MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-543A05
Chromosome	9 (Build37)
Map Location	55,625,204 - 55,625,571
singlet/doublet	singlet
Overlap gene	Zfp291
Upstream gene	Rab7-ps1, Ireb2, C630028N24Rik, AY074887, Psma4, Chrna5, Chrna3, Chrnb4, EG640554, LOC664897, 1700071A11Rik, Ube2q2, Fbxo22, Nrg4, AI118078, Etfa, LOC546133, Isl2
Downstream gene	LOC664980, 4930563M21Rik, LOC664995, LOC665005, Rcn2, Pstpip1, Tspan3, C230081A13Rik, Hmg20a, LOC100039535, LOC100039549, LOC640537, Lingo1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rab7-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19350 MGI:1276565
definition	note : RAB7, member RAS oncogene family, pseudogene 1 pseudo : _no_value

name	Ireb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64602 MGI:1928268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C630028N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235386 MGI:2443139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AY074887 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246735 MGI:3575512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psma4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26441 MGI:1347060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110835 MGI:87889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110834 MGI:87887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrnb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108015 MGI:87892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640554 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640554 MGI:3648923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC664897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	1700071A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76611 MGI:1923861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ube2q2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109161 MGI:2388672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71999 MGI:1926014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83961 MGI:1933833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI118078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244886 MGI:2142980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110842 MGI:106092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 133 ESTs, 23 Proteins pseudo : _no_value

name	Isl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104360 MGI:109156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp291 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244891 MGI:1925976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664980 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein pseudo : _no_value

name	4930563M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75258 MGI:1922508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC665005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins pseudo : _no_value

name	Rcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26611 MGI:1349765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pstpip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19200 MGI:1321396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56434 MGI:1928098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230081A13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244895 MGI:2442366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmg20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66867 MGI:1914117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 449 ESTs, 6 Proteins

name	LOC100039549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC640537 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lingo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235402 MGI:1915522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ireb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349648 GeneID:64602 MGI:1928268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iron responsive element binding protein 2 transcript_id : NM_022655.2

name	C630028N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345498 GeneID:235386 MGI:2443139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C630028N24 gene transcript_id : NM_177351.3

name	AY074887 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842406 GeneID:246735 MGI:3575512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY074887 transcript_id : NM_145229.2

name	Psma4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129984 GeneID:26441 MGI:1347060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, alpha type 4 transcript_id : NM_011966.3

name	Chrna5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559779 GeneID:110835 MGI:87889
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 5 transcript_id : NM_176844.3

name	Chrna3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778735 GeneID:110834 MGI:87887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 3 transcript_id : NM_145129.2

name	Chrnb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227209 GeneID:108015 MGI:87892
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 4 transcript_id : NM_148944.3

name	EG640554 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386114 GeneID:640554 MGI:3648923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640554 transcript_id : XM_973282.1

name	1700071A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386116 GeneID:76611 MGI:1923861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700071A11 gene transcript_id : XM_973359.1

name	Ube2q2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344098 GeneID:109161 MGI:2388672
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2Q (putative) 2 transcript_id : NM_180600.2

name	Fbxo22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948464 GeneID:71999 MGI:1926014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 22 transcript_id : NM_028049.2

name	Nrg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14030776 GeneID:83961 MGI:1933833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuregulin 4 transcript_id : NM_032002.1

name	AI118078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350526 GeneID:244886 MGI:2142980
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI118078 transcript_id : NM_172923.2

name	Etfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351839 GeneID:110842 MGI:106092
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : electron transferring flavoprotein, alpha polypeptide transcript_id : NM_145615.3

name	Isl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802238 GeneID:104360 MGI:109156
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin related protein 2 (islet 2) transcript_id : NM_027397.2

name	Zfp291 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486796 GeneID:244891 MGI:1925976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 291 transcript_id : NM_001081341.1

name	4930563M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147096 GeneID:75258 MGI:1922508
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930563M21 gene transcript_id : NM_183111.1

name	Rcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205427 GeneID:26611 MGI:1349765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulocalbin 2 transcript_id : NM_011992.2

name	Pstpip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469104 GeneID:19200 MGI:1321396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-serine-threonine phosphatase-interacting protein 1 transcript_id : NM_011193.1

name	Tspan3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981021 GeneID:56434 MGI:1928098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 3 transcript_id : NM_019793.2

name	C230081A13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386673 GeneID:244895 MGI:2442366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230081A13 gene transcript_id : NM_172924.2

name	Hmg20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981181 GeneID:66867 MGI:1914117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group 20A transcript_id : NM_025812.2

