MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-514D05
Chromosome	9 (Build37)
Map Location	109,564,592 - 109,565,043
singlet/doublet	singlet
Overlap gene	E330001B16Rik
Upstream gene	Slc25a20, Prkar2a, Ihpk2, Nckipsd, Celsr3, Slc26a6, LOC100038959, Tmem89, Uqcrc1, Col7a1, Pfkfb4, Scotin, Trex1, 6620401K05Rik, Ccdc72, Ccdc51, EG665413, Plxnb1, E330009P21Rik, Fbxw13, Fbxw12, Fbxw14, LOC668758, EG382156, Fbxw16, Fbxw19, LOC635668, Fbxw15, EG382106
Downstream gene	C85627, EG382109, 1700124P09Rik, Spink8, 3000002C10Rik, Nme6, Camp, Cdc25a, LOC100043782, Mtap4, LOC100049540, Dhx30, Smarcc1, Rn4.5s-ps2, Cspg5, Tmem103, Scap, Ptpn23, Ngp, Klhl18, Kif9, Setd2, Nradd, Nbeal2, Ccdc12
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc25a20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57279 MGI:1928738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkar2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19087 MGI:108025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ihpk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76500 MGI:1923750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nckipsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80987 MGI:1931834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Celsr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107934 MGI:1858236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171429 MGI:2159728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038959 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs

name	Tmem89 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69384 MGI:1916634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Uqcrc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22273 MGI:107876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12836 MGI:88462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkfb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270198 MGI:2687284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scotin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66940 MGI:1915044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trex1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22040 MGI:1328317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	6620401K05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235610 MGI:1925349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66167 MGI:1913417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66658 MGI:1913908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665413 MGI:3643956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Plxnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235611 MGI:2154238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330009P21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320082 MGI:2443323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211305 MGI:3505590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434440 MGI:3584372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50757 MGI:1354703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 136 ESTs, 17 Proteins

name	EG382156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382156 MGI:3643290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 13 Proteins

name	Fbxw16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320083 MGI:2443324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235612 MGI:3505706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC635668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	Fbxw15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382105 MGI:3505701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382106 MGI:3646659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330001B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546160 MGI:3588266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 9 Proteins

name	C85627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546161 MGI:3034520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382109 MGI:3646662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700124P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 15 Proteins

name	Spink8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78709 MGI:1925959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3000002C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378954 MGI:3036226
definition	note : RIKEN cDNA 3000002C10 gene pseudo : _no_value

name	Nme6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54369 MGI:1861676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12796 MGI:108443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12530 MGI:103198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Mtap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17758 MGI:97178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100049540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100049540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 ESTs, 13 Proteins pseudo : _no_value

name	Dhx30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72831 MGI:1920081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20588 MGI:1203524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rn4.5s-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19801 MGI:97948
definition	note : 4.5s RNA, pseudogene 2 pseudo : _no_value

name	Cspg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29873 MGI:1352747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72341 MGI:1919349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 43 ESTs, 3 Proteins

name	Scap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235623 MGI:2135958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104831 MGI:2144837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18054 MGI:105983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270201 MGI:2143315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16578 MGI:1098237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235626 MGI:1918177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nradd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67169 MGI:1914419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nbeal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235627 MGI:2448554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 83 ESTs, 3 Proteins

name	Ccdc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72654 MGI:1919904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356864 GeneID:57279 MGI:1928738
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 transcript_id : NM_020520.3

name	Prkar2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130621 GeneID:19087 MGI:108025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, cAMP dependent regulatory, type II alpha transcript_id : NM_008924.2

name	Ihpk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037446 GeneID:76500 MGI:1923750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol hexaphosphate kinase 2 transcript_id : NM_029634.1

name	Nckipsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892390 GeneID:80987 MGI:1931834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NCK interacting protein with SH3 domain transcript_id : NM_030729.4

name	Celsr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719164 GeneID:107934 MGI:1858236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin EGF LAG seven-pass G-type receptor 3 transcript_id : NM_080437.2

name	Slc26a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133779000 GeneID:171429 MGI:2159728
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 6 transcript_id : NM_134420.3

name	LOC100038959 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260321 GeneID:100038959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs product : similar to chloride-formate exchanger transcript_id : XM_001471980.1

name	Tmem89 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260323 GeneID:69384 MGI:1916634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : transmembrane protein 89 transcript_id : XM_135161.4

