MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-332G13
Chromosome	9 (Build37)
Map Location	56,687,839 - 56,851,177
singlet/doublet	doublet
Overlap gene	Odf3l1, Cspg4, Sh3px3, Imp3, Snupn, Ptpn9
Upstream gene	Zfp291, LOC664980, 4930563M21Rik, LOC664995, LOC665005, Rcn2, Pstpip1, Tspan3, C230081A13Rik, Hmg20a, LOC100039535, LOC100039549, LOC640537, Lingo1
Downstream gene	2700012I20Rik, Sin3a, Man2c1, Neil1, Commd4, 1700041C23Rik, Trcg1, 1700017B05Rik, EG330948, Ppcdc, Scamp5, D9Wsu149, LOC620603, Rpp25, Cox5a, 2310046O06Rik, Mpi1, Scamp2, Ulk3, Cplx3, Lman1l, Csk, Cyp1a2, Cyp1a1, Edc3, Clk3, Arid3b, LOC665235, LOC677423, LOC100039509, Ubl7, Sema7a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp291 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244891 MGI:1925976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664980 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein pseudo : _no_value

name	4930563M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75258 MGI:1922508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC665005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins pseudo : _no_value

name	Rcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26611 MGI:1349765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pstpip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19200 MGI:1321396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56434 MGI:1928098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230081A13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244895 MGI:2442366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmg20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66867 MGI:1914117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 449 ESTs, 6 Proteins

name	LOC100039549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC640537 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lingo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235402 MGI:1915522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Odf3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382075 MGI:2681875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cspg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:121021 MGI:2153093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3px3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235406 MGI:2443239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Imp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102462 MGI:1916119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snupn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66069 MGI:1913319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56294 MGI:1928376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700012I20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72588 MGI:1919838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Sin3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20466 MGI:107157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73744 MGI:1920994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72774 MGI:1920024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Commd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66199 MGI:1913449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67319 MGI:1914569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs

name	Trcg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:541610 MGI:3576664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700017B05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74211 MGI:1921461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330948 MGI:3647258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1131 ESTs, 7 Proteins

name	Ppcdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66812 MGI:1914062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scamp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56807 MGI:1928948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D9Wsu149 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28014 MGI:107281
definition	gene_synonym : D9Wsu149e note : DNA segment, Chr 9, Wayne State University 149 pseudo : _no_value

name	LOC620603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 313 ESTs, 15 Proteins pseudo : _no_value

name	Rpp25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102614 MGI:2143151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12858 MGI:88474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310046O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78323 MGI:1925573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110119 MGI:97075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24044 MGI:1346518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ulk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71742 MGI:1918992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 29 ESTs, 4 Proteins

name	Cplx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235415 MGI:2384571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lman1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235416 MGI:2667537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12988 MGI:88537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13077 MGI:88589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13076 MGI:88588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353190 MGI:2142951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102414 MGI:1098670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56380 MGI:1930768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 10 Proteins pseudo : _no_value

name	LOC677423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100039509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ubl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69459 MGI:1916709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20361 MGI:1306826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp291 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486796 GeneID:244891 MGI:1925976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 291 transcript_id : NM_001081341.1

name	4930563M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147096 GeneID:75258 MGI:1922508
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930563M21 gene transcript_id : NM_183111.1

name	Rcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205427 GeneID:26611 MGI:1349765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulocalbin 2 transcript_id : NM_011992.2

name	Pstpip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469104 GeneID:19200 MGI:1321396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-serine-threonine phosphatase-interacting protein 1 transcript_id : NM_011193.1

name	Tspan3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981021 GeneID:56434 MGI:1928098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 3 transcript_id : NM_019793.2

name	C230081A13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386673 GeneID:244895 MGI:2442366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230081A13 gene transcript_id : NM_172924.2

name	Hmg20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981181 GeneID:66867 MGI:1914117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group 20A transcript_id : NM_025812.2

name	LOC100039535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259983 GeneID:100039535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 449 ESTs, 6 Proteins product : similar to Ubiquitin-conjugating enzyme E2S transcript_id : XM_001473225.1

name	LOC100039549 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259987 GeneID:100039549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039549 transcript_id : XM_001473238.1

name	LOC640537 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259977 GeneID:640537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to transcription elongation factor A (SII)-like 8 transcript_id : XM_001472595.1

name	Lingo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926183 GeneID:235402 MGI:1915522
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and Ig domain containing 1 transcript_id : NM_181074.4

name	Odf3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348575 GeneID:382075 MGI:2681875
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 3-like 1 transcript_id : NM_198673.1

name	Cspg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20467422 GeneID:121021 MGI:2153093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chondroitin sulfate proteoglycan 4 transcript_id : NM_139001.1

name	Sh3px3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383222 GeneID:235406 MGI:2443239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and PX domain containing 3 transcript_id : NM_175483.5

name	Imp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388265 GeneID:102462 MGI:1916119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) transcript_id : NM_133976.2

name	Snupn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372553 GeneID:66069 MGI:1913319
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : snurportin 1 transcript_id : NM_178374.3

name	Ptpn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098099 GeneID:56294 MGI:1928376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 9 transcript_id : NM_019651.2

