MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-380F16
Chromosome	9 (Build37)
Map Location	123,951,486 - 123,951,997
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Tgm4, Zdhhc3, Exosc7, Clec3b, Cdcp1, Tmem158, Scp2-ps2, Lars2, Limd1, Sacm1l, Slc6a20, Xtrp3s1, Ccr9, LOC100043855, Lztfl1, Fyco1, Cxcr6, Xcr1, LOC100040443, LOC100043858, LOC671399, Ccr1, Ccr1l1, Ccr3
Downstream gene	Ccr2, Ccr5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Snrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20623 MGI:108104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102566 MGI:2143103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67469 MGI:1914719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040193 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9530059O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319626 MGI:2442421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs

name	LOC666218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC671232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	D9Ertd402e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382117 MGI:1196217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235682 MGI:2143340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Zfp167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382118 MGI:3040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 10 Proteins

name	EG666257 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666257 MGI:3645415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Zfp660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623911 MGI:3643882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Zfp105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22646 MGI:1277119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110059G10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66202 MGI:1913452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209737 MGI:1098258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66079 MGI:1277176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331046 MGI:3027002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69035 MGI:1926134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66446 MGI:1913696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21922 MGI:104540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdcp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109332 MGI:2442010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem158 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72309 MGI:1919559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scp2-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20282 MGI:107679
definition	note : sterol carrier protein 2, pseudogene 2 pseudo : _no_value

name	Lars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102436 MGI:2142973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Limd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29806 MGI:1352502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sacm1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83493 MGI:1933169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22599 MGI:1336891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xtrp3s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102680 MGI:2143217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12769 MGI:1341902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043855 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 815 ESTs, 55 Proteins

name	Lztfl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93730 MGI:1934860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fyco1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17281 MGI:107277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxcr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80901 MGI:1934582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xcr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23832 MGI:1346338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040443 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 105 ESTs, 11 Proteins

name	LOC671399 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ccr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12768 MGI:104618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12770 MGI:104617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12771 MGI:104616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12772 MGI:106185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12774 MGI:107182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526941 GeneID:20623 MGI:108104
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF related kinase transcript_id : NM_133741.1

name	Tmem16k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802585 GeneID:102566 MGI:2143103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16K transcript_id : NM_133979.2

name	Abhd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88703067 GeneID:67469 MGI:1914719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 5 transcript_id : NM_026179.2

name	9530059O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260358 GeneID:319626 MGI:2442421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs product : RIKEN cDNA 9530059O14 gene transcript_id : XM_982329.2

name	LOC666218 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260359 GeneID:666218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : gene model 847, (NCBI) transcript_id : XM_982360.2

name	LOC671232 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260361 GeneID:671232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to hCG1790160 transcript_id : XM_001474362.1

name	D9Ertd402e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61696135 GeneID:382117 MGI:1196217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 9, ERATO Doi 402, expressed transcript_id : NM_001013405.1

name	Zfp445 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896628 GeneID:235682 MGI:2143340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 445 transcript_id : NM_173364.4

name	LOC623874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260363 GeneID:623874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC623874 transcript_id : XM_356204.6

name	Zfp167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260365 GeneID:382118 MGI:3040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 10 Proteins product : zinc finger protein 167 transcript_id : XM_001474510.1

name	EG666257 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386609 GeneID:666257 MGI:3645415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG666257 transcript_id : XM_982630.1

name	Zfp105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374172 GeneID:22646 MGI:1277119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 105 transcript_id : NM_009544.2

name	1110059G10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360114 GeneID:66202 MGI:1913452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110059G10 gene transcript_id : NM_025419.3

name	Kif15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930324 GeneID:209737 MGI:1098258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 15 transcript_id : NM_010620.1

name	Tmem42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370779 GeneID:66079 MGI:1277176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 42 transcript_id : NM_025339.3

name	Tgm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344020 GeneID:331046 MGI:3027002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 4 (prostate) transcript_id : NM_177911.3

