MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-313L12
Chromosome	9 (Build37)
Map Location	106,295,712 - 106,296,080
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Nek11, Aste1, Atp2c1, EG434434, LOC664981, Pik3r4, E330026B02Rik, EG665033, 1110001D15Rik, LOC669311, 6230410P16Rik, Wdr82, Ppm1m, Twf2, Tlr9, Alas1, Wdr51a, Dusp7
Downstream gene	Rpl29, Acy1, Abhd14a, Abhd14b, Pcbp4, Parp3, Rrp9, Iqcf1, Iqcf5, Iqcf3, Iqcf4, LOC100041096, Grm2, Tex264, Rad54l2, LOC100041128, Vprbp, Armet, Dock3, Mapkapk3, Cish, Hemk1, 6430571L13Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nek11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208583 MGI:2442276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aste1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66595 MGI:1913845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235574 MGI:1889008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434434 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434434 MGI:3646701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1414 ESTs, 9 Proteins

name	LOC664981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	Pik3r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75669 MGI:1922919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330026B02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245026 MGI:2444259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665033 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665033 MGI:3648134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins pseudo : _no_value

name	1110001D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68553 MGI:1915803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	6230410P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wdr82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77305 MGI:1924555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 226 ESTs, 4 Proteins

name	Ppm1m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67905 MGI:1915155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Twf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23999 MGI:1346078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81897 MGI:1932389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alas1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11655 MGI:87989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr51a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70235 MGI:1917485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235584 MGI:2387100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19944 MGI:99687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109652 MGI:87913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68644 MGI:1915894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd14b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76491 MGI:1923741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59092 MGI:1890471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235587 MGI:1891258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27966 MGI:2384313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74267 MGI:1921517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 6 Proteins

name	Iqcf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75470 MGI:1922720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein

name	Iqcf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68265 MGI:1915515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67320 MGI:1914570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Grm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108068 MGI:1351339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 7 Proteins

name	Tex264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21767 MGI:1096570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rad54l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81000 MGI:1933196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Vprbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321006 MGI:2445220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armet (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74840 MGI:1922090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dock3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208869 MGI:2429763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102626 MGI:2143163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cish (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12700 MGI:103159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hemk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69536 MGI:1916786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430571L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235599 MGI:2445137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363104 GeneID:208583 MGI:2442276
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 11 transcript_id : NM_172461.2

name	Aste1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381893 GeneID:66595 MGI:1913845
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asteroid homolog 1 (Drosophila) transcript_id : NM_025651.3

name	Atp2c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33186871 GeneID:235574 MGI:1889008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++-sequestering transcript_id : NM_175025.2

name	EG434434 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260314 GeneID:434434 MGI:3646701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1414 ESTs, 9 Proteins product : predicted gene, EG434434, transcript variant 2 transcript_id : XM_889722.3

name	Pik3r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486788 GeneID:75669 MGI:1922919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 transcript_id : NM_001081309.1

name	E330026B02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353746 GeneID:245026 MGI:2444259
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330026B02 gene transcript_id : NM_172927.2

name	1110001D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286815 GeneID:68553 MGI:1915803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110001D15 gene transcript_id : NM_026763.1

name	6230410P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759351 GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230410P16 gene transcript_id : NM_001039586.1

name	6230410P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759353 GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230410P16 gene transcript_id : NM_174846.4

name	Wdr82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386558 GeneID:77305 MGI:1924555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 226 ESTs, 4 Proteins product : WD repeat domain containing 82, transcript variant 1 transcript_id : XM_135109.7

name	Ppm1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801846 GeneID:67905 MGI:1915155
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1M transcript_id : NM_198931.2

name	Ppm1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802086 GeneID:67905 MGI:1915155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1M transcript_id : NM_026447.3

name	Twf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891654 GeneID:23999 MGI:1346078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : twinfilin, actin-binding protein, homolog 2 (Drosophila) transcript_id : NM_011876.3

name	Tlr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13626029 GeneID:81897 MGI:1932389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 9 transcript_id : NM_031178.1

name	Alas1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956101 GeneID:11655 MGI:87989
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinic acid synthase 1 transcript_id : NM_020559.1

name	Wdr51a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037200 GeneID:70235 MGI:1917485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 51A transcript_id : NM_027354.1

name	Dusp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385539 GeneID:235584 MGI:2387100
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 7 transcript_id : NM_153459.3

name	Rpl29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982039 GeneID:19944 MGI:99687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L29 transcript_id : NM_009082.2

name	Acy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802669 GeneID:109652 MGI:87913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminoacylase 1 transcript_id : NM_025371.2

name	Abhd14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095336 GeneID:68644 MGI:1915894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 14A transcript_id : NM_145919.1