name	2700012I20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259980 GeneID:72588 MGI:1919838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : RIKEN cDNA 2700012I20 gene transcript_id : XM_001472828.1

name	Sin3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106406 GeneID:20466 MGI:107157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional regulator, SIN3A (yeast) transcript_id : NM_011378.1

name	Man2c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130507 GeneID:73744 MGI:1920994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase, alpha, class 2C, member 1 transcript_id : NM_028636.2

name	Neil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130491 GeneID:72774 MGI:1920024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nei endonuclease VIII-like 1 (E. coli) transcript_id : NM_028347.2

name	Commd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803184 GeneID:66199 MGI:1913449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 4 transcript_id : NM_025417.2

name	1700041C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259989 GeneID:67319 MGI:1914569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs product : RIKEN cDNA 1700041C23 gene transcript_id : XM_001473583.1

name	Trcg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480099 GeneID:541610 MGI:3576664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor protein 1 transcript_id : NM_001014398.1

name	1700017B05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625982 GeneID:74211 MGI:1921461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700017B05 gene transcript_id : NM_028820.1

name	EG330948 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259991 GeneID:330948 MGI:3647258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1131 ESTs, 7 Proteins product : predicted gene, EG330948, transcript variant 1 transcript_id : XM_284504.6

name	Ppcdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725348 GeneID:66812 MGI:1914062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphopantothenoylcysteine decarboxylase transcript_id : NM_176831.4

name	Scamp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543673 GeneID:56807 MGI:1928948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 5 transcript_id : NM_020270.2

name	Rpp25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527203 GeneID:102614 MGI:2143151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease P 25 subunit (human) transcript_id : NM_133982.1

name	Cox5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181181 GeneID:12858 MGI:88474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit Va transcript_id : NM_007747.2

name	2310046O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370984 GeneID:78323 MGI:1925573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310046O06 gene transcript_id : NM_175273.3

name	Mpi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345292 GeneID:110119 MGI:97075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose phosphate isomerase 1 transcript_id : NM_025837.2

name	Scamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560286 GeneID:24044 MGI:1346518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 2 transcript_id : NM_022813.2

name	Ulk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386134 GeneID:71742 MGI:1918992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 29 ESTs, 4 Proteins product : unc-51-like kinase 3 (C. elegans), transcript variant 1 transcript_id : XM_620754.3

name	Cplx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542187 GeneID:235415 MGI:2384571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complexin 3 transcript_id : NM_146223.2

name	Lman1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351955 GeneID:235416 MGI:2667537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, mannose-binding 1 like transcript_id : NM_199222.2

name	Csk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560711 GeneID:12988 MGI:88537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-src tyrosine kinase transcript_id : NM_007783.2

name	Cyp1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803352 GeneID:13077 MGI:88589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 1, subfamily a, polypeptide 2 transcript_id : NM_009993.3

name	Cyp1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801730 GeneID:13076 MGI:88588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 1, subfamily a, polypeptide 1 transcript_id : NM_009992.3

name	Edc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386565 GeneID:353190 MGI:2142951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enhancer of mRNA decapping 3 homolog (S. cerevisiae) transcript_id : NM_153799.2

name	Clk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801904 GeneID:102414 MGI:1098670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC-like kinase 3 transcript_id : NM_007713.4

name	Arid3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130594 GeneID:56380 MGI:1930768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 3B (Bright like) transcript_id : NM_019689.2

name	Ubl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349643 GeneID:69459 MGI:1916709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 7 (bone marrow stromal cell-derived) transcript_id : NM_027086.2

name	Sema7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254572 GeneID:20361 MGI:1306826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A transcript_id : NM_011352.2

name	Zfp291 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486797 GeneID:244891 MGI:1925976
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger protein 291 protein_id : NP_001074810.1

name	4930563M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147097 GeneID:75258 MGI:1922508
definition	GO_function : GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75258 protein_id : NP_898934.1

name	Rcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205428 CCDS:CCDS23206.1 GeneID:26611 MGI:1349765
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 note : taipoxin-associated calcium binding protein 49 product : reticulocalbin 2 protein_id : NP_036122.2

name	Pstpip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469105 GeneID:19200 MGI:1321396
definition	GO_component : GO:0005826 - contractile ring [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019903 - protein phosphatase binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0000910 - cytokinesis [Evidence IC] codon_start : 1 exception : mismatches in translation product : proline-serine-threonine phosphatase-interacting protein 1 protein_id : NP_035323.1

name	Tspan3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981022 CCDS:CCDS23207.1 GeneID:56434 MGI:1928098
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tetraspanin TM4-A homolog; transmembrane 4 superfamily member 8 product : tetraspanin 3 protein_id : NP_062767.2

name	C230081A13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370424 GeneID:244895 MGI:2442366
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC244895 protein_id : NP_766512.1

name	LOC100039535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259984 GeneID:100039535
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme E2S protein_id : XP_001473275.1

name	Hmg20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15022805 CCDS:CCDS23208.1 GeneID:66867 MGI:1914117
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : inhibitor of BRAF35 product : high mobility group 20A protein_id : NP_080088.1

name	LOC100039549 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259988 GeneID:100039549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473288.1

name	LOC640537 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259978 GeneID:640537
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472645.1