name	Uqcrc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46593020 GeneID:22273 MGI:107876
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquinol-cytochrome c reductase core protein 1 transcript_id : NM_025407.2

name	Col7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115647998 GeneID:12836 MGI:88462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VII, alpha 1 transcript_id : NM_007738.3

name	Pfkfb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120327 GeneID:270198 MGI:2687284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 4 transcript_id : NM_173019.5

name	Scotin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892939 GeneID:66940 MGI:1915044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scotin gene transcript_id : NM_025858.2

name	Scotin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367784 GeneID:66940 MGI:1915044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scotin gene transcript_id : NM_026381.2

name	Trex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59624978 GeneID:22040 MGI:1328317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : three prime repair exonuclease 1 transcript_id : NM_011637.6

name	Trex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59624980 GeneID:22040 MGI:1328317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : three prime repair exonuclease 1 transcript_id : NM_001012236.1

name	6620401K05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356371 GeneID:235610 MGI:1925349
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6620401K05 gene transcript_id : NM_172774.2

name	Ccdc72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384868 GeneID:66167 MGI:1913417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 72 transcript_id : NM_183250.2

name	Ccdc51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377296 GeneID:66658 MGI:1913908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 51 transcript_id : NM_025689.2

name	EG665413 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386569 GeneID:665413 MGI:3643956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG665413 transcript_id : XM_976757.1

name	Plxnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370139 GeneID:235611 MGI:2154238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin B1 transcript_id : NM_172775.1

name	E330009P21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388093 GeneID:320082 MGI:2443323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330009P21 gene transcript_id : NM_177069.3

name	Fbxw13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299748 GeneID:211305 MGI:3505590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 13 transcript_id : NM_177598.3

name	Fbxw12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372704 GeneID:434440 MGI:3584372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 12 transcript_id : NM_001008428.2

name	Fbxw14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131043 GeneID:50757 MGI:1354703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 14 transcript_id : NM_015793.2

name	LOC668758 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260368 GeneID:668758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 1 Protein product : similar to F-box and WD-40 domain protein 14, transcript variant 3 transcript_id : XM_001005206.2

name	EG382156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386617 GeneID:382156 MGI:3643290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 12 Proteins product : predicted gene, EG382156, transcript variant 2 transcript_id : XM_001005209.1

name	EG382156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260370 GeneID:382156 MGI:3643290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : predicted gene, EG382156 transcript_id : XM_001481011.1

name	Fbxw16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032047 GeneID:320083 MGI:2443324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 16 transcript_id : NM_177070.3

name	Fbxw19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382879 GeneID:235612 MGI:3505706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 19 transcript_id : NM_177703.3

name	LOC635668 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260325 GeneID:635668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Fbxw16 protein transcript_id : XM_001472183.1

name	Fbxw15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299772 GeneID:382105 MGI:3505701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 15 transcript_id : NM_199036.2

name	EG382106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381410 GeneID:382106 MGI:3646659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG382106 transcript_id : NM_001013776.2

name	C85627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702118 GeneID:546161 MGI:3034520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C85627 transcript_id : NM_001033794.1

name	EG382109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130897 GeneID:382109 MGI:3646662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG382109 transcript_id : NM_198674.2

name	1700124P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260377 GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : RIKEN cDNA 1700124P09 gene, transcript variant 3 transcript_id : XM_001481022.1

name	1700124P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260375 GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : RIKEN cDNA 1700124P09 gene, transcript variant 2 transcript_id : XM_001481021.1

name	1700124P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260373 GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 13 Proteins product : RIKEN cDNA 1700124P09 gene, transcript variant 1 transcript_id : XM_001481019.1

name	Spink8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145595 GeneID:78709 MGI:1925959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine peptidase inhibitor, Kazal type 8 transcript_id : NM_183136.2

name	Nme6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055289 GeneID:54369 MGI:1861676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 6, protein transcript_id : NM_018757.1

name	Camp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753471 GeneID:12796 MGI:108443
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathelicidin antimicrobial peptide transcript_id : NM_009921.1

name	Cdc25a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373435 GeneID:12530 MGI:103198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog A (S. pombe) transcript_id : NM_007658.3

name	Mtap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106362 GeneID:17758 MGI:97178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 4 transcript_id : NM_008633.1

name	Dhx30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19111155 GeneID:72831 MGI:1920081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 30 transcript_id : NM_133347.1