name	Abhd14b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753959 GeneID:76491 MGI:1923741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 14b transcript_id : NM_029631.2

name	Pcbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386736 GeneID:59092 MGI:1890471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 4 transcript_id : NM_021567.3

name	Parp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25014094 GeneID:235587 MGI:1891258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 3 transcript_id : NM_145619.2

name	Rrp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893319 GeneID:27966 MGI:2384313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RRP9, small subunit (SSU) processome component, homolog (yeast) transcript_id : NM_145620.4

name	Iqcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386562 GeneID:74267 MGI:1921517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : IQ motif containing F1, transcript variant 1 transcript_id : XM_486254.3

name	Iqcf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260315 GeneID:75470 MGI:1922720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein product : IQ motif containing F5 transcript_id : XM_356185.4

name	Iqcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354675 GeneID:68265 MGI:1915515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing F3 transcript_id : NM_026645.3

name	Iqcf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020726 GeneID:67320 MGI:1914570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing F4 transcript_id : NM_026090.2

name	LOC100041096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260300 GeneID:100041096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to hCG1789065 transcript_id : XM_001475797.1

name	Grm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260303 GeneID:108068 MGI:1351339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 7 Proteins product : G protein-coupled receptor, family C, group 1, member B transcript_id : XM_001475814.1

name	Tex264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090462 GeneID:21767 MGI:1096570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 264 transcript_id : NM_001081654.1

name	Tex264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090849 GeneID:21767 MGI:1096570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 264 transcript_id : NM_011573.2

name	Rad54l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090611 GeneID:81000 MGI:1933196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rad54 like 2 (S. cerevisiae) transcript_id : NM_030730.2

name	LOC100041128 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260305 GeneID:100041128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : XM_001475846.1

name	Vprbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82617568 GeneID:321006 MGI:2445220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vpr (HIV-1) binding protein transcript_id : NM_001015507.1

name	Armet (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365315 GeneID:74840 MGI:1922090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine-rich, mutated in early stage tumors transcript_id : NM_029103.3

name	Dock3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510296 GeneID:208869 MGI:2429763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dedicator of cyto-kinesis 3 transcript_id : NM_153413.1

name	Mapkapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388197 GeneID:102626 MGI:2143163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase-activated protein kinase 3 transcript_id : NM_178907.2

name	Cish (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129844 GeneID:12700 MGI:103159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine inducible SH2-containing protein transcript_id : NM_009895.3

name	Hemk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539656 GeneID:69536 MGI:1916786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HemK methyltransferase family member 1 transcript_id : NM_133984.1

name	6430571L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368001 GeneID:235599 MGI:2445137
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430571L13 gene transcript_id : NM_175486.2

name	Aste1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560235 CCDS:CCDS23465.1 GeneID:66595 MGI:1913845
definition	codon_start : 1 product : asteroid homolog 1 protein_id : NP_079927.2

name	Atp2c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33186872 GeneID:235574 MGI:1889008
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence TAS] [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0045045 - secretory pathway [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATPase, Ca++ transporting, type 2C, member 1 product : calcium-transporting ATPase 2C1 protein_id : NP_778190.2

name	EG434434 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82931053 GeneID:434434 MGI:3646701
definition	codon_start : 1 product : similar to QM protein isoform 2 protein_id : XP_894815.1

name	Pik3r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486789 GeneID:75669 MGI:1922919
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 protein_id : NP_001074778.1

name	E330026B02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370430 CCDS:CCDS23468.1 GeneID:245026 MGI:2444259
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245026 protein_id : NP_766515.1

name	1110001D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286816 GeneID:68553 MGI:1915803
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : collagen type VI alpha 4 protein_id : NP_081039.1

name	6230410P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759352 CCDS:CCDS23469.1 GeneID:235582 MGI:2444085
definition	codon_start : 1 product : CG9886-like protein_id : NP_001034675.1

name	6230410P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759354 CCDS:CCDS23469.1 GeneID:235582 MGI:2444085
definition	codon_start : 1 product : CG9886-like protein_id : NP_777271.3

name	Wdr82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765108 GeneID:77305 MGI:1924555
definition	codon_start : 1 product : WD repeat domain containing 82 isoform 1 protein_id : XP_135109.3

name	Ppm1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39573724 CCDS:CCDS23471.1 GeneID:67905 MGI:1915155
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008420 - CTD phosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; protein phosphatase 2C eta product : protein phosphatase 2C eta isoform 2 protein_id : NP_945149.1

name	Ppm1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980930 CCDS:CCDS23472.1 GeneID:67905 MGI:1915155
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008420 - CTD phosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; protein phosphatase 2C eta product : protein phosphatase 2C eta isoform 1 protein_id : NP_080723.2