name	LOC100039535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259983 GeneID:100039535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 449 ESTs, 6 Proteins product : similar to Ubiquitin-conjugating enzyme E2S transcript_id : XM_001473225.1

name	LOC100039549 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259987 GeneID:100039549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039549 transcript_id : XM_001473238.1

name	LOC640537 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259977 GeneID:640537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to transcription elongation factor A (SII)-like 8 transcript_id : XM_001472595.1

name	Lingo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926183 GeneID:235402 MGI:1915522
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and Ig domain containing 1 transcript_id : NM_181074.4

name	Ireb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098149 CCDS:CCDS23196.1 GeneID:64602 MGI:1928268
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003994 - aconitate hydratase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030350 - iron-responsive element binding [Evidence IDA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0030371 - translation repressor activity [Evidence TAS] GO_process : GO:0006879 - iron ion homeostasis [Evidence IDA]; GO:0006445 - regulation of translation [Evidence TAS] codon_start : 1 exception : mismatches in translation product : iron responsive element binding protein 2 protein_id : NP_073146.1

name	C630028N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893487 CCDS:CCDS23197.1 GeneID:235386 MGI:2443139
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC235386 protein_id : NP_796325.1

name	AY074887 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644595 CCDS:CCDS23198.1 GeneID:246735 MGI:3575512
definition	codon_start : 1 product : cleft palate-related protein 1 protein_id : NP_660264.1

name	Psma4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755196 GeneID:26441 MGI:1347060
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, alpha type 4 protein_id : NP_036096.1

name	Chrna5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559780 GeneID:110835 MGI:87889
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nicotinic acetylcholine receptor alpha5 subunit product : cholinergic receptor, nicotinic, alpha polypeptide 5 protein_id : NP_789814.2

name	Chrna3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778736 CCDS:CCDS23199.1 GeneID:110834 MGI:87887
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : alpha 3; neuronal nicotinic acetylcholine receptor, alpha 3 subunit product : cholinergic receptor, nicotinic, alpha polypeptide 3 protein_id : NP_660111.2

name	Chrnb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563301 CCDS:CCDS23200.1 GeneID:108015 MGI:87892
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : nicotinic acetylcholine receptor beta4 subunit product : cholinergic receptor, nicotinic, beta polypeptide 4 protein_id : NP_683746.1

name	EG640554 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386115 GeneID:640554 MGI:3648923
definition	codon_start : 1 product : similar to eukaryotic translation initiation factor 3, subunit 12 protein_id : XP_978376.1

name	1700071A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386117 GeneID:76611 MGI:1923861
definition	codon_start : 1 product : hypothetical protein LOC76611 protein_id : XP_978453.1

name	Ube2q2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725841 CCDS:CCDS23201.1 GeneID:109161 MGI:2388672
definition	EC_number : 6.3.2.19 GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin-conjugating enzyme E2Q 2 protein_id : NP_850931.1

name	Fbxo22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948465 CCDS:CCDS23202.1 GeneID:71999 MGI:1926014
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 22 product : F-box protein 22 protein_id : NP_082325.2

name	Nrg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14030777 GeneID:83961 MGI:1933833
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : neuregulin 4 protein_id : NP_114391.1

name	AI118078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370422 CCDS:CCDS23203.1 GeneID:244886 MGI:2142980
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC244886 protein_id : NP_766511.1

name	Etfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981826 CCDS:CCDS23204.1 GeneID:110842 MGI:106092
definition	GO_component : GO:0017133 - electron transfer flavoprotein complex (sensu Eukaryota) [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence TAS]; GO:0050660 - FAD binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Alpha-ETF product : electron transferring flavoprotein, alpha polypeptide protein_id : NP_663590.2

name	Isl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386228 CCDS:CCDS23205.1 GeneID:104360 MGI:109156
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : insulin gene enhancer protein ISL-2; islet 2 product : insulin related protein 2 (islet 2) protein_id : NP_081673.1

name	Zfp291 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486797 GeneID:244891 MGI:1925976
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger protein 291 protein_id : NP_001074810.1

name	4930563M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147097 GeneID:75258 MGI:1922508
definition	GO_function : GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75258 protein_id : NP_898934.1

name	Rcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205428 CCDS:CCDS23206.1 GeneID:26611 MGI:1349765
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 note : taipoxin-associated calcium binding protein 49 product : reticulocalbin 2 protein_id : NP_036122.2

name	Pstpip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469105 GeneID:19200 MGI:1321396
definition	GO_component : GO:0005826 - contractile ring [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019903 - protein phosphatase binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0000910 - cytokinesis [Evidence IC] codon_start : 1 exception : mismatches in translation product : proline-serine-threonine phosphatase-interacting protein 1 protein_id : NP_035323.1

