MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-151L04
Chromosome	1 (Build37)
Map Location	173,676,411 - 173,677,305
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Atf6, Dusp12, Fcrlb, Fcrla, LOC100040778, Fcgr2b, Fcgr4, Fcgr3, 1700009P17Rik, Sdhc, Mpz, Pcp4l1, Nr1i3, Tomm40l, Apoa2, Fcer1g, Ndufs2, Adamts4, B4galt3, Ppox, Usp21, Ufc1, EG622236, Dedd, Nit1, Pfdn2, 1190002J23Rik, Pvrl4, Arhgap30, Usf1, EG226654, F11r, Refbp2, Itlna, Cd244, Ly9, Slamf7, Cd48, LOC100041098
Downstream gene	Slamf1, Cd84, Slamf6, Vangl2, LOC100040199, Nhlh1, Ncstn, Copa, Pex19, LOC100041219, Wdr42a, Pea15a, Casq1, Timm23p, Atp1a2, Igsf8, Kcnj9, Kcnj10, Pigm, LOC665819, Slamf9, LOC100040274, Igsf9, Tagln2, Ccdc19, EG240916, Slamf8, Fcrl6, Dusp23, LOC100040320, Crp
Link	Open Mouse BAC browser

Click to get alignment info.

name	Atf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226641 MGI:1926157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80915 MGI:1890614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrlb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435653 MGI:3576487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98752 MGI:2138647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040778 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 192 ESTs, 4 Proteins

name	Fcgr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14130 MGI:95499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fcgr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246256 MGI:2179523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcgr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14131 MGI:95500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700009P17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75472 MGI:1922722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdhc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66052 MGI:1913302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17528 MGI:103177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcp4l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66425 MGI:1913675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 133 ESTs, 1 Protein

name	Nr1i3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12355 MGI:1346307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tomm40l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:641376 MGI:3589112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11807 MGI:88050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcer1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14127 MGI:95496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226646 MGI:2385112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamts4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240913 MGI:1339949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57370 MGI:1928767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19044 MGI:104968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30941 MGI:1353665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ufc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66155 MGI:1913405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622236 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622236 MGI:3645348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 600 ESTs, 6 Proteins

name	Dedd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21945 MGI:1333874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27045 MGI:1350916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfdn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18637 MGI:1276111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190002J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68874 MGI:1916124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pvrl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71740 MGI:1918990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226652 MGI:2684948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22278 MGI:99542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG226654 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226654 MGI:3648482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins

name	F11r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16456 MGI:1321398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Refbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56009 MGI:1913144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itlna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16429 MGI:1333831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd244 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18106 MGI:109294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17085 MGI:96885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slamf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75345 MGI:1922595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12506 MGI:88339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 236 ESTs, 4 Proteins

name	Slamf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27218 MGI:1351314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12523 MGI:1336885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slamf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30925 MGI:1353620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vangl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93840 MGI:2135272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Nhlh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18071 MGI:98481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncstn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59287 MGI:1891700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12847 MGI:1334462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19298 MGI:1334458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 179 ESTs, 6 Proteins

name	Wdr42a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98193 MGI:91860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pea15a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18611 MGI:104799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12372 MGI:1309468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm23p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:218888
definition	note : translocase of inner mitochondrial membrane 23 homolog pseudogene pseudo : _no_value

name	Atp1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98660 MGI:88106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140559 MGI:2154090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16524 MGI:108007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16513 MGI:1194504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67556 MGI:1914806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Slamf9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98365 MGI:1923692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040274 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Igsf9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93842 MGI:2135283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tagln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21346 MGI:1312985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71870 MGI:1919120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins

name	EG240916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240916 MGI:3642995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slamf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74748 MGI:1921998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcrl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:677296 MGI:3618339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	Dusp23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68440 MGI:1915690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040320 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 168 ESTs, 2 Proteins pseudo : _no_value

name	Crp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12944 MGI:88512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486810 GeneID:226641 MGI:1926157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 6 transcript_id : NM_001081304.1

name	Dusp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778929 GeneID:80915 MGI:1890614
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 12 transcript_id : NM_023173.2

name	Fcrlb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288908 GeneID:435653 MGI:3576487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like B transcript_id : NM_001029984.2