name	Zdhhc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328460 GeneID:69035 MGI:1926134
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 3 transcript_id : NM_026917.4

name	Exosc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487126 GeneID:66446 MGI:1913696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 7 transcript_id : NM_001081188.1

name	Clec3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755820 GeneID:21922 MGI:104540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 3, member b transcript_id : NM_011606.1

name	Cdcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129908 GeneID:109332 MGI:2442010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUB domain containing protein 1 transcript_id : NM_133974.3

name	Tmem158 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116805335 GeneID:72309 MGI:1919559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 158 transcript_id : NM_001002267.2

name	Lars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130101 GeneID:102436 MGI:2142973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucyl-tRNA synthetase, mitochondrial transcript_id : NM_153168.2

name	Limd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305236 GeneID:29806 MGI:1352502
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domains containing 1 transcript_id : NM_013860.1

name	Sacm1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375344 GeneID:83493 MGI:1933169
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAC1 (suppressor of actin mutations 1, homolog)-like (S. cerevisiae) transcript_id : NM_030692.2

name	Slc6a20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981420 GeneID:22599 MGI:1336891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter), member 20 transcript_id : NM_011731.2

name	Xtrp3s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20982824 GeneID:102680 MGI:2143217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X transporter protein 3 similar 1 gene transcript_id : NM_139142.1

name	Ccr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802430 GeneID:12769 MGI:1341902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 9 transcript_id : NM_009913.3

name	LOC100043855 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260415 GeneID:100043855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 815 ESTs, 55 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A1 transcript_id : XM_001481145.1

name	Lztfl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543134 GeneID:93730 MGI:1934860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper transcription factor-like 1 transcript_id : NM_033322.2

name	Fyco1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22779867 GeneID:17281 MGI:107277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE and coiled-coil domain containing 1 transcript_id : NM_148925.1

name	Cxcr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369009 GeneID:80901 MGI:1934582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) receptor 6 transcript_id : NM_030712.3

name	Xcr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362126 GeneID:23832 MGI:1346338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C motif) receptor 1 transcript_id : NM_011798.3

name	LOC100043858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260528 GeneID:100043858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 105 ESTs, 11 Proteins product : similar to Chain , P19-Ink4d From Mouse, Nmr, 20 Structures transcript_id : XM_001481149.1

name	LOC671399 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260526 GeneID:671399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC671399 transcript_id : XM_001474726.1

name	Ccr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380627 GeneID:12768 MGI:104618
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 1 transcript_id : NM_009912.3

name	Ccr1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262146 GeneID:12770 MGI:104617
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 1-like 1 transcript_id : NM_007718.2

name	Ccr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378618 GeneID:12771 MGI:104616
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 3 transcript_id : NM_009914.3

name	Ccr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753465 GeneID:12772 MGI:106185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 2 transcript_id : NM_009915.1

name	Ccr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227246 GeneID:12774 MGI:107182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 5 transcript_id : NM_009917.3

name	Snrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526942 CCDS:CCDS23644.1 GeneID:20623 MGI:108104
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SNF related kinase protein_id : NP_598502.1

name	Tmem16k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794236 CCDS:CCDS23645.1 GeneID:102566 MGI:2143103
definition	codon_start : 1 product : hypothetical protein LOC102566 protein_id : NP_598740.1

name	Abhd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385690 CCDS:CCDS23646.1 GeneID:67469 MGI:1914719
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005811 - lipid particle [Evidence IDA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : abhydrolase domain containing 5 protein_id : NP_080455.1

name	9530059O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386602 GeneID:319626 MGI:2442421
definition	codon_start : 1 product : hypothetical protein LOC319626 protein_id : XP_987423.1

name	LOC666218 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260360 GeneID:666218
definition	codon_start : 1 product : similar to hCG1643239 protein_id : XP_987454.2

name	LOC671232 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260362 GeneID:671232
definition	codon_start : 1 product : similar to hCG1790160 protein_id : XP_001474412.1