name	Lingo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841016 CCDS:CCDS23209.1 GeneID:235402 MGI:1915522
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine rich repeat neuronal 6A product : leucine-rich repeat neuronal 6A protein_id : NP_851419.1

name	Odf3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348576 CCDS:CCDS23210.1 GeneID:382075 MGI:2681875
definition	codon_start : 1 product : outer dense fiber of sperm tails 3-like 1 protein_id : NP_941075.1

name	Cspg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20467423 CCDS:CCDS23211.1 GeneID:121021 MGI:2153093
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IMP]; GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0008347 - glial cell migration [Evidence IDA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0009888 - tissue development [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IMP] codon_start : 1 exception : mismatches in translation note : nerve/glial antigen 2 product : chondroitin sulfate proteoglycan 4 protein_id : NP_620570.1

name	Sh3px3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793416 CCDS:CCDS23212.1 GeneID:235406 MGI:2443239
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : SH3 and PX domain containing 3 protein_id : NP_780692.2

name	Imp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527196 CCDS:CCDS23213.1 GeneID:102462 MGI:1916119
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0019843 - rRNA binding [Evidence IEA]; GO:0030519 - snoRNP binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IGI] codon_start : 1 note : U3 snoRNP protein 3 homolog product : IMP3, U3 small nucleolar ribonucleoprotein, homolog protein_id : NP_598737.1

name	Snupn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410012 CCDS:CCDS23214.1 GeneID:66069 MGI:1913319
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : RNA, U transporter 1 product : snurportin 1 protein_id : NP_848461.1

name	Ptpn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098100 CCDS:CCDS23215.1 GeneID:56294 MGI:1928376
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : protein-tyrosine phosphatase product : protein tyrosine phosphatase, non-receptor type 9 protein_id : NP_062625.2

name	2700012I20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259981 GeneID:72588 MGI:1919838
definition	codon_start : 1 product : hypothetical protein LOC72588 protein_id : XP_001472878.1

name	Sin3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106407 CCDS:CCDS23216.1 GeneID:20466 MGI:107157
definition	GO_component : GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transcriptional regulator, SIN3 yeast homolog A product : transcriptional regulator, SIN3A protein_id : NP_035508.1

name	Man2c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794150 GeneID:73744 MGI:1920994
definition	GO_function : GO:0015923 - mannosidase activity [Evidence IEA] GO_process : GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : cytosolic alpha-D-mannosidase product : mannosidase, alpha, class 2C, member 1 protein_id : NP_082912.1

name	Neil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094129 CCDS:CCDS23217.1 GeneID:72774 MGI:1920024
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence IDA]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0016829 - lyase activity [Evidence IDA]; GO:0008534 - oxidized purine base lesion DNA N-glycosylase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : endonuclease VIII product : nei endonuclease VIII-like 1 protein_id : NP_082623.1

name	Commd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384806 GeneID:66199 MGI:1913449
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : COMM domain containing 4 protein_id : NP_079693.1

name	1700041C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259990 GeneID:67319 MGI:1914569
definition	codon_start : 1 product : hypothetical protein LOC67319 protein_id : XP_001473633.1

name	Trcg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480100 CCDS:CCDS23218.1 GeneID:541610 MGI:3576664
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : taste receptor protein 1 protein_id : NP_001014420.1

name	1700017B05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625983 CCDS:CCDS23219.1 GeneID:74211 MGI:1921461
definition	codon_start : 1 product : hypothetical protein LOC74211 protein_id : NP_083096.1

name	EG330948 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28491531 GeneID:330948 MGI:3647258
definition	codon_start : 1 product : similar to ribosomal protein S8 isoform 1 protein_id : XP_284504.1

name	Ppcdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849879 CCDS:CCDS23221.1 GeneID:66812 MGI:1914062
definition	GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004633 - phosphopantothenoylcysteine decarboxylase activity [Evidence IEA] GO_process : GO:0015937 - coenzyme A biosynthesis [Evidence IEA] codon_start : 1 product : phosphopantothenoylcysteine decarboxylase protein_id : NP_789801.1

name	Scamp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937988 GeneID:56807 MGI:1928948
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 5 protein_id : NP_064666.1

name	Rpp25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527204 CCDS:CCDS23222.1 GeneID:102614 MGI:2143151
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004526 - ribonuclease P activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : ribonuclease P 25kDa subunit protein_id : NP_598743.1

name	Cox5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181182 CCDS:CCDS23223.1 GeneID:12858 MGI:88474
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase, subunit Va protein_id : NP_031773.2

name	2310046O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424930 GeneID:78323 MGI:1925573
definition	codon_start : 1 product : hypothetical protein LOC78323 protein_id : NP_780482.1

name	Mpi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206392 GeneID:110119 MGI:97075
definition	EC_number : 5.3.1.8 GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004476 - mannose-6-phosphate isomerase activity [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IC] codon_start : 1 note : phosphomannose isomerase product : mannose phosphate isomerase 1 protein_id : NP_080113.1

name	Scamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12331398 CCDS:CCDS23224.1 GeneID:24044 MGI:1346518
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 2 protein_id : NP_073724.1

name	Ulk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386135 GeneID:71742 MGI:1918992
definition	codon_start : 1 product : unc-51-like kinase 3 isoform 1 protein_id : XP_620754.3