name	Fcrla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553084 GeneID:98752 MGI:2138647
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor-like A transcript_id : NM_145141.1

name	LOC100040778 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245374 GeneID:100040778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 192 ESTs, 4 Proteins product : similar to ubiquinol-cytochrome c reductase binding protein transcript_id : XM_001475899.1

name	Fcgr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063577 GeneID:14130 MGI:95499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity IIb transcript_id : NM_010187.2

name	Fcgr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063578 GeneID:14130 MGI:95499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity IIb transcript_id : NM_001077189.1

name	Fcgr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362368 GeneID:246256 MGI:2179523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity IV transcript_id : NM_144559.1

name	Fcgr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76150626 GeneID:14131 MGI:95500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, low affinity III transcript_id : NM_010188.4

name	1700009P17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486892 GeneID:75472 MGI:1922722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700009P17 gene transcript_id : NM_001081275.1

name	Sdhc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803581 GeneID:66052 MGI:1913302
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate dehydrogenase complex, subunit C, integral membrane protein transcript_id : NM_025321.2

name	Mpz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802366 GeneID:17528 MGI:103177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin protein zero transcript_id : NM_008623.3

name	Pcp4l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245310 GeneID:66425 MGI:1913675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 133 ESTs, 1 Protein product : Purkinje cell protein 4-like 1 transcript_id : XM_484933.5

name	Nr1i3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385626 GeneID:12355 MGI:1346307
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group I, member 3 transcript_id : NM_009803.3

name	Tomm40l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802384 GeneID:641376 MGI:3589112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 40 homolog-like (yeast) transcript_id : NM_001037170.2

name	Apoa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304896 GeneID:11807 MGI:88050
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein A-II transcript_id : NM_013474.1

name	Fcer1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91932796 GeneID:14127 MGI:95496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgE, high affinity I, gamma polypeptide transcript_id : NM_010185.4

name	Ndufs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376353 GeneID:226646 MGI:2385112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) Fe-S protein 2 transcript_id : NM_153064.4

name	Adamts4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129941 GeneID:240913 MGI:1339949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4 transcript_id : NM_172845.2

name	B4galt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181157 GeneID:57370 MGI:1928767
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3 transcript_id : NM_020579.1

name	Ppox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431259 GeneID:19044 MGI:104968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protoporphyrinogen oxidase transcript_id : NM_008911.2

name	Usp21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347963 GeneID:30941 MGI:1353665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 21 transcript_id : NM_013919.3

name	Ufc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379212 GeneID:66155 MGI:1913405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-fold modifier conjugating enzyme 1 transcript_id : NM_025388.2

name	EG622236 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245396 GeneID:622236 MGI:3645348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 599 ESTs, 6 Proteins product : predicted gene, EG622236, transcript variant 1 transcript_id : XM_889804.3

name	Dedd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328201 GeneID:21945 MGI:1333874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death effector domain-containing transcript_id : NM_011615.2

name	Nit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754855 GeneID:27045 MGI:1350916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitrilase 1 transcript_id : NM_012049.1

name	Pfdn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271538 GeneID:18637 MGI:1276111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prefoldin 2 transcript_id : NM_011070.3

name	1190002J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357547 GeneID:68874 MGI:1916124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190002J23 gene transcript_id : NM_001033039.2

name	Pvrl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382903 GeneID:71740 MGI:1918990
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poliovirus receptor-related 4 transcript_id : NM_027893.2

name	Arhgap30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828719 GeneID:226652 MGI:2684948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 30 transcript_id : NM_001005508.1

name	Usf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130360 GeneID:22278 MGI:99542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream transcription factor 1 transcript_id : NM_009480.2

name	EG226654 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364519 GeneID:226654 MGI:3648482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins product : predicted gene, EG226654, transcript variant 1 transcript_id : XM_129558.5

name	F11r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87116673 GeneID:16456 MGI:1321398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F11 receptor transcript_id : NM_172647.2

name	Refbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350506 GeneID:56009 MGI:1913144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA and export factor binding protein 2 transcript_id : NM_019484.3

name	Itlna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130045 GeneID:16429 MGI:1333831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intelectin a transcript_id : NM_010584.2