name	D9Ertd402e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61696136 CCDS:CCDS23647.1 GeneID:382117 MGI:1196217
definition	codon_start : 1 product : hypothetical protein LOC382117 protein_id : NP_001013423.1

name	Zfp445 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71896629 CCDS:CCDS23648.1 GeneID:235682 MGI:2143340
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 445 protein_id : NP_775540.3

name	LOC623874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260364 GeneID:623874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_356204.6

name	Zfp167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260366 GeneID:382118 MGI:3040678
definition	codon_start : 1 product : similar to Zfp167 protein protein_id : XP_001474560.1

name	EG666257 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386610 GeneID:666257 MGI:3645415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987724.1

name	Zfp105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374173 CCDS:CCDS23649.1 GeneID:22646 MGI:1277119
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 105 protein_id : NP_033570.2

name	1110059G10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541808 CCDS:CCDS23650.1 GeneID:66202 MGI:1913452
definition	codon_start : 1 product : hypothetical protein LOC66202 protein_id : NP_079695.2

name	Kif15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930325 CCDS:CCDS23651.1 GeneID:209737 MGI:1098258
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : kinesin 15; N-10 kinesin product : kinesin-like 7 protein_id : NP_034750.1

name	Tmem42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384708 CCDS:CCDS23652.1 GeneID:66079 MGI:1277176
definition	codon_start : 1 product : transmembrane protein 42 protein_id : NP_079615.1

name	Tgm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244550 CCDS:CCDS23653.1 GeneID:331046 MGI:3027002
definition	GO_function : GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 exception : mismatches in translation note : experimental autoimmune prostatitis antigen 1 product : transglutaminase 4 (prostate) protein_id : NP_808579.1

name	Zdhhc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754040 CCDS:CCDS23654.1 GeneID:69035 MGI:1926134
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA]; GO:0006605 - protein targeting [Evidence IDA] codon_start : 1 note : GABA-A receptor-associated membrane protein 1 product : zinc finger, DHHC domain containing 3 protein_id : NP_081193.2

name	Exosc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487127 GeneID:66446 MGI:1913696
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000175 - 3'-5'-exoribonuclease activity [Evidence ISS] [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006401 - RNA catabolism [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] [Evidence ISS] codon_start : 1 product : exosome component 7 protein_id : NP_001074657.1

name	Clec3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755821 CCDS:CCDS23656.1 GeneID:21922 MGI:104540
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS]; GO:0005615 - extracellular space [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0005529 - sugar binding [Evidence TAS] GO_process : GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 exception : mismatches in translation note : tetranectin (plasminogen-binding protein); tetranectin (plasminogen binding protein) product : C-type lectin domain family 3, member b protein_id : NP_035736.1

name	Cdcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098143 CCDS:CCDS23657.1 GeneID:109332 MGI:2442010
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : CUB domain-containing protein 1 protein_id : NP_598735.2

name	Tmem158 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116805336 CCDS:CCDS23658.1 GeneID:72309 MGI:1919559
definition	codon_start : 1 note : BINP binding protein p40BBP; brain injury-derived neurotrophic peptide (BINP) binding protein product : Ras-induced senescence 1 protein_id : NP_001002267.2

name	Lars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346617 CCDS:CCDS23659.1 GeneID:102436 MGI:2142973
definition	EC_number : 6.1.1.4 GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : leucyl-tRNA synthetase, mitochondrial protein_id : NP_694808.1

name	Limd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305237 CCDS:CCDS23660.1 GeneID:29806 MGI:1352502
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : LIM domains containing 1 protein_id : NP_038888.1

name	Sacm1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507622 GeneID:83493 MGI:1933169
definition	codon_start : 1 note : polyphosphatidylinositol phosphatase; SAC1 product : SAC1 (supressor of actin mutations 1, homolog)-like protein_id : NP_109617.1

name	Slc6a20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981421 CCDS:CCDS23661.1 GeneID:22599 MGI:1336891
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence TAS] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : X transporter protein 3 product : solute carrier family 6 (neurotransmitter transporter), member 20 protein_id : NP_035861.2