name	Twf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755224 CCDS:CCDS23473.1 GeneID:23999 MGI:1346078
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 note : twinfilin-2; protein tyrosine kinase 9 related protein; PTK9 protein typrotein tyrosine kinase 9-like (A6-related protein); protein tyrosine kinase 9-like (A6-related protein) product : twinfilin-like protein protein_id : NP_036006.1

name	Tlr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626030 GeneID:81897 MGI:1932389
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0035197 - siRNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045356 - positive regulation of interferon-alpha biosynthesis [Evidence ISS]; GO:0045359 - positive regulation of interferon-beta biosynthesis [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence ISS]; GO:0009615 - response to virus [Evidence IMP] codon_start : 1 exception : mismatches in translation product : toll-like receptor 9 protein_id : NP_112455.1

name	Alas1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956102 GeneID:11655 MGI:87989
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003870 - 5-aminolevulinate synthase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006783 - heme biosynthesis [Evidence IEA] codon_start : 1 note : aminolevulinate synthase H; 5-aminolevulinate synthase; succinyl-CoA: glycine C-succinyl transferase product : aminolevulinic acid synthase 1 protein_id : NP_065584.1

name	Wdr51a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037201 CCDS:CCDS23474.1 GeneID:70235 MGI:1917485
definition	codon_start : 1 exception : mismatches in translation product : WD repeat domain 51A protein_id : NP_081630.1

name	Dusp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816911 CCDS:CCDS23475.1 GeneID:235584 MGI:2387100
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dual specificity phosphatase 7 protein_id : NP_703189.2

name	Rpl29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677781 CCDS:CCDS23476.1 GeneID:19944 MGI:99687
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L29 protein_id : NP_033108.1

name	Acy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384746 CCDS:CCDS23477.1 GeneID:109652 MGI:87913
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004046 - aminoacylase activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA] codon_start : 1 product : aminoacylase 1 protein_id : NP_079647.1

name	Abhd14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095337 GeneID:68644 MGI:1915894
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : down-regulated in Zic1 deficient cerebellar primordium; downregulated in Zic1 deficient cerebellum product : abhydrolase domain containing 14A protein_id : NP_666031.1

name	Abhd14b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753960 CCDS:CCDS23478.1 GeneID:76491 MGI:1923741
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : abhydrolase domain containing 14b protein_id : NP_083907.2

name	Pcbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981202 CCDS:CCDS23479.1 GeneID:59092 MGI:1890471
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : poly(rC)-binding protein 4 product : poly(rC) binding protein 4 protein_id : NP_067542.2

name	Parp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25014095 CCDS:CCDS23480.1 GeneID:235587 MGI:1891258
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 note : NAD+ ADP-ribosyltransferase 3; Poly[ADP-ribose] synthetase-3; A DP-ribosyltransferase (NAD+; poly (ADP-ribose polymerase)-like 3; ADP-ribosyltransferase (NAD+; poly (ADP-ribose polymerase)-like 3; ADP-ribosyltransferase (NAD+, poly (ADP-ribose polymerase)-like 3 product : poly (ADP-ribose) polymerase family, member 3 protein_id : NP_663594.2

name	Rrp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704248 CCDS:CCDS23481.1 GeneID:27966 MGI:2384313
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : U3 snoRNP-associated 55-kDa protein; RNA, U3 small nucleolar interacting protein 2 product : U3 snoRNP-associated protein protein_id : NP_663595.1

name	Iqcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765111 GeneID:74267 MGI:1921517
definition	codon_start : 1 product : IQ motif containing F1 isoform 1 protein_id : XP_486254.1

name	Iqcf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38090080 GeneID:75470 MGI:1922720
definition	codon_start : 1 product : IQ motif containing F5 protein_id : XP_356185.1

name	Iqcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627711 GeneID:68265 MGI:1915515
definition	codon_start : 1 note : testis-specific IQ motif containing protein 2 product : IQ motif containing F3 protein_id : NP_080921.2

name	Iqcf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020727 CCDS:CCDS23482.1 GeneID:67320 MGI:1914570
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : testis-specific IQ motif containing protein 1 product : IQ motif containing F4 protein_id : NP_080366.2

name	LOC100041096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260301 GeneID:100041096
definition	codon_start : 1 product : similar to hCG1789065 protein_id : XP_001475847.1

name	Grm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260304 GeneID:108068 MGI:1351339
definition	codon_start : 1 product : G protein-coupled receptor, family C, group 1, member B protein_id : XP_001475864.1

name	Tex264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090463 GeneID:21767 MGI:1096570
definition	codon_start : 1 product : testis expressed gene 264 protein_id : NP_001075123.1