name	Smarcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421096 GeneID:20588 MGI:1203524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 transcript_id : NM_009211.2

name	Cspg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328223 GeneID:29873 MGI:1352747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chondroitin sulfate proteoglycan 5 transcript_id : NM_013884.2

name	Tmem103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386623 GeneID:72341 MGI:1919349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 43 ESTs, 2 Proteins product : transmembrane protein 103, transcript variant 2 transcript_id : XM_895137.2

name	Tmem103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386624 GeneID:72341 MGI:1919349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 2 Proteins product : transmembrane protein 103, transcript variant 1 transcript_id : XM_135177.7

name	Scap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47564087 GeneID:235623 MGI:2135958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SREBF chaperone transcript_id : NM_001001144.1

name	Ptpn23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517677 GeneID:104831 MGI:2144837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 23 transcript_id : NM_001081043.1

name	Ngp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679053 GeneID:18054 MGI:105983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neutrophilic granule protein transcript_id : NM_008694.1

name	Klhl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517681 GeneID:270201 MGI:2143315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 18 (Drosophila) transcript_id : NM_177771.5

name	Kif9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374447 GeneID:16578 MGI:1098237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 9 transcript_id : NM_010628.2

name	Setd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486750 GeneID:235626 MGI:1918177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 2 transcript_id : NM_001081340.1

name	Nradd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271512 GeneID:67169 MGI:1914419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotrophin receptor associated death domain transcript_id : NM_026012.2

name	Nbeal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260327 GeneID:235627 MGI:2448554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 83 ESTs, 3 Proteins product : neurobeachin-like 2 transcript_id : XM_977572.2

name	Ccdc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802309 GeneID:72654 MGI:1919904
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 12 transcript_id : NM_028312.2

name	Slc25a20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048462 CCDS:CCDS23535.1 GeneID:57279 MGI:1928738
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mitochondrial carnitine-acylcarnitine translocase product : carnitine/acylcarnitine translocase protein_id : NP_065266.1

name	Prkar2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22550094 CCDS:CCDS23536.1 GeneID:19087 MGI:108025
definition	GO_component : GO:0005952 - cAMP-dependent protein kinase complex [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein kinase, cAMP dependent regulatory, type II alpha protein_id : NP_032950.1

name	Ihpk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037447 CCDS:CCDS23537.1 GeneID:76500 MGI:1923750
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0050517 - inositol hexakisphosphate kinase activity [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : inositol hexaphosphate kinase 2 protein_id : NP_083910.1

name	Nckipsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49258190 CCDS:CCDS23538.1 GeneID:80987 MGI:1931834
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : Wiskott-Aldrich syndrome homolog (human) binding protein product : NCK interacting protein with SH3 domain protein_id : NP_109654.2

name	Celsr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719165 CCDS:CCDS23539.1 GeneID:107934 MGI:1858236
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007413 - axonal fasciculation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : cadherin EGF LAG seven-pass G-type receptor 3 protein_id : NP_536685.2

name	Slc26a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981655 GeneID:171429 MGI:2159728
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015380 - anion exchanger activity [Evidence IDA]; GO:0015108 - chloride transporter activity [Evidence IDA]; GO:0015499 - formate transporter activity [Evidence IDA]; GO:0008271 - sulfate porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015701 - bicarbonate transport [Evidence IDA]; GO:0006821 - chloride transport [Evidence IDA]; GO:0015724 - formate transport [Evidence IDA]; GO:0008272 - sulfate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : solute carrier family 26, member 6 protein_id : NP_599252.2

name	LOC100038959 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260322 GeneID:100038959
definition	codon_start : 1 product : similar to chloride-formate exchanger protein_id : XP_001472030.1

name	Tmem89 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260324 GeneID:69384 MGI:1916634
definition	codon_start : 1 product : hypothetical protein LOC69384 protein_id : XP_135161.4

name	Uqcrc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46593021 CCDS:CCDS23540.1 GeneID:22273 MGI:107876
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ubiquinol-cytochrome c reductase core protein 1 protein_id : NP_079683.2

name	Col7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115647999 GeneID:12836 MGI:88462
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type VII, alpha 1 protein_id : NP_031764.2

name	Pfkfb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662740 CCDS:CCDS23541.1 GeneID:270198 MGI:2687284
definition	GO_function : GO:0003873 - 6-phosphofructo-2-kinase activity [Evidence IEA] [Evidence ISS]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004331 - fructose-2,6-bisphosphate 2-phosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006003 - fructose 2,6-bisphosphate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 4 protein_id : NP_766607.3