name	Xtrp3s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982825 GeneID:102680 MGI:2143217
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : X transporter protein 3 similar 1 protein_id : NP_631881.1

name	LOC100043855 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260416 GeneID:100043855
definition	codon_start : 1 product : similar to heterogeneous nuclear ribonucleoprotein A1 protein_id : XP_001481195.1

name	Lztfl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15277319 GeneID:93730 MGI:1934860
definition	codon_start : 1 product : leucine zipper transcription factor-like 1 protein_id : NP_201579.1

name	Ccr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753462 CCDS:CCDS23662.1 GeneID:12769 MGI:1341902
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : chemokine (C-C motif) receptor 9 protein_id : NP_034043.1

name	Fyco1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779868 GeneID:17281 MGI:107277
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : maternal embryonic message 2 product : FYVE and coiled-coil domain containing 1 protein_id : NP_683727.1

name	Cxcr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793404 CCDS:CCDS23664.1 GeneID:80901 MGI:1934582
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IEA]; GO:0016494 - C-X-C chemokine receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chemokine (C-X-C) receptor 6 product : chemokine (C-X-C motif) receptor 6 protein_id : NP_109637.2

name	Xcr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753330 CCDS:CCDS23665.1 GeneID:23832 MGI:1346338
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C motif) XC receptor 1; C motif-1/lymphotactin receptor product : chemokine (C motif) receptor 1 protein_id : NP_035928.1

name	LOC100043858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260529 GeneID:100043858
definition	codon_start : 1 product : similar to Chain , P19-Ink4d From Mouse, Nmr, 20 Structures protein_id : XP_001481199.1

name	LOC671399 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260527 GeneID:671399
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474776.1

name	Ccr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542352 CCDS:CCDS23666.1 GeneID:12768 MGI:104618
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0030595 - leukocyte chemotaxis [Evidence IMP] [Evidence IDA]; GO:0030099 - myeloid cell differentiation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chemokine (C-C) receptor 1; MIP-1 alphaR; MIP-1 alpha R product : chemokine (C-C motif) receptor 1 protein_id : NP_034042.2

name	Ccr1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262147 CCDS:CCDS23667.1 GeneID:12770 MGI:104617
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004950 - chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chemokine (C-C) receptor 1-like 1; macrophage inflammatory protein-1 alpha receptor-like 1; MIP-1 alphaRL1 product : chemokine (C-C motif) receptor 1-like 1 protein_id : NP_031744.2

name	Ccr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542354 CCDS:CCDS23668.1 GeneID:12771 MGI:104616
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chemokine (C-C) receptor 1,-like 2; MIP-1 alphaRL2; chemokine (C-C) receptor 3 product : CC chemokine receptor 3 protein_id : NP_034044.2

name	Ccr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753466 CCDS:CCDS23669.1 GeneID:12772 MGI:106185
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0019955 - cytokine binding [Evidence IPI]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006968 - cellular defense response [Evidence IMP]; GO:0006935 - chemotaxis [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0006959 - humoral immune response [Evidence IMP]; GO:0006955 - immune response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0030334 - regulation of cell migration [Evidence IMP]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MIP-1 alphaR; chemoattractant protein-1 receptor; chemokine (C-C) receptor 2 product : chemokine (C-C motif) receptor 2 protein_id : NP_034045.1

name	Ccr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542356 GeneID:12774 MGI:107182
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA] [Evidence ISS]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006952 - defense response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-C) receptor 5 product : chemokine (C-C motif) receptor 5 protein_id : NP_034047.2

name	LOC100040193 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040193
definition	number : 1 pseudo : _no_value

name	LOC100040193 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040193
definition	number : 2 pseudo : _no_value

name	LOC100040204 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040204
definition	number : 2 pseudo : _no_value

name	LOC100040204 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040204
definition	number : 1 pseudo : _no_value

name	LOC100040443 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040443
definition	number : 1 pseudo : _no_value