name	Tex264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090850 CCDS:CCDS23483.1 GeneID:21767 MGI:1096570
definition	codon_start : 1 product : testis expressed gene 264 protein_id : NP_035703.2

name	Rad54l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090612 GeneID:81000 MGI:1933196
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003712 - transcription cofactor activity [Evidence IDA] codon_start : 1 note : HCMV-interacting protein product : steroid receptor-interacting SNF2 domain protein protein_id : NP_109655.2

name	LOC100041128 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260306 GeneID:100041128
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475896.1

name	Vprbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617569 CCDS:CCDS23485.1 GeneID:321006 MGI:2445220
definition	codon_start : 1 product : Vpr-binding protein protein_id : NP_001015507.1

name	Armet (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625813 CCDS:CCDS23486.1 GeneID:74840 MGI:1922090
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : arginine-rich, mutated in early stage tumors protein_id : NP_083379.2

name	Dock3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510297 GeneID:208869 MGI:2429763
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0051020 - GTPase binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : unclassified translation discrepancy note : presenilin-binding protein; modifier of cell adhesion product : dedicator of cyto-kinesis 3 protein_id : NP_700462.1

name	Mapkapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542089 CCDS:CCDS23487.1 GeneID:102626 MGI:2143163
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase-activated protein kinase 3 protein_id : NP_849238.1

name	Cish (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753426 GeneID:12700 MGI:103159
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : cytokine-inducible SH2 protein product : cytokine inducible SH2-containing protein protein_id : NP_034025.1

name	Hemk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539657 CCDS:CCDS23488.1 GeneID:69536 MGI:1916786
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HemK methyltransferase family member 1 protein_id : NP_598745.1

name	6430571L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202049 CCDS:CCDS23489.1 GeneID:235599 MGI:2445137
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC235599 protein_id : NP_780695.1

name	LOC669311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669311
definition	number : 2 pseudo : _no_value

name	LOC669311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669311
definition	number : 1 pseudo : _no_value

name	LOC664981 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260296 GeneID:664981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : hypothetical LOC664981 pseudo : _no_value transcript_id : XR_032330.1

name	EG665033 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260297 GeneID:665033 MGI:3648134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : predicted gene, EG665033 pseudo : _no_value transcript_id : XR_035671.1