name	Scotin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703698 CCDS:CCDS23543.1 GeneID:66940 MGI:1915044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0008632 - apoptotic program [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : scotin isoform 1 protein_id : NP_080134.1

name	Scotin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746147 GeneID:66940 MGI:1915044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0008632 - apoptotic program [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : scotin isoform 2 protein_id : NP_080657.1

name	Trex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59624981 CCDS:CCDS23544.1 GeneID:22040 MGI:1328317
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence ISS]; GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS] GO_process : GO:0006310 - DNA recombination [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence ISS]; GO:0006298 - mismatch repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNase III; trophoblast expressed 1; three prime exonuclease 1 product : three prime repair exonuclease 1 protein_id : NP_001012236.1

name	Trex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59624979 CCDS:CCDS23544.1 GeneID:22040 MGI:1328317
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence ISS]; GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS] GO_process : GO:0006310 - DNA recombination [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence ISS]; GO:0006298 - mismatch repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNase III; trophoblast expressed 1; three prime exonuclease 1 product : three prime repair exonuclease 1 protein_id : NP_035767.4

name	6620401K05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819649 CCDS:CCDS23545.1 GeneID:235610 MGI:1925349
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATR interacting protein protein_id : NP_766362.1

name	Ccdc72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304024 GeneID:66167 MGI:1913417
definition	codon_start : 1 product : coiled-coil domain containing 72 protein_id : NP_899073.1

name	Ccdc51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313384 GeneID:66658 MGI:1913908
definition	codon_start : 1 product : coiled-coil domain containing 51 protein_id : NP_079965.1

name	EG665413 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386570 GeneID:665413 MGI:3643956
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981851.1

name	Plxnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370140 CCDS:CCDS23546.1 GeneID:235611 MGI:2154238
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IGI] codon_start : 1 exception : mismatches in translation product : plexin B1 protein_id : NP_766363.1

name	E330009P21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892973 CCDS:CCDS23547.1 GeneID:320082 MGI:2443323
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box domain containing protein protein_id : NP_796043.1

name	Fbxw13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243960 CCDS:CCDS23548.1 GeneID:211305 MGI:3505590
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 13 protein_id : NP_808266.1

name	Fbxw12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605676 CCDS:CCDS23549.1 GeneID:434440 MGI:3584372
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 12 protein_id : NP_001008428.1

name	Fbxw14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271358 CCDS:CCDS23550.1 GeneID:50757 MGI:1354703
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 12; F-box protein 12 product : F-box and WD-40 domain protein 14 protein_id : NP_056608.1

name	LOC668758 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260369 GeneID:668758
definition	codon_start : 1 product : similar to F-box and WD-40 domain protein 14 isoform 3 protein_id : XP_001005206.2

name	EG382156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260371 GeneID:382156 MGI:3643290
definition	codon_start : 1 product : hypothetical protein LOC382156 protein_id : XP_001481061.1

name	EG382156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386618 GeneID:382156 MGI:3643290
definition	codon_start : 1 product : hypothetical protein LOC382156 isoform 2 protein_id : XP_001005209.1

name	Fbxw16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032048 GeneID:320083 MGI:2443324
definition	codon_start : 1 product : F-box and WD-40 domain protein 16 protein_id : NP_796044.2

name	Fbxw19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244158 CCDS:CCDS23552.1 GeneID:235612 MGI:3505706
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 19 protein_id : NP_808371.1

name	LOC635668 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260326 GeneID:635668
definition	codon_start : 1 product : similar to Fbxw16 protein protein_id : XP_001472233.1

name	Fbxw15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299773 CCDS:CCDS23553.1 GeneID:382105 MGI:3505701
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 15 protein_id : NP_950201.2

name	EG382106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945398 GeneID:382106 MGI:3646659
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC382106 protein_id : NP_001013798.1

name	C85627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702119 GeneID:546161 MGI:3034520
definition	codon_start : 1 product : hypothetical protein LOC546161 protein_id : NP_001028966.1

name	EG382109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348578 GeneID:382109 MGI:3646662
definition	codon_start : 1 product : hypothetical protein LOC382109 protein_id : NP_941076.1