name	Cplx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122785 CCDS:CCDS23226.1 GeneID:235415 MGI:2384571
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005326 - neurotransmitter transporter activity [Evidence IMP]; GO:0000149 - SNARE binding [Evidence IDA]; GO:0019905 - syntaxin binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0046928 - regulation of neurotransmitter secretion [Evidence IDA]; GO:0016079 - synaptic vesicle exocytosis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : lectin, mannose-binding, 1 like product : complexin III protein_id : NP_666335.1

name	Lman1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363805 GeneID:235416 MGI:2667537
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : sublingual acinar membrane protein product : lectin, mannose-binding, 1 like protein_id : NP_954692.1

name	Csk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560712 CCDS:CCDS23228.1 GeneID:12988 MGI:88537
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IC] [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence TAS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] [Evidence TAS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] [Evidence TAS]; GO:0008285 - negative regulation of cell proliferation [Evidence IGI] [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS] [Evidence IEA]; GO:0050863 - regulation of T cell activation [Evidence TAS] codon_start : 1 product : c-src tyrosine kinase protein_id : NP_031809.2

name	Cyp1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753566 CCDS:CCDS23229.1 GeneID:13077 MGI:88589
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 1a2, aromatic compound inducible product : cytochrome P450, family 1, subfamily a, polypeptide 2 protein_id : NP_034123.1

name	Cyp1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753564 CCDS:CCDS23230.1 GeneID:13076 MGI:88588
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 1a1, aromatic compound inducible; cytochrome P450 subfamily I, polypeptide 1 product : cytochrome P450, family 1, subfamily a, polypeptide 1 protein_id : NP_034122.1

name	Edc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418913 CCDS:CCDS23231.1 GeneID:353190 MGI:2142951
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : enhancer of mRNA decapping 3 protein_id : NP_722494.1

name	Clk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745112 CCDS:CCDS23232.1 GeneID:102414 MGI:1098670
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : cdc2/CDC28-like protein kinase 3 product : CDC-like kinase 3 protein_id : NP_031739.3

name	Arid3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790033 CCDS:CCDS23233.1 GeneID:56380 MGI:1930768
definition	codon_start : 1 note : bright and dead ringer gene product homologous protein Bdp product : dead ringer homolog 2 protein_id : NP_062663.1

name	Ubl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312294 CCDS:CCDS23234.1 GeneID:69459 MGI:1916709
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin-like 7 (bone marrow stromal cell-derived) protein_id : NP_081362.1

name	Sema7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755466 CCDS:CCDS23235.1 GeneID:20361 MGI:1306826
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : H-Sema K1; Semaphorin K1 product : semaphorin 7A protein_id : NP_035482.1

name	LOC664995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664995
definition	number : 1 pseudo : _no_value

name	LOC664995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664995
definition	number : 2 pseudo : _no_value

name	LOC677423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677423
definition	number : 1 pseudo : _no_value

name	LOC100039509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039509
definition	number : 1 pseudo : _no_value

name	LOC100039509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039509
definition	number : 2 pseudo : _no_value

name	LOC664980 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259982 GeneID:664980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : similar to XY body protein pseudo : _no_value transcript_id : XR_030988.1

name	LOC665005 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259976 GeneID:665005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : similar to XY body protein pseudo : _no_value transcript_id : XR_030731.1

name	LOC620603 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259993 GeneID:620603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 313 ESTs, 15 Proteins product : similar to Fatty acid binding protein 5, epidermal pseudo : _no_value transcript_id : XR_031387.1

name	LOC665235 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260000 GeneID:665235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 10 Proteins product : similar to hCG1642689 pseudo : _no_value transcript_id : XR_031650.1