clone name	MSMg01-132A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362J17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-117I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-313L12.T7 (MSMg01no313_l12.b1)	MSMg01-313L12.TJ (MSMg01no313_l12.g1)
ACC	AG435568	AG435569
length	1,286	1,266
length of high quality (start - end)	61 (29 - 89)	369 (74 - 442)
definition	CHROMAT_FILE: MSMg01no313_l12.b1 PHD_FILE: MSMg01no313_l12.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:55:44 2005	CHROMAT_FILE: MSMg01no313_l12.g1 PHD_FILE: MSMg01no313_l12.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:55:45 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NNNGGCATATGGGGCTATAGACTACTAAGGGAGAGGATCCGCGGAATTCC CATTGCTTCTTAAGGGTTGGGGGGGTGGGGAGGGAGGGNNACTCNANANN CTTTTTTAAGTTTTGCCCCCACAAGAGATTGGGATAATTATGGTGATATG TGTGTTGTGTGNGGAAAAGGATTTTTGAGAAAGTTTTTTCGGGGAGAAGA AGGGAAAGGAGAAAGGGGAGAGACAGAGAGAGGCGAAGGGGAGAGGCAAG GGGCAAGGAGGAGGAGCAGAGACGACAGGGCCGGAGAAAATTGATAGAAG GTATGTAGGAGTTTTGGCATTTTTTTATCGTGTAATCTGTTGTTGTTGTG GATTTTATAGTTTGGTGGTGTTTATTTGTTGGTTGAAAATTGCTTTTTTT TTTTTTTGAGATGAGGTTAACGTGTATTTTTTTTGAGGGGTGTAAAGGAG TTTTTTTTTTTTTTCCCCCCCCCCGAAGGAGGCCCCCCCCCTAAAAAAAA AGGGGGGGGGGNNNNNNNNNNNNNNNNNCNNCNNCCCCNCCNCCCCCCCC CCCGCCGGGGGGGCGGGGGGCCGGGCCGCGCGCGCGGGCGCGCCGGGGGC CGCCCGCGCGGGCGGGCCGCGGCCGGCGGGCGCGGGCGGGGGCGGGCGGG GGGCCGGGGGGGGCGCGCGGGCGGGGCGGGCGGGCGGGCGCGGGGGGCGG GGGCGGGCGCCGGCGGGGGCGGCCGGCGGGGGCCGCGGGGCGGGGCGGGG CGGGCGGGGGCCCGGGGGGGGGGCGCGCGGCGCGGGGGCGCGGGCGGCGG GGGGCGCGGCCCGCCGGGCGCCGCGGGCGCGCGGCGGCGGCGCCGCGGGC GGGGGCGGGGCCCGGCCCGGGCGGGGGCCGGGGCGCCCGCGGCGGGGGGG GCGGGCGGCGCGCGCGGCGGGGCGGCGCGGGCCGGGGGCGCCGGGGGGGG GGGGGGGGGGCGCGGGGCCCGGGGCGGGCCGCGGGGCGGCCGCGGCGCGC CCGGGGCCGCGGGGGCGGCGGTGCCGCGGGGCGCGGCCCGGCGCGGGGCG GGGGCGCGGCCCGCGGCGGGGGGGGCGGGGGGGGGGGCGGGCGGCGCCGG GNCGGGGGGCGGGCGGGCGCCCGGCGGGGCCGCGGCGGGGGGCGGCCGGG CGGCGGCGCGGGGGGGCGGCGCGGGCGGGCGCGCGGGGCGGGCGGCGCGG GGGGCGGGGCGGGGGGGCGGCGCGCGCGCGGGGCGGCGCGCGCGGCGCGG GGGCGGGGGCGGCGCGCCCGGCGCGCCGGAGCGGGG	NNNCCACGATCGTGAGCTGGGGCGCCXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXATGGGAATGGAGTCTGAGCCCGCTGAG AAGTGAGTCTCATTCCTGCCCCGAGTGGGGAGGTCAAGAAAAACCTGAAG GGGCAACACTGGGATAGGGTTGGTCAGCGGCCATTTGGCAAAGAAGGCAA AAGCACGGCATGGCTGAAGAGGGGTCACGCCTGGCGTGGGCCTTGGGCTT TGGGACCTGCTGGTGACTAGAGGCCAGTAGCCCTTGTGGCTGCTTCTCGG AGTTGCTCTGAGCCTCACCAAGCTGAGATGAGCAGCAGTGAGAGTGGCGG GCACAGGGCTCACAGAGGCCAGTGGGTTCCAGCGGCCCCATCTTTTTCAG GTCCTTGGCAGCCCGCACTGCACTCGGGCCGCAGATTACCAAGTTTTATT TTTCCCCCCCCCCGGNANNAGNNANGNGATCAAAAAAAAAGGGGGGGGNN NNNNNNNGNNNNNNNNNNNNGANAGGANANNAAGGAGGNGGNGANGAAGG NGGNNNGGNNGAGANAGAANGGNAGNNGGNANGANNNGNNAGGNNAGANN GNNNGNNNGNNNGNNANAANGNAAGAANNNNNNANANNAGANGGAAGGNN NNGGAGNNAANAANNANGAAGAANAGAAGGGAANGGAANNNANAGAGAAN NNNNGGANNNNGAAANNGGAGAGNGAGANNAAAGAAAAGGAANANAAGGA NAAAGAAAAAGAANGAAAGAAGGGGAAGGGGGGAAAAAAGAGAGGAAGAA AGANAAAAANAGAGGAAAAGGAGAAAAAGNGAAAGAAAAAAGAAAGGGAG NGGAAGAAAAAGGNGAAAAAGGAGAAAAGGANAAAGGGAAGGAAGGANAA AAAGAGAAAGGAGGGAGAGAAGGAAAAAGGGAGGAAAAGGAAAAGAAGAA AAAAGAAGAAAAGAAAGGGAGAAAAAAAAAAAAGAGGGAAAAGGGAGGAG AAGAAAAAGAAGAAAAAAGGAAGAGGANAAGGAAAAGAAGAAAAGGAAAG GAGAAGAAAGAAGAAGAGAGAAAAGAAGAGAGAAAGAAGAAGAGAAAAAA GAGAAAGAAAAGGGGGAAAAGGAAAAGAAGAGGGAGGAAAAAAGAGAAGA AGAGAAAAGAAAGAAGAGGGAAGGAGAAGAGGAGAAAGAAAAGAGAAAGA AAAAAGANAAAGGAAAAAGAAGAGAGAAAGAAGAGGAAAGAAGGGGAAGA AGAAGGAAAAAAGAAA