name	1700124P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260378 GeneID:76998 MGI:1924248
definition	codon_start : 1 product : hypothetical protein LOC76998 isoform 3 protein_id : XP_001481072.1

name	1700124P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260376 GeneID:76998 MGI:1924248
definition	codon_start : 1 product : hypothetical protein LOC76998 isoform 2 protein_id : XP_001481071.1

name	1700124P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260374 GeneID:76998 MGI:1924248
definition	codon_start : 1 product : hypothetical protein LOC76998 isoform 1 protein_id : XP_001481069.1

name	Spink8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145596 GeneID:78709 MGI:1925959
definition	codon_start : 1 product : serine protease inhibitor Kazal type 8 protein_id : NP_898959.2

name	Nme6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055290 CCDS:CCDS23558.1 GeneID:54369 MGI:1861676
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleoside diphosphate kinase type 6; nm23/nucleoside diphosphate kinase 6; expressed in non-metastatic cells 6, protein (nucleoside diphosphate kinase) product : expressed in non-metastatic cells 6, protein protein_id : NP_061227.1

name	Camp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753472 GeneID:12796 MGI:108443
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : cathelin-like protein product : cathelicidin antimicrobial peptide protein_id : NP_034051.1

name	Cdc25a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92373436 CCDS:CCDS23559.1 GeneID:12530 MGI:103198
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle 25A product : cell division cycle 25 homolog A protein_id : NP_031684.3

name	Mtap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106363 GeneID:17758 MGI:97178
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IEA] citation : [PUBMED 1718985] codon_start : 1 exception : mismatches in translation note : MAP 4 product : microtubule-associated protein 4 protein_id : NP_032659.1

name	Dhx30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111156 CCDS:CCDS23560.1 GeneID:72831 MGI:1920081
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : HELG protein_id : NP_579925.1

name	Smarcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421097 CCDS:CCDS23561.1 GeneID:20588 MGI:1203524
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016514 - SWI/SNF complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006323 - DNA packaging [Evidence TAS]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 protein_id : NP_033237.2

name	Cspg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328224 GeneID:29873 MGI:1352747
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0050804 - regulation of synaptic transmission [Evidence IMP] codon_start : 1 exception : mismatches in translation note : chondroitin sulfate proteoglycan 5 (neuroglycan C) product : chondroitin sulfate proteoglycan 5 protein_id : NP_038912.2

name	Tmem103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82931329 GeneID:72341 MGI:1919349
definition	codon_start : 1 product : transmembrane protein 103 isoform 2 protein_id : XP_900230.1

name	Tmem103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765197 GeneID:72341 MGI:1919349
definition	codon_start : 1 product : transmembrane protein 103 isoform 1 protein_id : XP_135177.3

name	Scap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564088 CCDS:CCDS23564.1 GeneID:235623 MGI:2135958
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence TAS] [Evidence IDA] GO_function : GO:0015485 - cholesterol binding [Evidence TAS]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI] GO_process : GO:0008203 - cholesterol metabolism [Evidence IDA]; GO:0019217 - regulation of fatty acid metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Sreb cleavage-activating protein product : SREBP cleavage activating protein protein_id : NP_001001144.1

name	Ptpn23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517678 GeneID:104831 MGI:2144837
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase, non-receptor type 23 protein_id : NP_001074512.1

name	Ngp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679054 CCDS:CCDS23566.1 GeneID:18054 MGI:105983
definition	codon_start : 1 exception : mismatches in translation note : clone B6; myeloid granule protein product : neutrophilic granule protein protein_id : NP_032720.1

name	Klhl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925602 CCDS:CCDS23567.1 GeneID:270201 MGI:2143315
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 18 protein_id : NP_808439.2

name	Kif9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754442 CCDS:CCDS23568.1 GeneID:16578 MGI:1098237
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : mismatches in translation function : motor protein note : kinesin 9 product : kinesin family member 9 protein_id : NP_034758.1

name	Setd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486751 GeneID:235626 MGI:1918177
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SET domain containing 2 protein_id : NP_001074809.1

name	Nradd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22902118 CCDS:CCDS23569.1 GeneID:67169 MGI:1914419
definition	GO_component : GO:0030027 - lamellipodium [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005641 - nuclear envelope lumen [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : death domain containing membrane protein NRADD protein_id : NP_080288.1

name	Nbeal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260328 GeneID:235627 MGI:2448554
definition	codon_start : 1 note : overriding stop codons product : similar to FLJ00341 protein protein_id : XP_982666.2 transl_except : (pos:complement(110533284..110533286),aa:OTHER)