clone name	MSMg01-348H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349P24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297J17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-539C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-332G13.T7 (MSMg01no332_g13.b1)	MSMg01-332G13.TJ (MSMg01no332_g13.g1)
ACC	AG448450	AG448451
length	1,256	1,318
length of high quality (start - end)	571 (96 - 666)	674 (90 - 763)
definition	CHROMAT_FILE: MSMg01no332_g13.b1 PHD_FILE: MSMg01no332_g13.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:18:49 2005	CHROMAT_FILE: MSMg01no332_g13.g1 PHD_FILE: MSMg01no332_g13.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:18:49 2005
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(56,850,762 - 56,851,177)	(56,687,839 - 56,688,512)
sequence	NNNGCGGTTTTTGNNNNACATTGGGCGCTAAGACTCCTAAGGGAGAGGAT CCGCGGAATTCTTCACCTTTCCTTCCATCCCTATAGTGTGTTCTAATAGG CGATGTCTCGGAAAAGCCCCTATTAAACATCATGAATCATTTGGTCCTTG ACGTCTGGTTCCTTCCAGGGGGACAGATGACATTTAGCACAGGACATGGA AGTCTGTGGGAAAGGAAAGTTCTTAGCTACAAGAAAGGACAAACCTCTGA CCTTGGGAAAAGGGCCAAAAATCTTTGAAGTCCTCATTACAGCAGTTAAA TATTTAACTTTAGCCAGGCGGTGCTAATACATGCCTTTAATCCCAGCTCT AGGGAGGCAGAGGCAAGTGGATCTCTGTGAGTTCAAGGCCAACCTGGTCT ACAAAACAAGTTCCAGGACAGCTGCTAGGGCTACACAGAGAAACCCTGAG TCAAAATAACAACAACAACAACACATATTTAAAAGAATCTATTATGAAAA AAAAACCCAAAGTATAAAATTAGAATTGATTTTTGAAAGCTATACTATGT TGAGGGAACAAGGACAGCAGAGGGGTAAGATGTAGCTGCTAGAGTTTTCC AGTATCATGGAGGATCCACAAAGATTAGCCACCAGAGGAATTGGATTTTA ATAAGGCTTACAAGATCAGATTTTAGTTGTTGCACCCAGAGATTGAGTTA CCGTTGTTTCTGAACTAAGTTTGTGTTGTGTTTTCCTTCACATGCTCATC TGGGAGGGGTCAAGAGAGAAAGGTACGGCAGCAAAGTGTGGGTTTGCCAG ATGTGCACCACAAAGGCTGTGGGGGATTTGAAAAACAGGGCTGGCTTGTG TATGAACGGCCACCGGGAAACAAATGAAATGGGGGGAGGTGTTTCTGGAG GTCCAGCCCAAAAGACTCCACCAAGTAAACAGGGGATCCGTTGGCCCCCC AAAAAGGGCCGACAGGCCCCCCAGGCTGAAAATGCCACCGTGGAAAGGGC CCGGNNNTTTTTGGTTTGGGTTTCAAATTGGNNNNAAAAAANNCCCCCNC ANACAACAAAAAACATTAGGGGGGGGGTCGCCTTTTCTCCCCCTCTGTAT TAAATGNGGGTATTTTTAAATAAAAAAATGTTCAATTATAATCTATATAT ANGGTTTACAAAGACATTGTCATAAGAACAAAAAAAAAAACTCNNAGTAA TTTCTTTTAGACGAATGACCATATGCAACTTGTAACTATGGGGACTCATA ACAAAT	NCCCCCTTTTTNNNNACGATGTGAGGCTGGGGCGCCXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXCTTTTAGGGGTGAAAGCAATGG AATGGTCTCTATCCTGTGCGTGCCAAGAGCACTACAGAGAGGCTTCTGCC CCAGCCCAGCCACTTGACCTTGACAACTCACTGGTTTGGGGAGTAGGGTA AAAGGACCGCCCTTGAGCCTGCTCAGAAGTATCAAGTAGAAGCATCAACA TTCTGAAGCCTTGAAGGTCCCTCAACCTTCTCAGTCCCCACTGCTCCCAG TCCCTTAGGTCCTCCAGCTGCTCCTCCCTGTGTCCCCTCTGCTCTGCTCA CTCTCTCCTGCTTCTCCTCTTCTCCCTGTCAGGACAATAAGAATTAATGG CGTCCTCAGTGTCTGTCTCTGAACTTCCCCAGGGAATTAAATCCCAGACC CTTGAGCCCTGTTAGAGTCCAAGAAAAATGCATGTAAGTGCTCTTTGTGA AAATATGTGTGTATACAGGCGTCCTTGCACAGAAAGGTGTCACCAATACC CGCTGGGGGTTCTGTCTGAACCCCCAGGTCTGATCTGTATGTGTCTCTAA ATAGCCCAAGCGTGCCTGAGCTATAAGAATTCTGGGTGTTTGTGTAAATG CACATGCAACTGCTGGCATGAAATTTTTACAATCCTTGTGGATCTCAATG CATGCACAGCAAATCATCTGTGTGCAATGTCTATGTGTTAAATACAGGCC TGTGTGACAAGGCTGGGGAATACATATGTCACCGTACACTTATGTTTTAC TCATGTACACCACATGTCCACATGTATGGCCACTTCTGTGCGTTTTATGC TGTGTTCACACATTCCTACCTGTCTGCATATATTGTCATCCTGGGCCCCC TGGAGCTGACCCCTGTCCCCTACCATATACCCCCCTTCCTTGTTTTTTGG TGATGGTGCTTTCAGGTCCACCTCTAATCTAGTTCTTTACGCTACTGCTT TTGCTTTGGTCTGCTAATTCTCTTATATAAGACTCTTTCTTGTCCAATTC GTTAAACAGTATCCTACCTTTTTTCACTCCTTTCATTACCTCCTGATAAT GTTTATTTAAATTACTTCTTTTATTCCTCTCTCCTACCTTCTTTTTTCTT TATTCTCCATCTCCTTCTTAGTGTCTTCACAAACACTATATTCTATTTAT CCTCTAATTGCTGATCTCTTACTCTACATTATACATATTACTCCATCTTC TTACCTCCCTTTTATGTTATGACATTCTATACACTGTGCTTCTCTATATC TCTACTCTCTTCTCGCAC