quality values	Open. Hide. 0 0 0 3 6 6 6 8 6 6 17 12 12 8 8 8 11 12 11 15 6 9 9 8 8 8 8 8 19 22 33 36 36 36 36 23 26 21 28 37 37 37 39 31 28 28 32 41 30 25 28 28 28 31 44 47 47 50 27 29 26 17 14 19 19 16 20 31 31 48 48 59 59 42 38 38 36 36 33 44 39 37 37 41 39 25 23 3 0 0 3 18 18 3 0 3 0 3 0 0 3 7 8 9 10 8 8 8 9 10 10 10 15 11 10 10 16 17 12 7 7 7 7 7 6 8 8 8 8 12 10 10 10 10 13 16 19 28 21 13 16 10 8 6 6 8 8 9 10 10 11 16 11 16 10 10 8 10 8 8 3 0 3 8 8 8 8 6 7 7 7 6 6 7 14 9 6 6 6 6 6 6 10 10 12 14 9 8 6 6 6 8 8 8 6 6 6 13 8 8 8 13 10 10 10 10 22 22 20 19 23 12 10 10 10 10 8 8 8 8 8 8 8 8 10 10 7 6 8 6 9 9 8 8 8 10 8 10 8 8 6 6 9 9 11 9 9 9 15 14 8 8 6 6 6 8 10 11 15 18 13 15 8 13 10 8 6 6 6 6 8 8 8 9 7 7 7 8 9 11 7 9 9 10 12 11 11 11 9 9 8 8 8 8 8 8 6 6 8 8 8 6 6 6 10 10 10 10 8 8 9 9 9 10 10 11 10 10 9 10 15 15 13 14 14 10 10 9 10 10 10 10 8 8 8 10 10 8 11 11 13 12 10 9 9 9 15 12 10 13 13 11 11 8 8 8 10 8 10 10 8 8 8 10 10 8 13 11 11 10 8 8 8 8 8 10 17 17 15 10 9 9 8 10 8 8 8 8 10 9 11 9 9 9 10 10 17 16 14 14 8 8 7 9 9 12 9 7 7 8 8 8 8 8 8 8 9 8 8 6 6 8 8 8 8 8 13 13 10 15 9 9 9 9 9 9 8 10 10 10 8 8 8 13 13 15 8 8 8 8 8 9 11 13 19 19 21 23 23 32 32 20 18 16 12 12 16 27 37 39 24 13 11 9 9 8 8 8 8 8 9 9 11 17 9 7 6 6 6 6 6 6 7 7 9 17 16 20 9 7 6 6 6 6 11 9 9 12 12 10 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 3 0 0 3 7 7 3 0 3 3 0 3 6 7 7 7 7 7 9 9 9 7 7 8 8 8 9 12 10 18 13 11 11 10 10 8 9 9 8 8 8 10 10 9 9 9 10 10 10 9 12 6 6 6 6 13 6 6 6 6 6 6 8 8 18 16 9 9 6 6 6 6 6 6 6 8 6 6 6 11 8 6 6 6 6 9 9 8 8 8 8 9 9 8 8 8 8 15 8 10 6 6 6 11 6 6 6 10 10 14 9 9 9 8 8 8 8 8 8 8 8 8 8 10 9 10 10 12 13 6 6 6 6 8 8 8 8 8 6 8 6 6 8 8 8 8 8 10 6 7 6 8 9 7 9 14 8 7 7 8 8 10 15 16 11 11 10 10 10 10 10 8 6 6 6 6 6 6 6 6 8 8 6 6 8 8 8 8 9 9 8 8 8 8 8 8 10 10 11 11 11 9 9 9 9 9 10 10 10 10 8 9 11 6 6 6 15 10 10 10 10 9 9 9 9 8 10 8 7 9 9 9 9 9 10 10 10 10 15 10 10 6 6 6 7 6 6 6 6 6 6 7 12 11 7 6 6 6 8 6 8 8 7 7 6 8 6 6 10 6 9 8 8 8 9 9 9 12 12 9 10 8 8 8 8 8 8 10 8 6 7 7 9 6 6 7 7 10 8 8 6 6 6 8 10 10 13 10 8 6 6 8 8 8 8 8 7 8 6 6 6 6 6 6 6 6 6 8 8 8 9 6 8 6 6 6 6 6 8 8 8 7 7 8 6 6 6 6 6 8 8 8 8 8 10 8 8 8 8 8 13 10 10 10 12 12 11 8 8 8 8 8 8 8 9 10 9 6 6 6 6 6 6 6 6 8 6 6 6 8 11 11 12 12 6 6 6 6 8 6 8 8 11 11 8 9 9 9 9 9 9 10 12 13 12 9 8 8 11 8 8 8 8 7 7 9 11 11 11 10 10 8 8 8 8 7 7 9 9 9 9 9 11 11 10 8 8 6 6 6 7 10 11 11 10 10 8 10 8 8 8 8 8 6 6 6 6 8 8 8 8 10 10 19 12 11 7 7 7 7 8 8 8 8 10 6 6 8 8 8 8 8 6 7 8 8 8 8 8 9 8 8 8 8 6 6 7 9 8 8 7 7 6 6 6 7 6 6 7 8 6 6 6 6 6 7 11 9 8 9 9 9 9 9 10 9 9 9 16 12 9 9 9 9 9 15 12 15 12 11 11 8 10 10 15 10 6 6 6 6 6 8 6 6 6 8 8 8 8 3 0 3 9 9 10 6 6 6 6 8 10 9 9 7 8 9 9 9 10 11 8 6 6 6 6 6 11 11 6 6 6 6 8 6 9 9 15 13 13 10 9 9 11 6 6 6 6 8 6 9 7 6 6 6 6 6 6 6 6 11 11 14 10 7 7 7 8 9 9 6 8 6 6 6 8 9 9 9 9 9 9 9 9 9 11 10 6 6 6 8 6 6 8 8 8 8 8 9 8 7 6 8 6 6 6 6 11 8 6 6 6 8 9 9 7 6 6 6 6 6 6 6 6 6 6 6 6 8 8 10 9 10 9 8 8 8 8 6 6 9 10 10 10 7 7 7 7 7 7 15 15 9 9 9 10 10 11 11 8 7 7 7 7 7 10 9 9 9 8 8 7 9 