name	Zfp660 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260367 GeneID:623911 MGI:3643882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : zinc finger protein 660 pseudo : _no_value transcript_id : XR_031805.1

clone name	MSMg01-442H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153C14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-511J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-460O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-380F16.T7 (MSMg01no380_f16.b1)	MSMg01-380F16.TJ (MSMg01no380_f16.g1)
ACC	AG484750	AG484751
length	744	746
length of high quality (start - end)	516 (41 - 556)	490 (69 - 558)
definition	CHROMAT_FILE: MSMg01no380_f16.b1 PHD_FILE: MSMg01no380_f16.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:21:24 2005	CHROMAT_FILE: MSMg01no380_f16.g1 PHD_FILE: MSMg01no380_f16.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:21:24 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTC AGGGCTTCCTACATGCTAGGCAATTTTTCTATTATCAGGCTACATCCACA GCGCTGGAGAGCACGTTGCTGTCTTGTGACAGGACTAAGATATTACTAGA TGACTTGCTCCATTCTGGTCTGCAGGGACTTCACTATCACAACTTCTAGT GGGATACTGCAATGGGTCATACTGTCATCAGAACTGTACTGACTGAATTT GGGTAGTAGGAGTAACAAAAATCCTGAATGTGGTGATACATATCTGACAA TGACAAATAAACCCAGAGGAAATACCAGCCTCCTGTTTTAGGGAAGAGCA TAAAGTTTGATGATCTAGGGCCTTAGAAGACAATCTCTTCAAAGCTAAGG ACTGGAGGAGGTGGAGATGGGATAGTACAGGTAATCTATGGCTGCATAAC AATGTGTAAGCAAACTAGCTTAAAACAACTGTACTTATTTGATTTCCTTT CCATTTTTGAGGGCTGCACCAGAGAAGGACTATGAATGATAATCTATAAG AGGTGAACAAAGACCAAAAGCATGTCTCTTGCGGGAGGCAAGAAGGAGTC TATCCCCAGGCTGATCATTCTTGTGAGCTGAGGATGGCAGGATACTGGGA TCAAGATAAAGCTGGTATGAATGGTTTGGCTTGGTGCCTTCCTTAAGCTT TATGGAATTTAATCCGGGCGGACCATTTTCCTCCATGAGACTGG	GCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXTAATTACTGTTGGTGAGATTAAATGTTGATTC AGCCACTATGGAAACCAGTGAGAAGTAGTCTAGAGAGTAGGATAATAGGA GATATATGCTGTAAGAGAGATTACAGGAATAATGGATAATAGAAGAATAA TAAACTTAGACTGAGGAGGGATAGGAAGTAAAATTCAGGATAGTGAATAA GGACTGATAAATAACATAAAGAACAAAAGAGCCATAGTGAAAAATATTAT TATACAGTATTGTGATAAATTATTTTATAATGTATATGTATAGAATGTAC TTATATTCTCTATTTGTATTTATTCATGTCTAAGTTATTTCTTATTTCTA TGATAAGATACTATGATCAAAGCAATGTATAGAAAACAGTGTTCATTGAG GGTTTACAGTTTCAGGGAGTGAGCCAATACCACCATGTTATGGAGTATGG CTCAGGCAGACAGGCATAGCACGGGTATAGAGCTTACACCCTTATCTGTG AAGAATTGTGTTGGAATTTTGATGTCTTTTGATGAATCTGTATATGGGAA TTTTTGGTATTTAACAGGGAATCCTGTTAACTGGGGTATAGGACTTTGTA CTTGTGAGTACCGATTAAAGTTGTCCCCACGCTCCGCAAACTGTTTTGTT TCTGGCCCCCCATTCCCTTTCAATGGCGCACCCCATTTCCCTTTTT
quality values	Open. Hide. 11 11 21 23 28 22 18 18 18 17 16 23 10 10 9 9 9 19 23 34 22 11 17 15 13 7 11 11 17 17 11 11 11 12 12 16 16 24 27 29 30 47 47 44 29 23 22 28 29 29 27 18 12 9 9 9 11 11 9 9 11 17 18 30 33 39 47 43 39 47 53 53 53 53 53 53 59 59 59 59 59 59 59 57 57 57 57 57 68 68 48 48 36 41 41 42 41 41 47 47 50 50 57 68 68 68 57 57 54 54 57 57 57 57 57 57 57 59 57 68 68 68 68 68 68 68 68 68 68 68 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 57 57 68 68 68 68 57 44 43 30 18 13 12 15 13 13 13 24 38 44 57 68 57 57 57 57 59 59 59 57 57 59 59 59 59 59 68 68 68 68 68 68 68 68 59 59 57 68 68 57 57 57 54 54 57 