name	Cd244 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114645 GeneID:18106 MGI:109294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD244 natural killer cell receptor 2B4 transcript_id : NM_018729.2

name	Ly9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955337 GeneID:17085 MGI:96885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 9 transcript_id : NM_008534.2

name	Slamf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348013 GeneID:75345 MGI:1922595
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 7 transcript_id : NM_144539.3

name	Cd48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227214 GeneID:12506 MGI:88339
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD48 antigen transcript_id : NM_007649.3

name	LOC100041098 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245406 GeneID:100041098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 236 ESTs, 4 Proteins product : similar to coiled-coil domain containing 72 transcript_id : XM_001476805.1

name	Slamf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227207 GeneID:27218 MGI:1351314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signaling lymphocytic activation molecule family member 1 transcript_id : NM_013730.4

name	Cd84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304954 GeneID:12523 MGI:1336885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD84 antigen transcript_id : NM_013489.1

name	Slamf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892889 GeneID:30925 MGI:1353620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 6 transcript_id : NM_030710.2

name	Vangl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131201 GeneID:93840 MGI:2135272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vang-like 2 (van gogh, Drosophila) transcript_id : NM_033509.3

name	LOC100040199 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245324 GeneID:100040199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001474255.1

name	Nhlh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754851 GeneID:18071 MGI:98481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nescient helix loop helix 1 transcript_id : NM_010916.1

name	Ncstn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981204 GeneID:59287 MGI:1891700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicastrin transcript_id : NM_021607.2

name	Copa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356847 GeneID:12847 MGI:1334462
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex subunit alpha transcript_id : NM_009938.3

name	Pex19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543532 GeneID:19298 MGI:1334458
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 19 transcript_id : NM_023041.2

name	LOC100041219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245415 GeneID:100041219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 179 ESTs, 6 Proteins product : similar to Translocase of inner mitochondrial membrane 23 homolog (yeast) transcript_id : XM_001476967.1

name	Wdr42a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956325 GeneID:98193 MGI:91860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 42A transcript_id : NM_153555.1

name	Pea15a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439980 GeneID:18611 MGI:104799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoprotein enriched in astrocytes 15A transcript_id : NM_011063.2

name	Casq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753289 GeneID:12372 MGI:1309468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calsequestrin 1 transcript_id : NM_009813.1

name	Atp1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861248 GeneID:98660 MGI:88106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, alpha 2 polypeptide transcript_id : NM_178405.3

name	Igsf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189433 GeneID:140559 MGI:2154090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 8 transcript_id : NM_080419.1

name	Kcnj9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607442 GeneID:16524 MGI:108007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 9 transcript_id : NM_008429.2

name	Kcnj10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87116685 GeneID:16513 MGI:1194504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 10 transcript_id : NM_001039484.1

name	Pigm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373575 GeneID:67556 MGI:1914806
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class M transcript_id : NM_026234.3

name	Slamf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361393 GeneID:98365 MGI:1923692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 9 transcript_id : NM_029612.3

name	LOC100040274 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245328 GeneID:100040274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040274 transcript_id : XM_001474401.1

name	Igsf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475735 GeneID:93842 MGI:2135283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 9 transcript_id : NM_033608.2

name	Tagln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110349995 GeneID:21346 MGI:1312985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transgelin 2 transcript_id : NM_178598.2

name	Ccdc19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364522 GeneID:71870 MGI:1919120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins product : coiled-coil domain containing 19, transcript variant 1 transcript_id : XM_355284.5

name	EG240916 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360594 GeneID:240916 MGI:3642995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240916 transcript_id : NM_177723.3

name	Slamf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367889 GeneID:74748 MGI:1921998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SLAM family member 8 transcript_id : NM_029084.3

name	Fcrl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245417 GeneID:677296 MGI:3618339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : Fc receptor-like 6 transcript_id : XM_001477207.1

name	Dusp23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485684 GeneID:68440 MGI:1915690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 23 transcript_id : NM_026725.2

name	Crp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87162477 GeneID:12944 MGI:88512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-reactive protein, pentraxin-related transcript_id : NM_007768.3