name	Ccdc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469009 CCDS:CCDS23570.1 GeneID:72654 MGI:1919904
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 12 protein_id : NP_082588.1

name	LOC100043782 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043782
definition	number : 1 pseudo : _no_value

name	E330001B16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260372 GeneID:546160 MGI:3588266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 9 Proteins product : RIKEN cDNA E330001B16 gene transcript_id : XR_034946.1

name	LOC100049540 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260379 GeneID:100049540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 ESTs, 13 Proteins product : similar to ribosomal protein L7 pseudo : _no_value transcript_id : XR_034952.1

clone name	MSMg01-399O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-319K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-380B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-374G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307P10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-514D05.T7 (MSMg01no514_d05.b1)	MSMg01-514D05.TJ (MSMg01no514_d05.g1)
ACC	AG586742	AG586743
length	747	625
length of high quality (start - end)	---	449 (77 - 525)
definition	CHROMAT_FILE: MSMg01no514_d05.b1 PHD_FILE: MSMg01no514_d05.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:45:00 2005	CHROMAT_FILE: MSMg01no514_d05.g1 PHD_FILE: MSMg01no514_d05.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:45:00 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	TTACCCCCCTCCACTCCCCTACTTCTCATTATATTCTCTTTCTTTTCTTT TTTTTCNTTCCTTAATATTTGCGGGTCGCTAATACGAACTCACTATTAGT TCCTAAGAATCCGCCGGGAATTTCCCAGGTTTTTTGTTCTGAATGCCCAA CTTTCCTTTAACAAAAAATGGAAAGTAAAAAATTTCCTTTGGCTTAAAAA AAAAAAGGGTGGGCTTCCCGCGTTATAACCCGGGCCCTTATAAAAAAAAA GTTTTAAAGGGGCAAACCCCCCTCCATTGGGGGAAAATTTTAAAAAAGGG CGCTTTTGTGTTAGAGTCCCCAAATAATAGATATACCCACTTTTACACCA TCTTTTTTTTTTTAAAAAAAAAGGGCCCCCCCCCCCCCCCCCTCGTGGGT GTTTGTCCCCACTAAAAAAAAACTTTTTCCCCCCACAAGGGTGGGGGGAA AAATTTTCCTTCCGCCAGAAAAAAAAAAAAAATGGTGGTGTGTGCCTTTC TCTCACAATCAAATAAAAACAACAAGGGGGGGGGGGTTGTTAAAATAATA TTTTTTTTTTATTCAAAATAAAAAAATTTTTTTTCCTCCCTCAAAATAAT ATAAATCCCCCCCTCTCTCTATCCAATATTAAAGAAGTGGTGTGTAGATT ATGTTACCTCCTTTCAATCCCCCCTTCTCATTTATGTGTAGTTTCTCCCG CTCGCCACCCATATTCTTTGATATATTTTTATTCTCTATCTCCCCGG	TCTATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXACCATACAGACAACAGACTTGTCT TGTCCCTTTCTTGTTAAGCCACACCCTGAGATATAACATGCATATCCAAA AAGTCCTGCAAGGAAACCCCAACAGTATGTGGGCAGCAGACAGTTGAGGG ACAACTCAACCTGAAGGACATATGGTTCATTTCCCTCTGCCTTGTAGAAG GCTTGGATAAAAGCTGTGGAAAAGATGAAGGGAGGCCACCAAGCACACTG TAGGCTGGTGGTTCAGACACATTTACCCTTTAATCTGTTTCTATAGATAC AAAATGGGTCTGGGGCCTGGGGCTTTGACTCCCTGGCCAGAGTTCTCCGT TCTGTTCTGAAAGGCCAATAAACAGTACTCCATTAATCATTTGGAGGCAG AAAGTTCCAAAGTTCAAGATCATTGGTGTGCATTACATAAAGGATTTGAG GTCTGCCTGTGATGCATGACATCCTGTCTGAAGGANGAGAGAAAGAGAGA AAGATAGGAAGGGAGAAAGAGAGAAAGAGAAGAAGGGAAGGGAGAAAGAG AGAAAGAGAAAGAAGAGAAGGGAAG