9 9 9 6 8 7 6 6 6 11 11 12 12	Open. Hide. 0 0 0 3 6 6 6 6 6 6 6 6 6 6 8 8 8 6 6 6 6 8 10 15 9 8 9 9 16 16 29 21 21 10 10 9 10 13 9 19 12 37 31 36 34 36 37 42 53 47 43 39 30 42 42 48 57 57 57 57 57 68 68 68 68 34 26 19 12 12 19 19 32 31 32 32 44 48 57 68 68 68 57 43 31 31 25 31 31 22 28 28 32 32 34 34 20 23 15 27 35 53 53 57 50 53 53 36 36 33 33 33 33 37 37 37 32 28 22 19 19 13 16 11 16 17 24 28 28 28 28 31 25 25 33 36 57 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 68 59 59 59 57 57 57 57 57 57 48 48 54 54 68 68 68 68 68 68 48 32 27 24 24 28 27 25 28 40 44 54 57 44 42 35 35 35 42 43 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 59 59 57 59 57 44 44 35 43 35 44 44 59 59 52 52 52 52 59 59 59 68 68 57 57 57 57 57 57 59 59 59 59 52 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 57 57 57 57 68 68 68 68 57 57 57 57 57 59 52 52 43 50 50 57 59 44 44 50 50 37 37 37 43 43 52 57 59 59 68 68 59 59 57 57 57 57 57 68 68 68 68 68 59 59 57 59 59 57 57 57 57 47 57 44 47 43 43 42 44 44 59 59 57 57 54 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 59 59 57 54 48 59 48 48 57 59 59 48 48 48 48 48 48 48 48 48 57 57 59 59 59 59 59 48 48 48 59 57 59 57 59 59 59 59 59 59 41 41 23 23 11 12 12 14 9 9 9 9 10 15 25 30 47 59 59 59 59 50 57 57 57 57 57 59 57 50 50 50 44 44 36 37 37 39 32 28 34 34 48 48 43 59 59 59 59 50 50 47 47 27 19 10 7 7 9 7 6 6 6 7 7 11 12 12 12 13 17 19 19 16 15 8 7 7 3 0 3 0 0 3 3 0 0 3 0 3 0 3 11 9 12 9 9 12 12 10 10 10 12 11 12 12 15 7 7 7 7 3 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 3 3 0 3 25 25 3 0 3 0 0 3 23 23 37 23 17 3 0 3 3 0 3 3 0 3 10 7 7 3 0 3 3 0 0 0 3 3 0 0 3 9 9 3 0 3 7 7 3 0 3 3 0 3 3 0 0 3 3 0 3 0 3 3 0 0 0 3 0 0 3 6 3 0 0 3 9 3 0 0 3 0 0 0 3 0 0 0 3 0 0 0 3 0 0 3 0 3 3 0 3 0 3 23 23 25 3 0 0 0 0 0 0 3 0 3 0 0 3 6 3 0 3 7 7 7 7 3 0 0 0 0 3 12 23 3 0 0 3 3 0 3 3 0 0 3 0 3 9 8 6 6 3 0 3 6 7 6 6 6 7 7 3 0 3 7 7 3 0 0 0 3 0 3 15 10 8 8 3 0 0 0 0 0 3 6 3 0 0 0 0 3 6 6 3 0 0 3 10 10 10 13 3 0 3 7 8 3 0 0 3 11 11 11 11 7 6 6 6 6 6 3 0 3 0 3 9 10 6 3 0 3 7 6 6 6 9 9 9 6 6 6 3 0 3 6 6 6 9 9 9 9 8 8 6 6 6 6 13 10 9 8 8 8 6 6 6 6 6 7 7 9 13 13 9 9 9 9 8 8 8 8 3 0 3 14 18 12 3 0 3 6 6 6 6 8 11 8 6 6 6 6 6 8 9 9 9 9 3 0 3 8 10 8 8 8 14 14 14 16 9 9 9 9 9 9 9 10 9 3 0 3 9 8 6 8 6 6 8 8 8 8 3 0 3 7 8 10 9 11 9 8 8 6 6 6 6 8 8 6 3 0 3 9 9 10 11 10 10 10 9 10 7 8 8 7 3 0 3 9 9 10 8 8 7 9 9 9 9 9 9 9 9 9 9 7 8 7 6 6 6 6 8 6 7 6 6 6 6 8 8 8 8 7 7 7 6 7 6 8 8 8 8 6 6 6 6 6 6 10 10 15 10 8 8 8 8 6 8 6 6 6 6 6 6 6 6 6 6 8 6 6 8 8 13 10 10 10 14 15 8 10 9 8 8 6 6 6 6 8 8 9 9 9 9 6 6 6 6 6 6 6 6 10 9 9 8 8 9 9 9 10 11 10 12 26 26 22 18 12 6 6 6 6 6 6 3 0 3 7 7 9 10 10 9 11 9 9 9 8 8 11 16 8 6 6 6 6 6 6 6 6 6 6 6 9 8 8 8 7 7 8 9 8 10 7 7 7 7 7 8 7 7 6 6 6 6 6 7 9 9 8 8 8 10 7 7 7 8 8 6 6 6 6 6 8 8 10 9 9 9 9 9 9 6 6 8 6 8 7 10 10 9 9 9 9 9 9 9 9 9 9 9 10 6 6 6 8 6 6 6 6 6 6 6 6 6 6 11 12 12 6 6 6 6 8 8 8 8 11 15 8 8 7 8 8 10 9 9 9 10 7 7 8 6 6 6 6 6 6 8 6 6 6 6 6 8 6 6 6 8 8 8 8 8 8 6 7 8 8 7 7 6 6 6 6 8 6 6 6 8 10 9 9 11 9 3 0 3 9 9 9 9 9 11 11 8 8 8 8 7 6 6 6 6 6 6 8 6 6 6 8 8 8 8 6 6 6 6 6 6 6 6 9 9 9 9 10 10 6 8 6 6 6 6 9 6 6 7 6 6 8 10 12 11 11