57 57 57 57 59 59 57 57 68 68 57 57 57 59 59 59 54 54 59 59 59 59 57 57 57 57 57 57 57 50 57 57 57 50 50 37 37 44 57 47 47 42 47 35 37 42 59 59 57 57 57 57 43 43 36 36 28 28 28 36 38 57 57 57 57 47 54 54 54 54 57 57 54 54 54 54 54 57 59 68 68 68 68 68 59 57 57 57 57 57 57 59 59 57 57 57 43 43 43 43 43 59 43 48 43 43 43 48 50 43 43 39 35 35 35 37 39 34 34 41 41 41 41 41 41 47 48 59 48 48 57 57 57 57 57 48 48 48 48 48 57 57 48 39 39 39 39 48 48 41 41 47 47 47 43 41 29 25 25 27 26 28 22 20 20 23 20 20 28 28 35 35 31 24 32 28 31 30 37 37 40 48 37 37 37 39 37 31 30 30 28 24 15 25 22 30 30 29 30 17 12 11 9 9 9 13 21 19 18 18 18 23 23 23 22 30 24 13 11 8 8 8 11 17 19 13 6 6 6 7 7 9 9 9 10 9 9 17 15 20 20 26 30 32 30 30 26 17 11 8 8 8 8 10 12 24 22 17 13 9 9 8 8 8 8 10 8 12 15 15 22 22 24 23 13 15 11 8 8 9 8 8 8 10 10 10 11 10 10 10 13 12 12 13 13 11 8 8 8 10 10 9 9 9 9 9 13 15 10 8 8 10 8 10 9 9 10 11 9 8 9 8 12 11 12 10 10 13 10 9 9 11 10 10 10 10 8 8 8 8 8 8 8 10 12 13 10 10 10 12 10 12 12 10 15 10 8 8 8 10 21 13 17 8 8 8 9 10 11 18 13 10 9 9 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8	Open. Hide. 8 8 8 8 7 7 6 6 10 12 12 34 33 39 41 39 32 32 32 28 28 37 23 19 18 9 9 7 6 6 8 8 12 10 13 10 19 19 37 37 39 32 26 14 14 17 27 26 41 25 22 9 6 6 6 6 7 10 23 25 41 46 33 33 23 22 14 16 18 26 26 57 57 53 53 53 53 53 53 53 53 53 53 53 53 68 57 57 57 51 47 47 47 51 68 68 68 47 42 41 41 41 41 47 54 54 54 57 68 57 59 68 57 57 57 57 57 57 57 57 68 68 50 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 50 50 50 50 50 50 68 68 68 68 48 48 46 46 46 48 50 50 50 50 68 68 68 68 68 68 68 68 48 48 48 48 48 50 59 57 68 50 50 51 51 68 68 68 68 68 68 68 68 57 57 68 68 68 68 57 57 57 57 57 57 68 57 57 57 57 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 38 38 35 41 39 43 38 43 44 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 44 44 43 44 44 59 59 57 57 57 54 54 54 54 54 57 59 59 59 59 59 59 59 68 68 68 68 68 68 57 54 54 50 50 57 57 57 48 48 48 57 57 57 57 53 50 57 57 57 48 48 48 41 37 41 37 37 37 41 37 30 39 39 39 39 47 47 41 41 43 43 43 59 59 59 48 48 48 48 46 46 46 43 44 44 44 41 37 41 41 47 41 41 37 37 39 39 39 39 37 37 44 59 41 41 41 41 41 48 48 46 46 40 39 41 41 35 32 30 32 23 23 32 34 41 40 40 40 39 37 37 30 30 29 31 43 43 43 41 41 30 28 14 14 14 27 22 35 31 31 26 26 14 14 14 15 15 27 16 18 20 20 15 19 33 28 19 21 11 11 11 15 13 21 11 12 11 11 9 9 9 10 10 10 8 8 9 11 11 23 18 15 15 10 10 10 12 20 27 27 22 14 14 14 18 16 15 8 8 8 8 8 8 8 8 8 8 8 7 7 6 7 10 8 9 9 9 18 18 17 18 10 8 8 8 6 7 11 10 11 11 11 11 11 12 11 13 17 11 12 12 12 12 9 8 8 8 8 8 8 8 8 15 19 10 12 8 7 8 8 9 8 8 6 6 8 8 8 8 8 10 11 11 10 10 10 11 11 11 12 15 15 13 12 14 16 16 12 12 12 19 21 15 13 11 10 10 11 15 15 18 17 10 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 12 11 9 9 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no380_f16.b1 MSMg01no380_f16.b1 CHROMAT_FILE:
MSMg01no380_f16.b1 PHD_FILE: MSMg01no380_f16.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:21:24 2005
         (516 letters)