name	Atf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486811 GeneID:226641 MGI:1926157
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : activating transcription factor 6 protein_id : NP_001074773.1

name	Dusp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778930 CCDS:CCDS15474.1 GeneID:80915 MGI:1890614
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 12 protein_id : NP_075662.2

name	Fcrlb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288909 CCDS:CCDS15475.1 GeneID:435653 MGI:3576487
definition	codon_start : 1 note : Fc receptor-like mucin-like 2; Fc receptor related Y product : Fc receptor-like B protein_id : NP_001025155.2

name	Fcrla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553085 GeneID:98752 MGI:2138647
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA] codon_start : 1 note : Fc receptor related protein X; Fc receptor-like mucin-like 1; Fc receptor related X product : Fc receptor homolog expressed in B cells protein_id : NP_660123.1

name	LOC100040778 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245375 GeneID:100040778
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475949.1

name	Fcgr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857783 GeneID:14130 MGI:95499
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence TAS] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0045576 - mast cell activation [Evidence IDA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0050777 - negative regulation of immune response [Evidence IMP]; GO:0001811 - negative regulation of type I hypersensitivity [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Fc-gamma-RII; Fc gamma RIIB; FcgammaRIIB product : Fc receptor, IgG, low affinity IIb isoform 2 protein_id : NP_034317.1

name	Fcgr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063579 GeneID:14130 MGI:95499
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence TAS] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0045576 - mast cell activation [Evidence IDA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0050777 - negative regulation of immune response [Evidence IMP]; GO:0001811 - negative regulation of type I hypersensitivity [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Fc-gamma-RII; Fc gamma RIIB; FcgammaRIIB product : Fc receptor, IgG, low affinity IIb isoform 1 protein_id : NP_001070657.1

name	Fcgr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362369 CCDS:CCDS15476.1 GeneID:246256 MGI:2179523
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Fc receptor-like 3; Fc fragment of IgG, low affinity IIIa, receptor product : Fc gammaRIV protein_id : NP_653142.1

name	Fcgr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753834 CCDS:CCDS15477.1 GeneID:14131 MGI:95500
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IMP]; GO:0019770 - IgG receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001788 - antibody-dependent cellular cytotoxicity [Evidence IMP]; GO:0042590 - antigen processing and presentation of exogenous peptide antigen via MHC class I [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0045576 - mast cell activation [Evidence IDA] [Evidence IMP]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IMP]; GO:0006910 - phagocytosis, recognition [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence IMP]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IMP]; GO:0001812 - positive regulation of type I hypersensitivity [Evidence IMP] [Evidence IDA]; GO:0001798 - positive regulation of type IIa hypersensitivity [Evidence IMP]; GO:0001805 - positive regulation of type III hypersensitivity [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0001820 - serotonin secretion [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Fcg receptor III; FcgammaRIII; Fc gamma receptor III product : Fc receptor, IgG, low affinity III protein_id : NP_034318.1

name	1700009P17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486893 GeneID:75472 MGI:1922722
definition	codon_start : 1 product : hypothetical protein LOC75472 protein_id : NP_001074744.1

name	Sdhc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384690 GeneID:66052 MGI:1913302
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000104 - succinate dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : succinate dehydrogenase complex, subunit C, integral membrane protein protein_id : NP_079597.1

name	Mpz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678928 CCDS:CCDS15479.1 GeneID:17528 MGI:103177
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045217 - intercellular junction maintenance [Evidence IMP] codon_start : 1 exception : mismatches in translation product : myelin protein zero protein_id : NP_032649.1

name	Pcp4l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245311 GeneID:66425 MGI:1913675
definition	codon_start : 1 product : Purkinje cell protein 4-like 1 protein_id : XP_484933.5

name	Nr1i3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921568 CCDS:CCDS15480.1 GeneID:12355 MGI:1346307
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : constitutively transactivates RAREs product : constitutive androstane receptor protein_id : NP_033933.2

name	Tomm40l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921605 CCDS:CCDS15481.1 GeneID:641376 MGI:3589112
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005741 - mitochondrial outer membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0008308 - voltage-gated ion-selective channel activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocase of outer mitochondrial membrane 40 homolog-like protein_id : NP_001032247.1

