MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-005O14
Chromosome	1 (Build37)
Map Location	137,996,592 - 137,997,618
singlet/doublet	singlet
Overlap gene	Cacna1s
Upstream gene	Lgr6, Ptprv, LOC100042432, Ptpn7, Arl8a, Gpr37l1, LOC100043064, Elf3, Rnpep, Timm17a, Lmod1, Tmem58, Ipo9, Nav1, EG215714, LOC623327, Csrp1, Phlda3, Tnni1, Lad1, Tnnt2, LOC100042477, Pkp1, 9830123M21Rik, Tmem9, Ascl5
Downstream gene	Kif21b, 2310006M14Rik, 5730559C18Rik, LOC100042513, Gpr25, Camsap1l1, 9230116N13Rik, Ddx59, Kif14, Zfp281, LOC667686, EG623818, Nr5a2, Rnu7-ps3, LOC100042567
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lgr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329252 MGI:2441805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13924 MGI:108027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Ptpn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320139 MGI:2156893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68724 MGI:1915974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr37l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171469 MGI:1928503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043064 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 233 ESTs, 15 Proteins pseudo : _no_value

name	Elf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13710 MGI:1101781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnpep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215615 MGI:2384902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm17a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21854 MGI:1343131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93689 MGI:2135671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77552 MGI:1924802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ipo9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226432 MGI:1918944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nav1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215690 MGI:2183683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG215714 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215714 MGI:3646955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Csrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13007 MGI:88549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phlda3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27280 MGI:1351485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnni1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21952 MGI:105073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16763 MGI:109343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnnt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21956 MGI:104597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042477 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 3 Proteins

name	Pkp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18772 MGI:1328359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830123M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226438 MGI:3045352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins

name	Tmem9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66241 MGI:1913491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ascl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226439 MGI:2685043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Cacna1s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12292 MGI:88294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif21b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16565 MGI:109234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310006M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76422 MGI:1923672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	5730559C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67313 MGI:1921579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042513 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Gpr25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383563 MGI:2686146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	Camsap1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67886 MGI:1922434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230116N13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320054 MGI:2443255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ddx59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67997 MGI:1915247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kif14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381293 MGI:1098226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp281 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226442 MGI:3029290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667686 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins pseudo : _no_value

name	EG623818 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623818 MGI:3645105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 151 ESTs, 5 Proteins

name	Nr5a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26424 MGI:1346834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu7-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19869 MGI:105101
definition	note : U7 small nuclear RNA, pseudogene 3 pseudo : _no_value

name	LOC100042567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Lgr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369014 GeneID:329252 MGI:2441805
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeat-containing G protein-coupled receptor 6 transcript_id : NM_001033409.2

name	Ptprv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328114 GeneID:13924 MGI:108027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, V transcript_id : NM_007955.2

name	LOC100042432 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234269 GeneID:100042432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100042432 transcript_id : XM_001478190.1

name	Ptpn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130340 GeneID:320139 MGI:2156893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 7 transcript_id : NM_177081.3

name	Arl8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130256 GeneID:68724 MGI:1915974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 8A transcript_id : NM_026823.2

name	Gpr37l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794241 GeneID:171469 MGI:1928503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 37-like 1 transcript_id : NM_134438.1

name	Elf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892374 GeneID:13710 MGI:1101781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E74-like factor 3 transcript_id : NM_007921.2

name	Rnpep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353777 GeneID:215615 MGI:2384902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginyl aminopeptidase (aminopeptidase B) transcript_id : NM_145417.2

name	Timm17a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345310 GeneID:21854 MGI:1343131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 17a transcript_id : NM_011590.2

name	Lmod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948540 GeneID:93689 MGI:2135671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leiomodin 1 (smooth muscle) transcript_id : NM_053106.2

name	Tmem58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129842 GeneID:77552 MGI:1924802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 58 transcript_id : NM_175259.4

name	Ipo9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734860 GeneID:226432 MGI:1918944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : importin 9 transcript_id : NM_153774.1

name	Nav1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077104 GeneID:215690 MGI:2183683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron navigator 1 transcript_id : NM_173437.1

name	EG215714 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803322 GeneID:215714 MGI:3646955
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG215714 transcript_id : NM_175447.3

name	LOC623327 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94363976 GeneID:623327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical LOC623327 transcript_id : XM_897682.2

name	Csrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367677 GeneID:13007 MGI:88549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine and glycine-rich protein 1 transcript_id : NM_007791.3

name	Phlda3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305376 GeneID:27280 MGI:1351485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology-like domain, family A, member 3 transcript_id : NM_013750.1

name	Tnni1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981669 GeneID:21952 MGI:105073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin I, skeletal, slow 1 transcript_id : NM_021467.4