quality values	Open. Hide. 0 0 0 3 7 8 10 12 11 9 6 8 3 0 0 0 0 3 6 7 7 7 7 7 7 10 10 8 8 8 8 8 8 10 8 8 8 11 8 8 8 21 19 22 28 23 22 22 29 37 37 37 33 33 32 32 32 23 28 32 33 33 33 33 33 33 33 47 44 44 50 37 37 27 21 10 9 9 7 8 8 9 8 9 8 8 8 9 9 13 19 21 21 8 8 9 21 21 53 53 57 53 38 35 35 35 35 31 31 31 33 42 41 39 39 24 17 12 15 10 10 6 8 6 6 8 19 21 41 41 37 37 37 37 37 37 40 40 43 43 43 43 43 57 57 57 50 53 53 53 53 53 53 68 68 68 68 53 53 48 50 50 68 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 48 48 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 68 68 68 59 59 59 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 52 52 52 57 59 68 68 68 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 57 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 59 59 59 59 57 57 57 57 57 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 68 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 52 62 62 62 52 62 43 43 31 35 35 44 44 62 62 62 62 62 52 62 62 62 62 62 52 43 43 35 35 35 43 43 52 62 62 62 62 52 62 62 62 62 62 62 47 47 35 43 43 39 39 43 59 57 57 57 45 38 38 18 20 17 18 24 36 44 57 57 52 57 57 52 43 43 35 35 35 44 44 52 57 45 45 57 43 43 33 32 32 44 44 57 57 57 43 43 28 28 32 43 43 52 59 57 52 38 38 18 16 16 30 30 41 50 50 52 52 52 52 57 57 52 52 50 59 59 59 54 54 54 59 59 54 50 57 50 43 47 47 59 57 54 48 46 44 43 59 59 68 68 59 59 59 59 59 39 39 37 43 42 43 43 47 47 54 59 47 34 32 20 20 23 32 30 43 46 37 37 37 46 59 54 54 48 48 48 48 54 54 57 57 57 48 48 39 39 35 39 39 43 43 43 43 43 43 39 36 36 37 37 37 37 37 37 32 34 22 20 11 12 12 27 33 59 59 28 28 17 22 15 23 17 32 28 30 30 30 30 21 21 14 21 21 37 41 32 37 22 24 18 32 32 42 33 43 43 43 43 43 37 37 33 32 32 20 20 20 32 31 34 34 30 25 25 15 15 13 12 12 13 19 13 14 14 21 18 30 25 28 28 33 39 42 42 39 43 43 43 43 37 37 36 36 30 31 32 34 30 25 28 26 28 13 15 15 18 24 13 15 15 27 25 17 17 18 20 28 28 28 24 22 23 20 23 15 11 11 11 12 12 17 17 24 20 20 18 20 25 18 16 11 12 15 18 18 20 28 28 30 28 25 22 24 19 16 11 11 11 13 27 12 14 13 12 12 11 11 11 11 11 22 20 22 24 17 17 12 12 12 25 25 36 32 32 30 28 28 32 32 25 20 20 22 15 14 16 16 28 34 34 25 25 11 11 11 11 11 21 12 12 11 11 12 17 16 18 11 11 11 11 12 12 12 11 11 11 12 12 26 24 21 17 15 11 11 11 10 13 11 11 10 10 11 18 17 14 11 10 8 7 7 7 8 10 17 13 14 17 18 24 32 23 22 17 12 9 9 9 10 12 13 12 6 6 6 6 8 12 19 28 23 16 12 12 8 8 6 6 8 8 10 13 8 8 8 8 10 8 8 8 8 10 6 8 8 9 9 10 10 9 9 8 10 10 9 10 11 14 9 9 10 9 9 6 6 6 6 8 11 12 11 11 10 10 9 9 9 9 9 10 9 11 10 10 10 6 8 8 8 17 6 6 6 8 8 8 7 6 6 6 6 6 8 8 6 8 6 6 7 10 11 11 11 11 9 9 9 8 8 8 6 7 9 9 9 15 18 14 14 14 14 16 16 16 8 8 8 8 8 8 8 8 8 8 8 8 17 11 9 9 8 8 7 6 6 8 8 9 9 8 8 9 8 8 8 8 8 8 8 6 10 8 10 11 11 10 9 14 10 10 10 3 0 0 0 3 7 14 19 11 10 10 10 10 8 8 7 8 10 19 12 9 9 9 10 8 11 8 3 0 0 0 0 3 8 17 17 11 3 0 0 3 8 8 7 3 0 3 3 0 3 9 9 9 10 16 25 28 31 26 26 10 10 9 9 10 10 10 12 14 19 19 19 13 8 8 8 8 8 8 15 13 9 10 10 8 8 8 12 13 14 10 10 10 9 11 8 11 9 10 10 10 11 3 0 3 18 11 11 8 8 8 8 6 8 9 10 8 8 8 9 12 13 12 12 9 9 9 9 11 8 9 9 9 6 8 6 6 8 8 6 6 8 8 9 8 8 7 3 0 3 9 9 10 9 9 9 9 10 9 6 6 6 6 8 8 8 8 8 10 10 10 9 6 6 6 6 10 10 7 7 8 8 9 17 18 18 9 9 9 3 0 0 3 7 6 6 7 6 6 6 6 6 6 11 15 7 9 9 10 13 10 8 8 8 8 8 8 7 8 8 11 13 8 8 8 8 8 13 8 8 8 8 8 8 8 8 8 8 8 8 10 9 11 9 8 11 8 8 8 10 11 9 9	Open. Hide. 0 3 10 10 10 10 9 9 9 15 3 0 