name	Tspan3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981022 CCDS:CCDS23207.1 GeneID:56434 MGI:1928098
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tetraspanin TM4-A homolog; transmembrane 4 superfamily member 8 product : tetraspanin 3 protein_id : NP_062767.2

name	C230081A13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370424 GeneID:244895 MGI:2442366
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC244895 protein_id : NP_766512.1

name	LOC100039535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259984 GeneID:100039535
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme E2S protein_id : XP_001473275.1

name	Hmg20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15022805 CCDS:CCDS23208.1 GeneID:66867 MGI:1914117
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : inhibitor of BRAF35 product : high mobility group 20A protein_id : NP_080088.1

name	LOC100039549 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259988 GeneID:100039549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473288.1

name	LOC640537 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259978 GeneID:640537
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472645.1

name	Lingo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841016 CCDS:CCDS23209.1 GeneID:235402 MGI:1915522
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine rich repeat neuronal 6A product : leucine-rich repeat neuronal 6A protein_id : NP_851419.1

name	LOC664897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664897
definition	number : 2 pseudo : _no_value

name	LOC664897 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664897
definition	number : 1 pseudo : _no_value

name	LOC664995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664995
definition	number : 1 pseudo : _no_value

name	LOC664995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664995
definition	number : 2 pseudo : _no_value

name	LOC546133 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259979 GeneID:546133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 133 ESTs, 23 Proteins product : similar to DnaJ (Hsp40) homolog, subfamily B, member 6 pseudo : _no_value transcript_id : XR_030911.1

name	LOC664980 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259982 GeneID:664980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : similar to XY body protein pseudo : _no_value transcript_id : XR_030988.1

name	LOC665005 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259976 GeneID:665005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : similar to XY body protein pseudo : _no_value transcript_id : XR_030731.1