quality values	Open. Hide. 9 11 11 11 11 10 8 8 8 8 8 8 6 6 8 8 14 10 11 8 8 8 8 8 8 8 8 8 8 9 9 9 8 8 8 8 8 8 10 22 11 11 9 9 11 8 8 10 16 15 20 20 15 8 6 3 0 3 8 6 8 6 6 8 6 6 6 6 13 12 10 10 10 10 10 10 10 16 19 19 14 15 13 11 11 11 12 13 13 15 9 9 9 9 9 13 9 9 9 9 12 12 9 8 6 6 6 6 6 6 10 10 9 9 10 8 8 8 9 8 8 11 16 19 20 17 10 9 9 14 16 17 8 9 10 9 8 11 8 8 6 6 6 6 8 9 14 12 12 15 15 17 19 16 18 18 16 11 10 9 9 10 10 11 18 24 16 17 14 11 12 13 13 9 11 11 9 8 11 8 10 9 9 9 10 12 10 8 8 7 6 6 6 10 10 11 12 14 14 10 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 7 6 9 8 8 10 8 8 8 8 8 9 10 13 11 11 9 9 9 11 10 10 6 6 6 9 13 22 22 16 16 10 9 9 8 13 8 9 10 11 10 9 8 8 10 10 10 10 12 14 18 24 8 11 7 6 6 6 6 8 6 6 7 7 13 8 8 8 8 8 9 13 12 22 20 15 21 13 13 9 7 6 6 6 6 6 6 12 19 9 9 9 8 8 8 8 8 8 8 8 8 8 12 12 10 8 8 8 8 8 9 9 9 9 8 8 6 6 8 8 8 8 8 8 9 10 12 10 10 10 8 8 8 6 7 10 9 20 22 22 19 19 21 13 10 6 6 8 7 13 16 14 12 11 10 8 8 8 8 8 9 18 15 18 22 18 17 19 19 24 24 16 16 15 9 8 8 8 8 8 8 8 6 6 8 10 8 8 9 10 10 12 11 9 9 9 10 13 16 21 20 14 12 9 8 8 8 10 8 10 12 12 15 15 16 9 9 10 10 11 10 8 8 7 9 9 10 11 12 12 12 8 9 11 8 9 9 13 10 9 9 8 8 8 8 9 9 9 8 8 8 8 8 8 24 30 32 24 20 22 21 24 15 15 11 9 9 9 9 9 8 8 8 10 7 7 7 8 10 10 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 9 9 9 10 10 8 6 6 8 8 8 8 8 8 9 13 11 14 14 20 18 18 15 11 10 10 8 8 6 6 8 8 6 6 8 8 8 8 8 9 9 18 32 32 24 15 8 8 8 8 8 8 18 17 23 12 10 9 10 9 10 10 10 10 10 10 13 19 19 19 12 10 8 8 12 8 10 8 8 8 8 8 8 8 8 10 8 8 12 13 8 8 8 8 8 8 13 28 26 10 9 9 8 8 8 6 6 6 8 8 8 8 8 8 10 11 11 11 12 11 9 8 8 8 8 8 8 8 10 17 13 10 8 10 10 10 11 11 10 9 10 8 8 10 8 8 8 10 8 10 11 10 6 6 6 6 8 8 8 10 17 19 17 15 10 10 8 8 8 13 10 10 6 6 6 8 6 6 6 6 7 8 8 8 8 8 8 8 8 10 9 9 9 10 10 10 10 10 6 6 8 10 8 8 8 8 8 10 10 8 8 8 8 10 10 8 10 6 6 6 8 10 10 10 8 8 8 10 10 9 8 10 8 8 8	Open. Hide. 6 8 8 8 8 8 8 8 8 8 8 8 10 12 12 9 9 20 19 32 34 34 44 27 25 12 17 20 34 34 39 32 15 11 10 11 10 10 9 14 16 20 30 30 48 50 53 53 47 38 50 50 50 50 50 53 53 50 50 50 43 24 21 26 24 33 33 39 43 43 41 42 42 42 41 43 48 48 50 50 50 50 50 50 50 50 47 48 48 50 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 50 48 48 48 51 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 52 52 52 59 59 57 57 57 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 59 59 59 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 57 68 68 68 68 68 59 59 59 57 57 52 52 52 57 57 68 68 68 68 68 68 68 57 57 57 57 57 59 52 52 57 59 59 68 68 68 59 59 59 57 57 57 59 59 68 68 68 68 57 57 57 48 44 57 57 57 54 57 59 59 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 48 48 48 48 59 59 59 57 57 59 59 59 59 59 57 57 57 59 59 59 59 50 50 50 50 50 42 41 41 39 35 32 36 39 44 59 59 59 59 59 59 59 48 48 47 59 41 41 41 41 32 29 29 29 29 37 37 37 47 41 41 41 48 48 48 48 59 57 57 48 48 48 48 48 48 48 48 46 39 39 37 30 30 32 27 28 39 39 41 36 35 34 35 31 31 39 41 41 41 41 41 37 33 33 33 28 30 22 28 22 30 30 32 29 25 30 30 30 30 33 33 33 33 33 37 41 47 47 43 41 15 10 8 8 8 19 22 32 29 26 28 28 28 30 25 29 34 37 36 35 35 28 28 23 28 23 28 28 30 24 32 24 18 16 16 10 10 12 9 9 8 8 8 3 0 3 18 23 36 39 29 31 25 30 22 23 18 16 18 17 11 17 9 9 9 9 10 13 14 15 16 25 35 25 18 17 15 18 11 16 15 21 15 20 20 27 22 14 10 9 13 10 12 10 11 9 8 8 11 13 11 17 23 24 22 22 28 20 13 13 13 12 14 20 19 11 11 11 12 11 15 10 10 13 13 15 30 19 15 10 12 12 12 12