0 0 0 3 9 9 6 6 6 6 6 6 6 6 8 6 6 6 6 8 10 11 8 8 9 8 11 12 19 19 20 22 21 21 30 28 22 19 10 10 19 23 28 35 37 37 37 37 29 28 35 35 36 36 36 50 50 50 50 42 41 27 27 9 9 11 9 11 6 7 6 8 8 8 13 13 14 14 19 29 37 48 50 53 53 53 53 53 53 50 50 50 50 36 36 35 31 31 31 30 28 28 21 10 9 9 9 10 15 10 14 19 26 32 37 40 37 30 25 13 11 8 8 10 13 27 43 47 50 50 41 41 53 53 53 53 57 59 59 57 57 57 57 57 57 59 59 59 53 50 42 42 47 47 68 68 68 68 68 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 47 47 47 50 51 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 59 59 68 68 68 68 59 59 59 59 57 68 68 68 57 57 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 52 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 68 62 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 57 57 57 59 59 68 68 68 68 68 68 41 41 15 21 12 13 14 18 16 38 38 57 44 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 59 57 57 57 57 57 44 44 43 43 35 38 42 43 59 59 59 59 59 59 57 57 57 57 57 57 68 68 68 57 57 59 59 59 59 59 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 54 59 59 59 59 59 59 57 57 57 68 68 68 68 68 68 68 68 57 57 48 48 48 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 48 47 59 59 59 59 59 44 37 37 44 44 44 59 59 50 39 41 44 47 47 57 57 57 57 59 59 59 59 59 59 59 57 48 48 48 57 43 59 59 59 59 57 50 47 41 41 37 42 42 47 34 37 30 25 25 34 34 37 39 40 41 41 50 48 48 48 48 57 57 57 57 59 57 43 39 34 43 43 43 43 57 43 43 43 42 42 42 48 48 46 54 57 59 43 39 30 30 33 37 43 48 48 48 57 46 43 39 43 26 26 20 20 23 34 36 48 34 34 34 30 28 34 34 46 47 59 30 28 13 13 13 21 28 27 34 28 25 25 34 28 35 28 34 25 28 28 37 37 43 39 37 37 39 32 30 30 37 37 32 32 39 32 32 27 19 19 24 23 18 22 31 32 37 37 37 30 22 25 20 20 23 14 18 11 23 17 34 34 29 25 15 14 14 21 21 28 33 29 24 17 15 9 9 10 17 10 10 8 8 8 10 22 31 36 39 47 37 37 39 39 39 37 39 26 22 10 10 10 10 13 12 12 15 15 27 23 16 12 10 10 8 8 8 8 8 8 15 16 16 21 19 15 11 15 10 10 10 10 11 11 11 11 13 8 8 8 8 8 9 10 10 12 9 10 9 10 10 11 13 13 15 11 11 12 16 15 13 10 10 10 13 18 14 15 10 10 10 8 10 12 12 10 15 11 10 10 9 8 8 8 13 13 9 15 12 12 12 12 12 12 11 11 8 8 13 8 8 8 16 15 15 10 9 9 9 9 16 15 12 12 8 8 8 10 15 17 15 12 10 10 10 13 15 19 10 13 9 9 10 13 10 8 8 8 8 8 10 13 10 9 9 9 9 9 9 8 8 6 6 8 8 8 8 8 10 10 8 8 10 8 10 9 9 8 8 6 6 8 8 8 8 10 10 9 9 9 8 8 7 7 12 8 10 12 13 11 10 10 11 11 11 11 12 12 11 11 11 11 8 8 6 6 10 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 9 10 10 9 9 9 9 10 8 8 8 8 10 12 8 7 8 8 10 11 10 8 8 11 8 8 10 19 11 10 9 8 8 10 8 8 8 10 10 10 10 13 10 10 10 8 8 8 8 8 7 9 10 10 11 11 11 11 11 11 16 15 22 19 19 19 21 13 10 10 10 15 19 13 13 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 18 9 9 9 9 10 10 13 13 15 9 8 8 8 7 8 8 6 8 7 7 8 8 8 8 8 8 8 8 11 11 8 9 9 16 14 8 8 6 6 8 8 9 14 14 10 8 8 8 8 8 7 7 10 10 8 8 8 6 6 6 6 8 8 11 11 8 8 10 10 8 8 9 8 8 8 6 6 6 6 12 13 19 12 10 10 9 15 9 10 10 15 17 16 10 8 8 8 8 8 8 9 8 13 19 9 11 10 7 6 8 8 6 6 8 8 6 6 8 8 8 8 8 8 6 7 10 7 8 8 8 8 8 8 8 11 11 11 8 8 6 6 8 8 8 8 8 8 8 12 13 8 9 10 7 6 8 8 13 12 11 11 8 8 8 6 13 6 6 8 8 6 6 8 8 9 9 9 7 7 8 10 8 8 8 8 8 7 7 7 6 8 6 6 8 8 7 8 8 6 6 8 10 10 9 9 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no332_g13.b1 MSMg01no332_g13.b1 CHROMAT_FILE:
MSMg01no332_g13.b1 PHD_FILE: MSMg01no332_g13.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:18:49 2005
         (571 letters)