>mm_chr9_123951282_123952197
          Length = 916

 Score =  907 bits (469), Expect = 0.0
 Identities = 502/513 (97%), Gaps = 2/513 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   gaattcaggg-cttcctacatgctaggcaatttttctattatcaggctacatccacagcg 63
           |||||||||| |||  ||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 205 gaattcagggcctt-gtacatgctatgcaatttttctattatcaggctacatccacagcg 263

                                                                       
Query: 64  ctggagagcacgttgctgtcttgtgacaggactaagatattactagatgacttgctccat 123
           |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 264 ctggagagcatgttgctgtcttgtgacaggactaagatattactagatgacttgctccgt 323

                                                                       
Query: 124 tctggtctgcagggacttcactatcacaacttctagtgggatactgcaatgggtcatact 183
           |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 324 tctggtctgcagggacctcactatcacaacttctactgggatactgcaatgggtcatact 383

                                                                       
Query: 184 gtcatcagaactgtactgactgaatttgggtagtaggagtaacaaaaatcctgaatgtgg 243
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 384 gtcatcagaactgtactgactgaatttgagtagtaggagtaacaaaaatcctgaatgtgg 443

                                                                       
Query: 244 tgatacatatctgacaatgacaaataaacccagaggaaataccagcctcctgttttaggg 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 tgatacatatctgacaatgacaaataaacccagaggaaataccagcctcctgttttaggg 503

                                                                       
Query: 304 aagagcataaagtttgatgatctagggccttagaagacaatctcttcaaagctaaggact 363
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 504 aagagcataaagtttgatgatctagggccttagaagacaatctcttcaaagctaaggact 563

                                                                       
Query: 364 ggaggaggtggagatgggatagtacaggtaatctatggctgcataacaatgtgtaagcaa 423
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 564 ggaggaggtggagatgggatagtacaggtaatctatggctgcataacaatgtgtacgcaa 623

                                                                       
Query: 424 actagcttaaaacaactgtacttatttgatttcctttccatttttgagggctgcaccaga 483
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 624 actagcttaaaacaactgtacttatttgatttcctttccatttttgagggctgcaccaga 683

                                            
Query: 484 gaaggactatgaatgataatctataagaggtga 516
           ||||| |||||||||||||||||||||||||||
Sbjct: 684 gaagggctatgaatgataatctataagaggtga 716


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 20
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 516
Length of database: 916
Length adjustment: 10
Effective length of query: 506
Effective length of database: 906
Effective search space:   458436
Effective search space used:   458436
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information