name	Apoa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304897 GeneID:11807 MGI:88050
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence ISS] GO_process : GO:0015759 - beta-glucoside transport [Evidence NAS]; GO:0006631 - fatty acid metabolism [Evidence NAS]; GO:0006006 - glucose metabolism [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA]; GO:0050995 - negative regulation of lipid catabolism [Evidence ISS]; GO:0050748 - negative regulation of lipoprotein metabolism [Evidence ISS]; GO:0042119 - neutrophil activation [Evidence ISS]; GO:0045416 - positive regulation of interleukin-8 biosynthesis [Evidence ISS]; GO:0030300 - regulation of cholesterol absorption [Evidence IMP]; GO:0001817 - regulation of cytokine production [Evidence ISS]; GO:0009749 - response to glucose stimulus [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : apolipoprotein A-II protein_id : NP_038502.1

name	Fcer1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753830 CCDS:CCDS15483.1 GeneID:14127 MGI:95496
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0045121 - lipid raft [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0019863 - IgE binding [Evidence IDA]; GO:0019864 - IgG binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0042590 - antigen processing and presentation of exogenous peptide antigen via MHC class I [Evidence IMP]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA] [Evidence IMP]; GO:0042742 - defense response to bacterium [Evidence IMP]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006911 - phagocytosis, engulfment [Evidence IMP]; GO:0050778 - positive regulation of immune response [Evidence IMP]; GO:0045082 - positive regulation of interleukin-10 biosynthesis [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence IMP]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IMP]; GO:0001798 - positive regulation of type IIa hypersensitivity [Evidence IMP]; GO:0001805 - positive regulation of type III hypersensitivity [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : Fc receptor, IgE, high affinity I, gamma polypeptide protein_id : NP_034315.1

name	Ndufs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346461 CCDS:CCDS15484.1 GeneID:226646 MGI:2385112
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016651 - oxidoreductase activity, acting on NADH or NADPH [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH-coenzyme Q reductase product : NADH dehydrogenase (ubiquinone) Fe-S protein 2 protein_id : NP_694704.1

name	Adamts4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370274 CCDS:CCDS15485.1 GeneID:240913 MGI:1339949
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 note : aggrecanase-1 product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4 protein_id : NP_766433.1

name	B4galt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181158 CCDS:CCDS15486.1 GeneID:57370 MGI:1928767
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003831 - beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003945 - N-acetyllactosamine synthase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : beta-1,4-galactosyltransferase III; beta4GalT-III product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3 protein_id : NP_065604.1

name	Ppox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679445 CCDS:CCDS15487.1 GeneID:19044 MGI:104968
definition	GO_component : GO:0031304 - intrinsic to mitochondrial inner membrane [Evidence IDA]; GO:0031966 - mitochondrial membrane [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004729 - protoporphyrinogen oxidase activity [Evidence IEA] [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence ISS] [Evidence IEA]; GO:0006783 - heme biosynthesis [Evidence IEA] [Evidence ISS]; GO:0006779 - porphyrin biosynthesis [Evidence IEA] codon_start : 1 note : protoporhyrinogen oxidase product : protoporphyrinogen oxidase protein_id : NP_032937.1

name	Usp21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305615 GeneID:30941 MGI:1353665
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin specific protease 23; ubiquitin specific protease 21 product : ubiquitin-specific protease 21 protein_id : NP_038947.1

name	Ufc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384768 CCDS:CCDS15488.1 GeneID:66155 MGI:1913405
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : Ufm1-conjugating enzyme 1 protein_id : NP_079664.1

name	EG622236 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883122 GeneID:622236 MGI:3645348
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_894897.1

name	Dedd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328202 CCDS:CCDS15490.1 GeneID:21945 MGI:1333874
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tumor necrosis factor (ligand) superfamily, member 19 product : death effector domain-containing protein_id : NP_035745.2

name	Nit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754856 GeneID:27045 MGI:1350916
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 note : snoRNA MBI-11 product : nitrilase 1 protein_id : NP_036179.1

name	Pfdn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981577 CCDS:CCDS15491.1 GeneID:18637 MGI:1276111
definition	GO_component : GO:0005829 - cytosol [Evidence TAS] GO_function : GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IDA] codon_start : 1 product : prefoldin 2 protein_id : NP_035200.2