clone name	MSMg01-059C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358L24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349P24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074O14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-543A05.T7 (MSMg01no543_a05.b1)	MSMg01-543A05.TJ (MSMg01no543_a05.g1)
ACC	AG608650	AG608651
length	769	761
length of high quality (start - end)	368 (74 - 441)	387 (81 - 467)
definition	CHROMAT_FILE: MSMg01no543_a05.b1 PHD_FILE: MSMg01no543_a05.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:23:14 2005	CHROMAT_FILE: MSMg01no543_a05.g1 PHD_FILE: MSMg01no543_a05.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:23:14 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	AAAAATCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX CGCGGAATTCACTCTGTATACCAGGCTGGTCTGAAACTCAGAAATCTGTC TGCCTCTGCCTCCCAAGTGCTGGGATTAAAGATGTGCAGCACCACTGCCA GCTTTGAATGTCTTTCTTTCCCAATCCCCATTCTTATTATGTTGCAATTT TTTGTGCTTTCTTCTTTGTTTGCTTGGTTTGGTTTTTTTTTTTGTTTGTT TTTATGTTTGAGACATGGTTTTCGTTGTTTAGCCTTGGCTGTCCTGGAAC TCATTCTGTAGACCTTGGCTGACCTTGAATTCAGAGATCTGCCTGCCTCT GCCTCCCAAGTGCTGGTATTGAAAGTGTACACTACCACCACCCACTCCGA AAGCATGAAAACCATGTGCATTGTTTCCTTTTTAAAACTTAGGCTTTCTC TTAATTTGCGAACATGGGAATAAAGTATTGTACCTACTTTAACTAATTAC TCTTGCGAGATCTTTATATGGACTTGCCTGTTCCCAATTGTCTCACCTAG GGTTTCACTGCTGTGAAAACACTACTCTAATAATGTAGACTTTCTTGTTG GTGACTGGCTTACACGCTTCAAAAGTTTCAGTCCCATTATCATCATAGGC AGGGATATTTGTATCCCCCTTATGTTTTGCTTTACCTGCCCGAAGTACCC AACTAGTTTTCACTACTTTTTCATCTCTGTAGGCCCTGCATTTCTACAAA TTTTTTTGTTTCTCCCCGG	NNNCCTCGATGACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGTCTTAAATGGTATGTCTT CATCAAAACACTCCCCTCAGGCTCAGGGATCTATGTGGAAAAGGTAGGAG AAAGACTAAGAGGTGGAGGAAATGGGTGACTTGAAGAAAACAGCATTTTC CAGAAACAAAACGACTGATGTACATAAGAAGGCAGATAGCAGTACACAAA ACCTGCACAAGTCTAGACTTTTTATTTTCAATACTCCACAACCCCTTCCC TTATACTGCTCAAACAGGTTACAATCTAATACAGCATTTCTATTATTACA CTACAGGAAAGGAATTCCCCAATAGCATCTTATGTATGTATGTATGTATG TATGTATGTATGTATGTATGTATGNTATATGTATGTAACTTTTTCNANAC AGGTTTCTCTGTGTANCCCTGGCTGTCCTGAAACTCACTCTGTAGACCAG GCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCTAAGTGGTGGG ATTTTAGGCATGCACCACCATCGTCCGGCCCTAACAGGATCTTATGATGG ATCCTATTATCCCATCTTTCTAGTGGTTATTAATTGATATTCTTATTTCT TATAGACATTCTTACCGGTTTTATTTCCTATTGTTTGACCCTATATTTCA TTAGATCTAGACTCTTTTATTACCTAAGGATCTTTACCTTTTTTTCCCCG GTTTGCCATTT
quality values	Open. Hide. 15 19 19 13 9 9 11 10 12 19 22 13 13 10 13 28 28 24 22 16 18 30 17 19 10 10 10 19 25 37 28 20 20 17 15 9 11 6 7 7 6 6 7 19 32 18 20 20 24 28 31 47 48 48 35 35 32 31 33 33 33 33 28 33 17 17 10 10 10 16 16 21 15 19 19 28 32 39 46 59 59 57 57 53 53 53 57 57 48 48 48 47 48 48 53 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 48 48 48 50 59 57 57 44 39 29 29 40 48 46 48 57 48 41 41 41 41 50 57 57 54 54 54 57 57 54 54 47 48 48 47 47 41 57 57 50 50 43 43 43 57 57 68 68 68 68 68 68 68 68 68 68 57 57 52 52 52 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 52 52 52 57 57 57 57 59 59 57 57 57 57 57 68 59 59 57 57 57 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 62 62 62 62 62 62 62 62 52 62 52 52 52 57 52 57 52 57 57 52 52 52 57 57 57 57 57 59 59 59 59 52 52 52 52 57 57 57 57 52 43 57 43 43 52 57 57 57 57 59 59 59 44 43 28 28 23 32 32 43 28 31 31 43 43 52 32 32 12 12 12 32 32 52 52 43 43 35 35 37 43 52 28 38 13 11 10 10 10 10 14 11 11 12 19 21 43 44 50 48 48 50 50 47 47 47 57 57 59 47 42 36 32 19 19 15 15 16 16 20 41 32 32 21 13 13 13 27 25 44 43 43 43 43 31 32 20 20 20 24 28 39 32 32 36 36 32 30 30 30 37 37 43 43 29 29 17 17 17 30 22 20 20 32 28 30 28 24 23 23 31 23 16 19 18 17 21 19 16 16 17 20 24 30 32 29 29 32 34 34 20 20 25 34 34 41 34 30 22 13 11 10 12 9 9 10 15 11 11 11 20 18 28 22 28 22 19 12 13 13 19 18 18 16 12 11 9 9 10 10 12 12 20 20 9 9 9 8 15 15 15 9 6 9 9 12 10 17 23 23 32 32 25 30 24 30 18 15 12 13 13 21 15 10 10 10 10 11 11 19 19 24 16 14 9 9 9 9 21 22 28 30 26 26 15 19 8 8 8 10 9 12 11 11 11 12 20 21 26 18 14 10 10 10 10 12 10 10 10 9 10 10 9 8 8 8 13 9 13 15 11 12 11 11 11 10 6 6 6 6 6 8 8 8 10 10 10 8 9 10 10 9 10 9 9 9 9 9 10 10 10 6 6 6 10 16 22 13 13 8 6 8 8 8 8 9 8 9 16 12 10 9 9 9 10 10 12 14 14 15 10 10 10 14 14 17 16 13 10 10 11 19 15 14 11 11 10 10 8 8 8 10 8 8 8 10 8 8 8 8 8 9 9 8 8 8 8 8 7 9 10 10 10 12 21 14 11 10 10 8 8 8 8 11 15 16 12 13 10 8 8 8 8 8 8 6 6 8 8 9 9 9 8 8 8 8 11 15 15 10 10 12 12 12 12 13 15 15 13 12 9 9 9 9 9 10 10 15 15 14 9 9 9 13 11 8 8 8 8 8 8 8 10 17 10 8 8 8 8 8 8 10 8 8 9 9 8 8 8 8 8 8 14 7 13 6 6 6 8 9 9 9 10 6 7 6 6 6	Open. Hide. 0 0 0 3 6 6 6 7 8 8 8 8 9 9 10 24 30 37 25 30 24 22 22 30 34 37 37 37 37 39 41 41 37 37 37 34 33 16 16 8 8 8 8 11 10 8 10 10 19 19 36 36 23 23 12 11 11 23 23 59 59 59 43 34 23 10 10 13 13 18 14 21 28 34 37 40 41 41 42 42 48 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 50 41 47 47 50 50 68 68 51 50 50 50 51 50 68 68 68 57 57 57 57 57 57 57 57 57 48 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 57 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 57 57 57 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 50 35 35 35 31 31 33 33 33 33 33 21 17 3 0 3 17 19 59 59 59 59 59 59 59 59 59 59 47 47 47 59 27 27 3 0 3 0 3 23 23 37 39 39 40 41 39 39 37 40 39 37 22 22 3 0 3 16 18 23 23 12 12 11 16 16 34 34 37 41 37 48 48 37 37 37 37 37 26 25 15 11 11 21 23 19 24 24 16 16 11 12 12 28 11 10 10 10 10 17 19 37 36 32 28 23 23 28 31 23 24 14 12 12 19 24 37 23 23 23 34 32 32 28 17 13 18 11 11 11 23 23 20 15 10 8 6 11 10 32 31 29 18 18 18 15 25 24 32 19 21 10 15 14 11 9 14 16 10 10 12 13 10 11 11 15 21 11 11 11 12 10 8 15 19 8 9 9 8 10 16 17 11 11 11 11 11 11 12 15 10 8 8 6 6 8 12 10 11 11 10 8 8 8 8 8 8 8 8 9 9 9 12 8 11 11 13 13 11 12 12 10 8 8 9 13 17 18 10 11 10 8 8 8 10 10 19 11 9 8 10 10 8 8 10 19 10 10 10 12 10 10 10 8 9 8 12 14 10 9 9 13 15 15 15 13 10 11 11 11 11 13 13 12 12 10 10 10 12 13 13 10 10 10 10 10 10 9 9 8 8 8 6 8 7 7 10 10 10 15 11 8 8 8 8 10 10 11 10 8 8 10 9 8 12 10 10 10 10 10 12 11 15 15 12 10 10 10 10 9 9 9 10 12 9 9 9 9 10 10 10 10 8 8 8 8 8 10 15 13 12