name	Lad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802090 GeneID:16763 MGI:109343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ladinin transcript_id : NM_133664.3

name	Tnnt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755842 GeneID:21956 MGI:104597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin T2, cardiac transcript_id : NM_011619.1

name	LOC100042477 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234272 GeneID:100042477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 3 Proteins product : similar to general transcription factor II I repeat domain-containing 1 transcript_id : XM_001478282.1

name	Pkp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130660 GeneID:18772 MGI:1328359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plakophilin 1 transcript_id : NM_019645.2

name	9830123M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234274 GeneID:226438 MGI:3045352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins product : RIKEN cDNA 9830123M21 gene transcript_id : XM_001478294.1

name	Tmem9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981292 GeneID:66241 MGI:1913491
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 9 transcript_id : NM_025439.2

name	Cacna1s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486621 GeneID:12292 MGI:88294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, L type, alpha 1S subunit transcript_id : NM_001081023.1

name	Kif21b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86990453 GeneID:16565 MGI:109234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 21B transcript_id : NM_001039472.1

name	5730559C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51571944 GeneID:67313 MGI:1921579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730559C18 gene transcript_id : NM_028872.2

name	Gpr25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363979 GeneID:383563 MGI:2686146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : G protein-coupled receptor 25 transcript_id : XM_357126.3

name	Camsap1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486888 GeneID:67886 MGI:1922434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin regulated spectrin-associated protein 1-like 1 transcript_id : NM_001081360.1

name	9230116N13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234277 GeneID:320054 MGI:2443255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 9230116N13 gene transcript_id : XM_001478397.1

name	Ddx59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362902 GeneID:67997 MGI:1915247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 transcript_id : NM_026500.2

name	Ddx59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349852 GeneID:67997 MGI:1915247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 transcript_id : NM_178052.3

name	Kif14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486926 GeneID:381293 MGI:1098226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 14 transcript_id : NM_001081258.1

name	Zfp281 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803475 GeneID:226442 MGI:3029290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 281 transcript_id : NM_177643.3

name	EG623818 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234279 GeneID:623818 MGI:3645105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 151 ESTs, 5 Proteins product : predicted gene, EG623818 transcript_id : XM_888318.3

name	Nr5a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14010846 GeneID:26424 MGI:1346834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 5, group A, member 2 transcript_id : NM_030676.1

name	Lgr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781785 CCDS:CCDS15314.1 GeneID:329252 MGI:2441805
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016500 - protein-hormone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : leucine-rich repeat-containing G protein-coupled receptor 6 protein_id : NP_001028581.1

name	Ptprv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328115 GeneID:13924 MGI:108027
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006977 - DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest [Evidence IGI]; GO:0031571 - G1 DNA damage checkpoint [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IGI]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP] [Evidence IGI]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : embryonic stem cell phosphatase; tyrosine phosphatase product : protein tyrosine phosphatase, receptor type, V protein_id : NP_031981.2

name	LOC100042432 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234270 GeneID:100042432
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478240.1

name	Ptpn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892997 CCDS:CCDS15315.1 GeneID:320139 MGI:2156893
definition	GO_function : GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IMP] [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase, non-receptor type 7 protein_id : NP_796055.1

name	Arl8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956194 CCDS:CCDS15316.1 GeneID:68724 MGI:1915974
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : small G protein indispensable for equal chromosome segregation 2 product : ADP-ribosylation factor-like 10B protein_id : NP_081099.1

name	Gpr37l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794242 GeneID:171469 MGI:1928503
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 37-lke 1; endothelin B receptor-like protein-2; orphan Gpr37-like protein 1 product : G protein-coupled receptor 37-like 1 protein_id : NP_602320.1

name	Elf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679629 GeneID:13710 MGI:1101781
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IMP] GO_process : GO:0009790 - embryonic development [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0009653 - morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E74-like factor 3 protein_id : NP_031947.1

name	Rnpep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703832 CCDS:CCDS15317.1 GeneID:215615 MGI:2384902
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0030601 - aminopeptidase B activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0016485 - protein processing [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : arginyl aminopeptidase (aminopeptidase B) protein_id : NP_663392.1

name	Timm17a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468943 CCDS:CCDS15318.1 GeneID:21854 MGI:1343131
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : translocator of inner mitochondrial membrane 17 kDa, a; translocator of inner mitochondrial membrane a product : translocator of inner mitochondrial membrane 17a protein_id : NP_035720.1

name	Lmod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948541 GeneID:93689 MGI:2135671
definition	codon_start : 1 product : leiomodin 1 (smooth muscle) protein_id : NP_444336.2

name	Tmem58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424906 CCDS:CCDS15319.1 GeneID:77552 MGI:1924802
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 58 protein_id : NP_780468.1