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no514_d05.g1 MSMg01no514_d05.g1 CHROMAT_FILE:
MSMg01no514_d05.g1 PHD_FILE: MSMg01no514_d05.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:45:00 2005
         (449 letters)



>mm_chr9_109564392_109565244
          Length = 853

 Score =  491 bits (254), Expect = e-143
 Identities = 404/456 (88%), Gaps = 11/456 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   accatacagacaacagacttgtcttgtccctttcttgttaagccacaccctgagatataa 60
           ||||||||||  || |||||| ||||||| ||||||||||| |||  |||||||||||||
Sbjct: 201 accatacagatgactgacttgccttgtccgtttcttgttaaaccatgccctgagatataa 260

                                                                       
Query: 61  catgcatatcca-aaaagtcctgcaaggaaaccccaacagtatgtgggcagcagacagtt 119
           ||||| |||||| |||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 261 catgcgtatccataaaa-tcctgcaaggaaaccccaacagtatgtggacagcagacagtt 319

                                                                       
Query: 120 gagggacaactcaacctgaaggacatatggttcatttccctctgccttgtagaaggcttg 179
           ||| |||||||||| || |||||  ||||||||  ||||||||||| |||||||||||||
Sbjct: 320 gagagacaactcaaactaaaggaggtatggttcccttccctctgccatgtagaaggcttg 379

                                                                       
Query: 180 gataaaagctgtggaaaagatgaagggaggcca-ccaagcacactgtaggctggt----g 234
           ||||||||||||||||||||||||||||||| | |||||||||||||||||||||    |
Sbjct: 380 gataaaagctgtggaaaagatgaagggaggc-agccaagcacactgtaggctggtcattg 438

                                                                       
Query: 235 gttcagacacatttaccctttaatctgtttctatagatacaaaatgggtctggggcctgg 294
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 439 gttcagacacatttaccctttaatctgtttctatagatacaaaataggtctggggcctgt 498

                                                                       
Query: 295 ggctttgactccctggccagagttctccgttctgttctgaaaggccaataaacagtactc 354
           |||| ||||||||||| |||||| | | |||||||||| |||| ||||||||| |||  |
Sbjct: 499 ggctctgactccctgggcagagtgcactgttctgttctcaaagaccaataaaccgtaaac 558

                                                                       
Query: 355 catta-atcatttggaggcagaaagttccaaagttcaagatcattggtgtgcattacata 413
           ||||| | ||||||||||||||||| ||| ||||||||| || ||||||||  |||||| 
Sbjct: 559 cattaca-catttggaggcagaaagatccgaagttcaagttc-ttggtgtgtgttacatg 616

                                               
Query: 414 aaggatttgaggtctgcctgtgatgcatgacatcct 449
           |||| |||||||||||||| || | ||||| |||||
Sbjct: 617 aagggtttgaggtctgcctatggtacatgagatcct 652


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 12
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 449
Length of database: 853
Length adjustment: 10
Effective length of query: 439
Effective length of database: 843
Effective search space:   370077
Effective search space used:   370077
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information