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no543_a05.g1 MSMg01no543_a05.g1 CHROMAT_FILE:
MSMg01no543_a05.g1 PHD_FILE: MSMg01no543_a05.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 21:23:14 2005
         (387 letters)



>mm_chr9_55625004_55625790
          Length = 787

 Score =  640 bits (331), Expect = 0.0
 Identities = 363/385 (94%), Gaps = 17/385 (4%)
 Strand = Plus / Plus

                                                                       
Query: 1   agtcttaaatggtatgtcttcatcaaaacactcccctcaggctcagggatctatgtggaa 60
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agtcttaaatggcatgtcttcatcaaaacactcccctcaggctcagggatctatgtggaa 260

                                                                       
Query: 61  aaggtaggagaaagactaagaggtggaggaaatgggtgacttgaagaaaacagcattttc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 aaggtaggagaaagactaagaggtggaggaaatgggtgacttgaagaaaacagcattttc 320

                                                                       
Query: 121 cagaaacaaaacgactgatgtacataagaaggcagatagcagtacacaaaacctgcacaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cagaaacaaaacgactgatgtacataagaaggcagatagcagtacacaaaacctgcacaa 380

                                                                       
Query: 181 gtctagactttttattttcaatactccacaaccccttcccttatactgctcaaacaggtt 240
           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 381 gtctagtctttttattttcaatactccacaaccccttcccttatactgctcaaacaggct 440

                                                                       
Query: 241 acaatctaatacagcatttctattattacactacaggaaaggaattccccaatagcatct 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 acaatctaatacagcatttctattattacactacaggaaaggaattccccaatagcatct 500

                                                                       
Query: 301 tatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgntatatgtatgtaact 360
           |||||||||||||||||||||||||||||||                 ||||||||||||
Sbjct: 501 tatgtatgtatgtatgtatgtatgtatgtat-----------------atgtatgtaact 543

                                    
Query: 361 ttttcnanacaggtttctctgtgta 385
           ||||| | |||||||||||||||||
Sbjct: 544 ttttcgagacaggtttctctgtgta 568


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 26
Number of extensions: 5
Number of successful extensions: 5
Number of sequences better than 10.0: 1
Number of HSP's gapped: 2
Number of HSP's successfully gapped: 1
Length of query: 387
Length of database: 787
Length adjustment: 9
Effective length of query: 378
Effective length of database: 778
Effective search space:   294084
Effective search space used:   294084
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information