name	Ipo9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734861 GeneID:226432 MGI:1918944
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0042393 - histone binding [Evidence IDA]; GO:0008565 - protein transporter activity [Evidence ISS]; GO:0008536 - Ran GTPase binding [Evidence TAS] GO_process : GO:0006606 - protein import into nucleus [Evidence IDA]; GO:0050821 - protein stabilization [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006610 - ribosomal protein import into nucleus [Evidence ISS]; GO:0042254 - ribosome biogenesis and assembly [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Ran binding protein 9 product : importin 9 protein_id : NP_722469.1

name	Nav1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077105 GeneID:215690 MGI:2183683
definition	GO_component : GO:0015630 - microtubule cytoskeleton [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0001578 - microtubule bundle formation [Evidence IDA]; GO:0001764 - neuron migration [Evidence IMP] codon_start : 1 exception : mismatches in translation product : neuron navigator 1 protein_id : NP_775613.1

name	EG215714 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425174 GeneID:215714 MGI:3646955
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC215714 protein_id : NP_780656.1

name	LOC623327 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94363977 GeneID:623327
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902775.2

name	Csrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681069 CCDS:CCDS15320.1 GeneID:13007 MGI:88549
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence TAS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS] codon_start : 1 note : cysteine rich protein; cysteine rich protein 1 product : cysteine and glycine-rich protein 1 protein_id : NP_031817.1

name	Phlda3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305377 GeneID:27280 MGI:1351485
definition	codon_start : 1 note : TDAG/lpl homolog 1 product : pleckstrin homology-like domain, family A, member 3 protein_id : NP_038778.1

name	Tnni1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946862 GeneID:21952 MGI:105073
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 product : troponin I, skeletal, slow 1 protein_id : NP_067442.1

name	Lad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981555 GeneID:16763 MGI:109343
definition	GO_component : GO:0005604 - basement membrane [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] codon_start : 1 product : ladinin protein_id : NP_598425.2

name	Tnnt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755843 GeneID:21956 MGI:104597
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030017 - sarcomere [Evidence IDA]; GO:0005861 - troponin complex [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IDA] GO_process : GO:0006936 - muscle contraction [Evidence IDA] codon_start : 1 note : cardiac TnT product : troponin T2, cardiac protein_id : NP_035749.1

name	LOC100042477 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234273 GeneID:100042477
definition	codon_start : 1 product : similar to general transcription factor II I repeat domain-containing 1 protein_id : XP_001478332.1

name	Pkp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790161 CCDS:CCDS15322.1 GeneID:18772 MGI:1328359
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030057 - desmosome [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0019215 - intermediate filament binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0030280 - structural constituent of epidermis [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 product : plakophilin 1 protein_id : NP_062619.1

name	9830123M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234275 GeneID:226438 MGI:3045352
definition	codon_start : 1 product : eEF1A2 binding protein protein_id : XP_001478344.1

name	Tmem9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384842 CCDS:CCDS15323.1 GeneID:66241 MGI:1913491
definition	GO_component : GO:0005770 - late endosome [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane protein 9 protein_id : NP_079715.1

name	Cacna1s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486622 GeneID:12292 MGI:88294
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0030315 - T-tubule [Evidence IDA]; GO:0005891 - voltage-gated calcium channel complex [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : dihydropyridine receptor alpha 1S; muscle dysgenesis; DHPR alpha1s product : calcium channel, voltage-dependent, L type, alpha 1S subunit protein_id : NP_001074492.1

name	Kif21b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86990454 CCDS:CCDS15324.1 GeneID:16565 MGI:109234
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : N-5 kinesin product : kinesin family member 21B protein_id : NP_001034561.1

name	5730559C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51571945 CCDS:CCDS15325.1 GeneID:67313 MGI:1921579
definition	codon_start : 1 product : hypothetical protein LOC67313 protein_id : NP_083148.2

name	Gpr25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38073371 GeneID:383563 MGI:2686146
definition	codon_start : 1 product : similar to putative G protein-coupled receptor protein_id : XP_357126.1

name	Camsap1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486889 GeneID:67886 MGI:1922434
definition	codon_start : 1 product : calmodulin regulated spectrin-associated protein 1-like 1 protein_id : NP_001074829.1

name	9230116N13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234278 GeneID:320054 MGI:2443255
definition	codon_start : 1 product : hypothetical protein LOC320054 protein_id : XP_001478447.1

name	Ddx59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385988 CCDS:CCDS15326.1 GeneID:67997 MGI:1915247
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 isoform 1 protein_id : NP_080776.1

name	Ddx59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017343 GeneID:67997 MGI:1915247
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 isoform 2 protein_id : NP_835153.1