>mm_chr9_56850762_56851732
          Length = 971

 Score =  774 bits (400), Expect = 0.0
 Identities = 412/416 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   ataggcgatgtctcggaaaagcccctattaaacatcatgaatcatttggtccttgacgtc 60
           ||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 416 ataggcgatgtctcggaaaagcctcaatttaacatcatgaatcatttggtccttgacgtc 357

                                                                       
Query: 61  tggttccttccagggggacagatgacatttagcacaggacatggaagtctgtgggaaagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 tggttccttccagggggacagatgacatttagcacaggacatggaagtctgtgggaaagg 297

                                                                       
Query: 121 aaagttcttagctacaagaaaggacaaacctctgaccttgggaaaagggccaaaaatctt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 296 aaagttcttagctacaagaaaggacaaacctctgaccttgggaaaagggccaaaaatctt 237

                                                                       
Query: 181 tgaagtcctcattacagcagttaaatatttaactttagccaggcggtgctaatacatgcc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 236 tgaagtcctcattacagcagttaaatatttaactttagccaggcggtgctaatacatgcc 177

                                                                       
Query: 241 tttaatcccagctctagggaggcagaggcaagtggatctctgtgagttcaaggccaacct 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176 tttaatcccagctctagggaggcagaggcaagtggatctctgtgagttcaaggccaacct 117

                                                                       
Query: 301 ggtctacaaaacaagttccaggacagctgctagggctacacagagaaaccctgagtcaaa 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 116 ggtctacaaaacaagttccaggacagctgctagggctacacagagaaaccctgagtcaaa 57

                                                                   
Query: 361 ataacaacaacaacaacacatatttaaaagaatctattatgaaaaaaaaacccaaa 416
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 56  ataacaacaacaacaacagatatttaaaagaatctattatgaaaaaaaaacccaaa 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 25
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 571
Length of database: 971
Length adjustment: 10
Effective length of query: 561
Effective length of database: 961
Effective search space:   539121
Effective search space used:   539121
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

Query= MSMg01no332_g13.g1 MSMg01no332_g13.g1 CHROMAT_FILE:
MSMg01no332_g13.g1 PHD_FILE: MSMg01no332_g13.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:18:49 2005
         (674 letters)



>mm_chr9_56687639_56688712
          Length = 1074

 Score = 1257 bits (650), Expect = 0.0
 Identities = 668/674 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   gaaagcaatggaatggtctctatcctgtgcgtgccaagagcactacagagaggcttctgc 60
           ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||
Sbjct: 201 gaaagcaatggaatggtctctatcctgtgtgtgccaagagcactagagagaggcttctgc 260

                                                                       
Query: 61  cccagcccagccacttgaccttgacaactcactggtttggggagtagggtaaaaggaccg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 cccagcccagccacttgaccttgacaactcactggtttggggagtagggtaaaaggaccg 320

                                                                       
Query: 121 cccttgagcctgctcagaagtatcaagtagaagcatcaacattctgaagccttgaaggtc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cccttgagcctgctcagaagtatcaagtagaagcatcaacattctgaagccttgaaggtc 380

                                                                       
Query: 181 cctcaaccttctcagtccccactgctcccagtcccttaggtcctccagctgctcctccct 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 cctcaaccttctcagtccccactgctcccagtcccttaggtcctccagctgctcctccct 440

                                                                       
Query: 241 gtgtcccctctgctctgctcactctctcctgcttctcctcttctccctgtcaggacaata 300
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 441 gtgtcccctctgctctgctcactttctcctgcttctcctcttctccctgtcaggataata 500

                                                                       
Query: 301 agaattaatggcgtcctcagtgtctgtctctgaacttccccagggaattaaatcccagac 360
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 agaattaatggcatcctcagtgtctgtctctgaacttccccagggaattaaatcccagac 560

                                                                       
Query: 361 ccttgagccctgttagagtccaagaaaaatgcatgtaagtgctctttgtgaaaatatgtg 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ccttgagccctgttagagtccaagaaaaatgcatgtaagtgctctttgtgaaaatatgtg 620

                                                                       
Query: 421 tgtatacaggcgtccttgcacagaaaggtgtcaccaatacccgctgggggttctgtctga 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 tgtatacaggcgtccttgcacagaaaggtgtcaccaatacccgctgggggttctgtctga 680

                                                                       
Query: 481 acccccaggtctgatctgtatgtgtctctaaatagcccaagcgtgcctgagctataagaa 540
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 acctccaggtctgatctgtatgtgtctctaaatagcccaagcgtgcctgagctataagaa 740

                                                                       
Query: 541 ttctgggtgtttgtgtaaatgcacatgcaactgctggcatgaaatttttacaatccttgt 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 ttctgggtgtttgtgtaaatgcacatgcaactgctggcatgaaatttttacaatccttgt 800

                                                                       
Query: 601 ggatctcaatgcatgcacagcaaatcatctgtgtgcaatgtctatgtgttaaatacaggc 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 801 ggatctcaatgcatgcacagcaaatcatctgtgtgcaatgtctatgtgttaaatacaggc 860

                         
Query: 661 ctgtgtgacaaggc 674
           ||||||||||||||
Sbjct: 861 ctgtgtgacaaggc 874


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 31
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 674
Length of database: 1074
Length adjustment: 10
Effective length of query: 664
Effective length of database: 1064
Effective search space:   706496
Effective search space used:   706496
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information