 7 6 8 8 8 10 10 10 11 11 11 11 10 8 8 10 10 12 8 8 8 8 8 8 8 8 8 8 8 10 10 8 10 10 10 10 9 11 9 9 9 9 9 10 8 11 11 8 8 8 8 8 8 8 10 10 14 13 12 10 8 8 6 6 8 8 8 6 6 8 6 8 8 6 6 8 10 8 8 12 10 12 8 8 8 10 6 6 8 8 8 8 8 8 8 9 8 8 8 8 9 9 8 8 6 6 7 7 9 9 12 10 11 8 8 8 8 8 11 12 15 11 19 11 11 10 10 8 8 6 7 8 8 8 8 8 8 8 8 8 11 11 16 16 11 11 11 13 10 11 8 11 7 7 8 8 8 8 8 8 10 13 8 8 9 9 11 10 8 8 6 6 10 6 6 8 8 8 7 7 8 8 10 10 8 8 8 8 8 7 8 8 10 10 10 8 8 6 6 8 8 10 8 8 8 8 8 8 8 8 10 8 8 10 8 8 8 6 6 6 6 6 8 7 7 10 8 8 8 9 9 9 8 10 10 8 8 8 7 8 8 8 10 10 10 16 11 8 8 8 6 6 8 8 9 10 10 12 11 8 8 8 8 8 10 10 10 10 10 11 8 7 7 8 8 10 8 8 8 16 12 11 11 12 9 8 8 6 6 6 6 9 10 6 6 6 6 7 7 8 8 8 8 8 8 8 8 9 9 7 8 11 10 10 8 8 9 10 11 14 10 10 8 8 8 11 8 9 9 8 8 10 6 6 8 8 8 8 8 12 10 8 6 6 6 6 8 10 8 10 10 12 9 9 8 8 8 6 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 7 6 8 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 8 8 12 12 8 8 6 6 8 8 8 8 8 8 8 8 8 9 11 13 13 10 7 7 7 10 10 13 10 10 10 10 10 7 6 8 8 8 8 12 12 13 12 13 13 10 12 12 12 8 8 6 6 8 8 8 10 8 8 8 12 10 10 10 12 15 12 11 11 10 10 10 10 10 10 9 9 9 7 8 8 10 8 10 10 9 9 10 11 8 8 8 8 8 8 8 8 8 8 10 10 7 6 6 6 9 9 9 11 11 11 13 11 8 8 7 7 10 10 6 6 8 10 10 12 8 9 9 9 11 10 12 8 8 8 8 10 10 10 13 13 11 11 11 17 11 11 10 9 9 9 8 8 8 6 6 6 6 8 8 8 8 10 8 8 10 8 8 6 6 7 10 10 8 8 8 8 10 10 10 9 12 12 3 0 3 8 6 7 9 9 12 8 12 8 8 8 10 8 8 8 8 8 9 10 10 11 11 12 8 8 8 8 8 8 8 8 8 6 8 8 6 6 6 8 10 10 13 15 17 10 8 8 8 6 6 8 8 8 11 8 6 6 6 8 8 8 9 9 9 8 8 6 6 8 8 8 10 8 8 8 6 7 8 8 9 9 9 9 9 8 8 8 8 8 8 8 10 8 8 8 8 8 6 6 6 6 7 10 10 10 8 6 6 8 8 12 8 8 8 8 10 8 9 9 8 10 10 10 8 8 8 8 7 7 10 8 9 6 6 6 6 6 6 6 10 6 7 7 7 10 8 8 8 10 8 8 6 6 6 6 8 7 6 8 8 11 8 8 8 8 8 8 8 8 8 10 10 10 10 10 10 16 11 11 13 8 8 8 8 8 8 6 6 10 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no107_e12.b1 MSMg01no107_e12.b1 CHROMAT_FILE:
MSMg01no107_e12.b1 PHD_FILE: MSMg01no107_e12.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:08:56 2005
         (240 letters)



>mm_chr9_54944895_54945534
          Length = 640

 Score =  441 bits (228), Expect = e-128
 Identities = 237/240 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   ataatccaagtctgtcattcaaaacagaaaaccatctctatcccatcgctaacagctaac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 ataatccaagtctgtcattcaaaacagaaaaccatctctatcccatcgctaacagctaac 381

                                                                       
Query: 61  tcctcatcctcctcctgacccttcacaagggagtgtaagaggttactaatgcttgcctaa 120
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 380 tcctcatcctcctcctgacccttcacaagggagtgtaataggttactaatgcttgcctaa 321

                                                                       
Query: 121 ctcttgcggagcctgtggctctccgacagtgtctacctgcacttctgctctgcttctggt 180
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 320 ctcttgcggagcctgtggctctccgacagtgtctacctgcacttccgctctgcttctggg 261

                                                                       
Query: 181 caaaagcccttgctgttttgttatttgtgtgtgctgcttcagtttcttccattctttaag 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 caaaagcccttgctgttttgttatttgtgtgtgctgcttcagtttcttccattctttaag 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 240
Length of database: 640
Length adjustment: 9
Effective length of query: 231
Effective length of database: 631
Effective search space:   145761
Effective search space used:   145761
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information