name	Kif14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486927 GeneID:381293 MGI:1098226
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : N-3 kinesin product : kinesin family member 14 protein_id : NP_001074727.1

name	Zfp281 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244048 CCDS:CCDS15327.1 GeneID:226442 MGI:3029290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 281 protein_id : NP_808311.1

name	EG623818 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234280 GeneID:623818 MGI:3645105
definition	codon_start : 1 product : similar to Hydroxymethylbilane synthase protein_id : XP_893411.2

name	Nr5a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14010847 CCDS:CCDS15328.1 GeneID:26424 MGI:1346834
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008206 - bile acid metabolism [Evidence IMP]; GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : fetoprotein transcription factor product : nuclear receptor subfamily 5, group A, member 2 protein_id : NP_109601.1

name	Ascl5 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:226439
definition	number : 1 pseudo : _no_value

name	Ascl5 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:226439
definition	number : 2 pseudo : _no_value

name	LOC100042513 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042513
definition	number : 1 pseudo : _no_value

name	LOC100042513 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042513
definition	number : 2 pseudo : _no_value

name	LOC100042567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042567
definition	number : 4 pseudo : _no_value

name	LOC100042567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042567
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:124408
definition	standard_name : 41.MMHAP33FRF11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234221
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178469
definition	standard_name : AW047233

name	(CDS detail)
type	STS
link
xref	UniSTS:128815
definition	standard_name : D1Mit445.2

name	(CDS detail)
type	STS
link
xref	UniSTS:128814
definition	standard_name : D1Mit445

name	(CDS detail)
type	STS
link
xref	UniSTS:210482
definition	standard_name : RH136499

name	(CDS detail)
type	STS
link
xref	UniSTS:240992
definition	standard_name : D4Mon28

name	(CDS detail)
type	STS
link
xref	UniSTS:165107
definition	standard_name : AI845704

name	(CDS detail)
type	STS
link
xref	UniSTS:163062
definition	standard_name : RH126354

name	(CDS detail)
type	STS
link
xref	UniSTS:186243
definition	standard_name : M-04311

name	(CDS detail)
type	STS
link
xref	UniSTS:234222
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128866
definition	standard_name : D1Mit498

name	(CDS detail)
type	STS
link
xref	UniSTS:178471
definition	standard_name : AW545626

name	(CDS detail)
type	STS
link
xref	UniSTS:161598
definition	standard_name : RH124776

name	(CDS detail)
type	STS
link
xref	UniSTS:270614
definition	standard_name : PMC130177P2

name	(CDS detail)
type	STS
link
xref	UniSTS:158859
definition	standard_name : AA959891

name	(CDS detail)
type	STS
link
xref	UniSTS:162567
definition	standard_name : RH125822

name	(CDS detail)
type	STS
link
xref	UniSTS:178470
definition	standard_name : AF151099

name	(CDS detail)
type	STS
link
xref	UniSTS:216537
definition	standard_name : RH133254

name	(CDS detail)
type	STS
link
xref	UniSTS:165105
definition	standard_name : AW049021

name	(CDS detail)
type	STS
link
xref	UniSTS:163265
definition	standard_name : AI747285

name	(CDS detail)
type	STS
link
xref	UniSTS:124496
definition	standard_name : 43.MMHAP26FRG10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158857
definition	standard_name : L47570

name	(CDS detail)
type	STS
link
xref	UniSTS:163264
definition	standard_name : Y07941

name	(CDS detail)
type	STS
link
xref	UniSTS:178475
definition	standard_name : AI528551

name	(CDS detail)
type	STS
link
xref	UniSTS:271736
definition	standard_name : PMC18818P1

name	(CDS detail)
type	STS
link
xref	UniSTS:128439
definition	standard_name : D1Mit103

name	(CDS detail)
type	STS
link
xref	UniSTS:234223
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178474
definition	standard_name : AW545782

name	(CDS detail)
type	STS
link
xref	UniSTS:178473
definition	standard_name : AW493108

name	(CDS detail)
type	STS
link
xref	UniSTS:165106
definition	standard_name : AI834762

name	(CDS detail)
type	STS
link
xref	UniSTS:178472
definition	standard_name : AW061096

name	(CDS detail)
type	STS
link
xref	UniSTS:128535
definition	standard_name : D1Mit197

name	(CDS detail)
type	STS
link
xref	UniSTS:167269
definition	standard_name : RH127070

name	(CDS detail)
type	STS
link
xref	UniSTS:234225
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234227
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234224
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128905
definition	standard_name : D1Mit538

name	(CDS detail)
type	STS
link
xref	UniSTS:207222
definition	standard_name : RH126594

name	(CDS detail)
type	STS
link
xref	UniSTS:234226
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167266
definition	standard_name : RH126840