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no313_l12.g1 MSMg01no313_l12.g1 CHROMAT_FILE:
MSMg01no313_l12.g1 PHD_FILE: MSMg01no313_l12.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:55:45 2005
         (369 letters)



>mm_chr9_106295512_106296280
          Length = 769

 Score =  659 bits (341), Expect = 0.0
 Identities = 362/373 (97%), Gaps = 8/373 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaatggagtctgagcccgctgagaagtgagtctcattcctgccccgagtggggagg 60
           ||||||||||||||||||||||||||||||||||||||||||||| |  |||||||||||
Sbjct: 201 atgggaatggagtctgagcccgctgagaagtgagtctcattcctgtcatgagtggggagg 260

                                                                       
Query: 61  tcaagaaaaacctgaaggggcaacactgggatagggttggtcagcggccatttggcaaag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tcaagaaaaacctgaaggggcaacactgggatagggttggtcagcggccatttggcaaag 320

                                                                       
Query: 121 aaggcaaaagcacggcatggctgaagaggggtcacgcctggcgtgggccttgggctttgg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 aaggcaaaagcacggcatggctgaagaggggtcacgcctggcgtgggccttgggctttgg 380

                                                                       
Query: 181 gacctgctggtgactagaggccagtagcccttgtggctgcttctcggagttgctctgagc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 gacctgctggtgactagaggccagtagcccttgtggctgcttctcggagttgctctgagc 440

                                                                       
Query: 241 ctcaccaagctgagatgagcagcagtgagagtggcgggcacagggctcacagaggccagt 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 ctcaccaagctgagatgagcagcagtgagagtggcgggcacagggctcacagaggccagt 500

                                                                       
Query: 301 gggttccagcggccccatctttttcag----gtccttggcagcccgcactgcactcgggc 356
           ||||||||||||||||||||    |||    |||||||||||||||||||||||||||||
Sbjct: 501 gggttccagcggccccatct----cagccaggtccttggcagcccgcactgcactcgggc 556

                        
Query: 357 cgcagattaccaa 369
           |||||||||||||
Sbjct: 557 cgcagattaccaa 569


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 18
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 369
Length of database: 769
Length adjustment: 9
Effective length of query: 360
Effective length of database: 760
Effective search space:   273600
Effective search space used:   273600
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information