name	(CDS detail)
type	STS
link
xref	UniSTS:186334
definition	standard_name : 25.MHAa58c1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:167297
definition	standard_name : D1Ertd811e

name	(CDS detail)
type	STS
link
xref	UniSTS:210273
definition	standard_name : RH136280

name	(CDS detail)
type	STS
link
xref	UniSTS:271761
definition	standard_name : PMC193920P1

name	(CDS detail)
type	misc_feature
link
xref
definition	note : proximal sequence element

name	LOC100043064 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234318 GeneID:100043064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 233 ESTs, 15 Proteins product : similar to nucleosome assembly protein 1-like 1 pseudo : _no_value transcript_id : XR_034434.1

name	2310006M14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149234276 GeneID:76422 MGI:1923672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 2310006M14 gene transcript_id : XR_033650.1

name	LOC667686 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234319 GeneID:667686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : similar to macrophage migration inhibitory factor pseudo : _no_value transcript_id : XR_034494.1

name	(CDS detail)
type	misc_signal
link
xref
definition	note : 3' signal

clone name	MSMg01-513E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334I21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-155B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037P04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-005O14.b	B6Ng01-005O14.g
ACC	DH842919	DH842920
length	1,194	1,025
definition	DH842919\|Mus musculus domesticus DNA, BAC clone: B6Ng01-005O14, 5' end.	DH842920\|Mus musculus domesticus DNA, BAC clone: B6Ng01-005O14, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcccttgcctgaagccactttttgatgaaaatacatgggacaca aatatcttcacatcctttgctcatttggagagatttatccacatacttct tccccagatatctttcttaccaattttccaatggtgatctttccaagttc ctgaccatccaattaatcagtccatttggctacagcccatgagtcattga acaatggtatatctggtcatttcttcttccaaacaaactgtaataccatg tgtactgccctatgttctgcccactgtgaagatttatcttcaccagtatc tttcagggttgtcccagaaaggggctgtaattctgcagctgtccacttct gggtggtacctgcataacgcgcagagccatcagtaaagtaaaccaggccc tagtcttctcttcctcagtcagccgatcatagggaaccccccatgaggct atcgatacactcgtggcattgtaacaggaataggaaccataggtatttgg acaacttcttcacgtaatttgcttgtaccttcaggacctgctcgggctcc gatcttgtatataccacttctgtttgataatggaatgctgctgtgcacgt cctactttatgacttggaatgtcagataacacccagctcatgatgggcag ttcaggtcacatggtaactttggtggcctattgtcaaacattcagttttc actaaggcccaatagcaggccaagaactatctttcaaagggagaatagtt gtctgcagatgttggtagtaccttgcttcaaaatcccaaaggtctcttct gtgattcacttaaaggagcctgccaaaggctctaaatagcatctttatct cccactcacatctcaagtatcattggatctgctggatcatatattatagt caaattataggacagcgtggatctgttaaagagccttctcctgttccagg cccctcacaaagctagcagcttgcaaatcacttggtaaacgggcctgtgt gatgcattcaagtgaaaaggtgctgtctccagattccaaatagaaccatt aatgttgcttctttttttgggtggtgggagggcccaggttcaacacttcc cttttgaaagggatacttcctgtcagccccagcccatggacttctagaga ttttacagaggtgaccaatctcagaaattgtgcgcaaattacct	gaattccaccttgggtggagcctgagcatagagactcaaagcccacccct acaagtgacgtatttcctccaacaaggccatacctactccaacaaggcca cacctgttccaacaaggctacacctcttaatagtgccactcactgggcca agcatattcaaaccaccacactggggcagctggtatataggagtcttacc tagctctgtttcccactagacagatgtcaaccccagaaccccagggtctt ctctttagtcctataccatagtgactatgctaagccctgcctaggagact cagttttggtcacccagaaccaaatatataaatgacatttgtagccttga gccatacttggtcaaacttatggttgttgaacctccacactcccctctgc cactgcttattgtagacggaacagttatgaaagttattcttgagatctgg tagaagagattactaatctcctagcttgctgagataaaaacaggcacttt ccaaagagaagatggatcggggattgtgatctgtagctgggaagcccggc actcctggcctacctcattcatgttgcctctccagcattacaaccagtcg gaacagatgaaccacatctcagacattctcaacgtggctttcaccatcat ctttcaccctggagatggtcctcaagctcatagctttcagcccagggtga gtgactgggccacggggacaaaggaacagctgtggcctgggaggagagac tttcccctccttatacctgaggctcttctgcctttctgctctcaggctgc tcatgcctatgctatgcctcctgtcagatgcaggcctagcaaaacttcca gagtcaaattggaatgctggaatatagatgctcgccactgcatctgtgga cctgttccacatccatgccttcttttcttgcttctagagcacaagtctcg aactaggagaagatcttgttttgtttttaggtctcagattattcccacag tcccatcctaatccaactgagttct
quality values	Open. Hide. 12 32 23 24 17 8 10 10 14 45 43 43 61 50 50 47 50 47 36 37 52 38 27 55 61 61 12 16 9 5 7 8 6 7 8 8 17 12 23 19 18 33 55 55 55 55 59 59 52 49 52 59 52 59 59 59 61 59 59 41 61 59 61 61 61 61 59 59 61 12 13 17 9 18 21 26 23 18 26 26 28 27 41 38 59 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 59 59 55 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 52 59 59 44 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 52 59 59 59 45 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 59 52 59 59 59 61 52 59 59 49 59 59 59 31 49 49 52 50 30 43 49 52 52 52 55 55 52 55 49 55 55 52 55 43 61 61 61 61 61 61 61 61 61 61 55 52 52 52 37 52 52 52 52 52 55 52 61 61 55 55 55 61 52 55 55 61 61 55 55 61 61 61 61 55 61 61 61 47 61 55 61 50 61 55 55 61 55 55 61 55 61 61 61 50 55 61 61 55 55 61 61 61 55 55 55 61 50 61 61 61 61 61 61 55 55 61 55 55 55 47 55 55 36 55 55 55 61 61 61 61 61 61 50 53 61 61 61 61 61 61 61 61 50 61 53 53 61 61 53 61 61 61 61 61 61 61 50 50 61 61 61 61 45 50 38 61 43 33 61 61 61 53 61 53 61 61 61 61 61 61 61 52 61 47 53 61 61 53 45 42 40 50 61 52 61 61 50 61 61 61 45 61 61 31 61 61 61 61 30 45 61 50 61 61 61 61 52 47 61 61 61 52 47 47 38 53 47 47 53 52 53 53 47 32 52 53 57 57 52 53 35 50 53 42 57 50 39 48 57 53 45 53 22 53 53 36 57 36 45 53 40 45 52 57 47 45 33 34 50 40 42 40 50 40 26 53 53 37 43 43 43 42 43 38 38 23 53 38 42 45 45 45 45 45 27 12 32 37 32 10 47 22 37 38 42 53 53 25 52 39 53 32 38 47 8 27 16 57 36 45 28 41 22 32 22 16 32 45 46 10 29 28 30 23 20 8 8 12 11 19 27 22 16 20 23 12 17 21 20 53 32 38 25 35 30 57 8 15 35 30 50 37 28 57 45 32 17 19 23 24 57 50 53 25 40 18 25 53 38 34 33 31 19 37 32 30 21 32 18 52 35 48 53 11 34 46 29 44 28 9 23 21 40 36 52 40 27 27 27 33 12 57 57 37 27 24 57 52 23 53 36 21 53 33 36 24 28 23 37 37 23 33 36 31 37 29 30 22 24 30 40 24 16 37 18 10 23 33 16 32 29 30 29 9 30 26 39 33 21 53 21 37 36 30 40 57 20 30 28 23 32 21 34 32 30 51 33 34 20 38 34 30 30 23 20 24 39 39 16 28 9 32 34 29 27 17 28 39 30 28 39 29 24 44 24 29 22 16 22 39 34 38 28 16 18 27 37 32 24 23 10 7 24 29 29 14 10 18 29 19 8 31 9 17 7 5 5 7 8 8 26 17 28 29 23 17 34 29 29 27 27 12 23 28 27 7 8 30 29 37 25 16 15 8 24 19 15 29 33 29 30 19 12 29 14 25 16 23 28 31 33 25 51 39 29 28 24 18 28 21 46 25 13 23 9 7 26 27 19 10 26 30 31 20 21 25 43 33 26 23 26 28 27 28 28 33 28 31 51 23 28 14 51 25 8 14 10 9 7 12 12 11 19 12 31 20 15 36 25 24 16 28 23 26 17 8 7 19 6 6 10 9 22 22 19 27 15 17 19 21 38 9 12 38 8 22 29 17 19 29 9 16 9 9 13 18 19 38 12 20 22 19 44 9 20 6 7 5 18 27 29 19 9 39 39 39 44 30 10 9 12 18 9 18 22 9 23 42 12 10 8 39 11 6 19 26 11 4 3 8 9 13 8 4 4 6 10 5 13 11 12 9 11 26 29 9 4 10 30 7 14 13 9 19 6 10 10 5 7 8 12 25 10 8 3 1 1 3 3 12 9 7 5 7 17 13 3 3 3 5 4 4 4 4 9 3 1 6 14 11 3 4 18 20 7 4 3 2 3 4 4 3 6 5 4 3 5 9 5 5 9 4 3 4 5 23 20 7 26 25 4 3 5 7 5 9 9 16 8 4 5 3 3 3 6	Open. Hide. 50 61 50 55 50 55 43 10 7 11 8 6 5 6 8 8 20 23 24 25 33 49 52 61 49 49 55 43 55 52 43 59 59 61 61 61 59 59 59 59 59 59 59 59 59 61 61 61 61 24 15 24 12 12 12 21 19 24 20 27 35 43 45 52 59 61 61 61 61 61 61 61 61 61 61 59 61 52 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 59 59 59 59 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 59 61 61 61 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 52 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 59 59 59 43 59 61 61 61 61 61 61 59 59 49 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 59 61 61 61 59 61 61 61 59 59 59 59 59 52 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 52 59 61 52 61 59 61 61 59 59 61 61 59 59 59 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 52 59 59 61 61 61 61 59 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 52 52 52 52 55 50 34 36 41 52 61 55 61 61 61 61 61 55 40 49 61 61 61 61 61 61 61 55 49 49 55 55 52 61 61 61 61 61 52 61 61 61 61 61 61 61 43 52 52 36 52 61 61 28 37 37 21 29 15 61 50 38 61 38 55 47 50 55 55 55 55 47 55 55 47 55 55 50 55 41 47 43 50 61 61 61 61 61 55 47 35 55 55 50 50 39 50 37 49 61 55 38 47 61 61 55 55 55 43 50 53 50 61 47 61 61 50 61 50 50 61 38 38 53 47 53 53 61 47 32 61 61 35 61 47 47 43 61 61 50 43 43 61 61 61 61 50 61 61 50 50 50 50 50 53 43 43 53 61 61 61 50 61 61 53 61 61 52 45 61 61 50 39 38 38 27 31 35 61 47 61 52 39 61 53 40 50 45 61 45 50 47 42 43 40 42 47 17 47 53 53 50 52 47 53 30 37 61 53 53 53 39 53 45 52 43 27 29 27 28 33 24 50 40 53 53 42 16 53 32 12 45 45 50 53 40 31 53 40 43 13 31 53 35 53 53 53 43 22 50 43 38 50 50 34 53 42 16 47 8 43 21 18 24 47 45 53 52 53 32 47 19 31 25 19 32 53 45 47 31 14 14 14 14 10 19 45 39 39 32 30 36 21 17 17 25 30 53 53 36 29 20 50 18 32 32 22 32 39 37 25 41 38 47 27 27 39 26 35 27 53 47 53 35 15 17 53 52 30 39 23 50 42 16 32 42 21 24 9 17 17 12 35 32 23 10 26 31 19 52 37 9 52 21 33 18 11 20 23 33 26 11 10 14 9 14 19 36 32 20 32 28 36 33 27 47 18 50 24 50 41 25 30 22 10 47 21 31 13 57 22 33 35 47 16 18 23 32 28 32 21 31 8 7 9 13 15 33 19 32 37 14 37 24 27 37 31 23 11 10 17 20 12 38 23 20 22 24 52 21 29 18 14 31 9 28 19 25 37 34 18 14 10 19 15 26 18 30 37 27 27 46 11 10 15 19 18 57 8 27 41 41 37 14 6 6 15 20 23 13 8 6 7 9 21 20 17 5 5 10 17 23 23 44 32 41 33 33 39 19 38 23 12 21 18 32 30 15 11 17 19 30 12 18 21 29 9 32 17 26 8 30 23 13 12 27 28 33 21 9 13 7 20 28 13 15 30 41 19 44 48 25 24 13 6 14 21 39 20 15 7 13 18 23 13 18 7 10 29 27 14 29 16 29 25 10 34 28 16 23 26 31 11 12 5 11 7 5 7 7 9 7 33 46 23 41 31 21 29 13 51 46 41 18 10 12 12 9 7 10 10 19 7 28 9 8 6 13 26 21 28 26 9 7 7 6 17 24 28 27 12 11 13 11 26 8 9 17 25 29 20 20 28 28 17 12 5 19 19 17 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_137996592_137997618
seq2: B6Ng01-005O14.g_71_1095

seq1  GAATTCCACCCTGGGTGGAGCCTGAGCATAGAGACTCAAAGCCCACCCCT  50
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACCTTGGGTGGAGCCTGAGCATAGAGACTCAAAGCCCACCCCT  50

seq1  ACAAGTGACGTATTTCCTCCAACAAGGCCATACCTACTCCAACAAGGCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTGACGTATTTCCTCCAACAAGGCCATACCTACTCCAACAAGGCCA  100

seq1  CACCTGTTCCAACAAGGCTACACCTCTTAATAGTGCCACTCACTGGGCCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTGTTCCAACAAGGCTACACCTCTTAATAGTGCCACTCACTGGGCCA  150

seq1  AGCATATTCAAACCACCACACTGGGGCAGCTGGTATATAGGAGTCTTACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATATTCAAACCACCACACTGGGGCAGCTGGTATATAGGAGTCTTACC  200

seq1  TAGCTCTGTTTCCCACTAGACAGATGTCAACCCCAGAACCCCAGGGTCTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTCTGTTTCCCACTAGACAGATGTCAACCCCAGAACCCCAGGGTCTT  250

seq1  CTCTTTAGTCCTATACCATAGTGACTATGCTAAGCCCTGCCTAGGAGACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTAGTCCTATACCATAGTGACTATGCTAAGCCCTGCCTAGGAGACT  300

seq1  CAGTTTTGGTCACCCAGAACCAAATATATAAATGACATTTGTAGCCTTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTTTGGTCACCCAGAACCAAATATATAAATGACATTTGTAGCCTTGA  350

seq1  GCCATACTTGGTCAAACTTATGGTTGTTGAACCTCCACACTCCCCTCTGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATACTTGGTCAAACTTATGGTTGTTGAACCTCCACACTCCCCTCTGC  400

seq1  CACTGCTTATTGTAGACGGAACAGTTATGAAAGTTATTCTTGAGATCTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGCTTATTGTAGACGGAACAGTTATGAAAGTTATTCTTGAGATCTGG  450

seq1  TAGAAGAGATTACTAATCTCCTAGCTTGCTGAGATAAAAACAGGCACTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAGAGATTACTAATCTCCTAGCTTGCTGAGATAAAAACAGGCACTTT  500

seq1  CCAAAGAGAAGATGGATCGGGGATTGTGATCTGTAGCTGGGAAGCCCGGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGAGAAGATGGATCGGGGATTGTGATCTGTAGCTGGGAAGCCCGGC  550

seq1  ACTCCTGGCCTACCTCATTCATGTTGCCTCTCCAGCATTACAACCAGTCG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCTGGCCTACCTCATTCATGTTGCCTCTCCAGCATTACAACCAGTCG  600

seq1  GAACAGATGAACCACATCTCAGACATTCTCAACGTGGCTTTCACCATCAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAGATGAACCACATCTCAGACATTCTCAACGTGGCTTTCACCATCAT  650

seq1  C-TTCACCCTGGAGATGGTCCTCAAGCTCATAGCTTTCAAGCCCAGGGTG  699
      | |||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CTTTCACCCTGGAGATGGTCCTCAAGCTCATAGCTTTC-AGCCCAGGGTG  699

seq1  AGTGACTGGGCCACGGGGACAAAGGAACAGCTGTGGCCTGGGAGGAGAGA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACTGGGCCACGGGGACAAAGGAACAGCTGTGGCCTGGGAGGAGAGA  749

seq1  CTTTCCCCTCCTTATACCTGAGGCTCTTCTGCC-TTCTGCTCTCAGGCTG  798
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CTTTCCCCTCCTTATACCTGAGGCTCTTCTGCCTTTCTGCTCTCAGGCTG  799

seq1  CTCATGCCTATGCTATGCCTCCTGTCAGATGCAGGCCTAGCAAAACTTCC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATGCCTATGCTATGCCTCCTGTCAGATGCAGGCCTAGCAAAACTTCC  849

seq1  AGAAGTCAAAATGGAGTGCTGGTATATAGATGCTCGCCACTGCATCTGTG  898
      || ||||||| |||| |||||| |||||||||||||||||||||||||||
seq2  AG-AGTCAAATTGGAATGCTGGAATATAGATGCTCGCCACTGCATCTGTG  898

seq1  GACCTGTT-CACATCCCATGCCTTCCTTTC-TGCTTCTAGAGCACAAGTC  946
      |||||||| ||||| |||||||||| |||| |||||||||||||||||||
seq2  GACCTGTTCCACAT-CCATGCCTTCTTTTCTTGCTTCTAGAGCACAAGTC  947

seq1  TCGAACTAGGAGAAGATCTTGTTTTGTTTTTTAGGCTCTCAGATCTATTC  996
      |||||||||||||||||||||||||| |||||||| |||||||| |||||
seq2  TCGAACTAGGAGAAGATCTTGTTTTG-TTTTTAGG-TCTCAGAT-TATTC  994

seq1  CCACAGTCCCATCTTAGTCCAACTGAGTTCT  1027
      ||||||||||||| || ||||||||||||||
seq2  CCACAGTCCCATCCTAATCCAACTGAGTTCT  1025

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information