name	1190002J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986583 GeneID:68874 MGI:1916124
definition	codon_start : 1 product : hypothetical protein LOC68874 protein_id : NP_001028211.1

name	Pvrl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037253 CCDS:CCDS15493.1 GeneID:71740 MGI:1918990
definition	GO_component : GO:0005912 - adherens junction [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation note : nectin 4 product : poliovirus receptor-related 4 protein_id : NP_082169.1

name	Arhgap30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828720 CCDS:CCDS15494.1 GeneID:226652 MGI:2684948
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 30 protein_id : NP_001005508.1

name	Usf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678521 CCDS:CCDS15495.1 GeneID:22278 MGI:99542
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : upstream stimulatory factor product : upstream stimulatory factor 1 protein_id : NP_033506.1

name	EG226654 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63479994 GeneID:226654 MGI:3648482
definition	codon_start : 1 product : similar to KAT protein isoform 1 protein_id : XP_129558.3

name	F11r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734847 CCDS:CCDS15496.1 GeneID:16456 MGI:1321398
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IMP] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IDA]; GO:0030855 - epithelial cell differentiation [Evidence IDA] codon_start : 1 note : junction cell adhesion molecule A; BV11 antigen; junction cell adhesion molecule1; F11 receptor/F11R product : F11 receptor protein_id : NP_766235.1

name	Refbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524924 CCDS:CCDS15497.1 GeneID:56009 MGI:1913144
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IDA]; GO:0003697 - single-stranded DNA binding [Evidence IDA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA and export factor binding protein 2-I product : RNA and export factor binding protein 2 protein_id : NP_062357.2

name	Itlna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754388 GeneID:16429 MGI:1333831
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA] GO_process : GO:0009624 - response to nematode [Evidence IDA] codon_start : 1 note : lactoferrin receptor; intelectin 2; intelectin 1; calcium-dependent galactosyl-specific lectin product : intelectin a protein_id : NP_034714.1

name	Cd244 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114646 GeneID:18106 MGI:109294
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : NK cell receptor 2B4; non MHC restricted killing associated product : CD244 natural killer cell receptor 2B4 protein_id : NP_061199.2

name	Ly9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955338 GeneID:17085 MGI:96885
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 9 protein_id : NP_032560.2

name	Slamf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541977 CCDS:CCDS15500.1 GeneID:75345 MGI:1922595
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel Ly9 product : SLAM family member 7 protein_id : NP_653122.2

name	Cd48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094083 CCDS:CCDS15501.1 GeneID:12506 MGI:88339
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : CD48 antigen protein_id : NP_031675.1

name	LOC100041098 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245407 GeneID:100041098
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476855.1

name	Slamf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336066 CCDS:CCDS15502.1 GeneID:27218 MGI:1351314
definition	GO_component : GO:0009986 - cell surface [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0046649 - lymphocyte activation [Evidence IEA] codon_start : 1 note : signaling lymphocyte activation molecule product : signaling lymphocytic activation molecule family member 1 protein_id : NP_038758.2

name	Cd84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304955 CCDS:CCDS15503.1 GeneID:12523 MGI:1336885
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 product : CD84 antigen protein_id : NP_038517.1

name	Slamf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507654 CCDS:CCDS15504.1 GeneID:30925 MGI:1353620
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : lymphocyte antigen 108 product : SLAM family member 6 protein_id : NP_109635.1

name	Vangl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15723382 CCDS:CCDS15505.1 GeneID:93840 MGI:2135272
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045176 - apical protein localization [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001736 - establishment of planar polarity [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0001843 - neural tube closure [Evidence IGI] [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IGI] codon_start : 1 note : vang (van gogh)-like 2 product : loop tail associated protein protein_id : NP_277044.1

name	LOC100040199 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245325 GeneID:100040199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474305.1

name	Nhlh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754852 CCDS:CCDS15506.1 GeneID:18071 MGI:98481
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nescient helix loop helix 1 protein_id : NP_035046.1

name	Ncstn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981205 CCDS:CCDS15507.1 GeneID:59287 MGI:1891700
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence ISS]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0007220 - Notch receptor processing [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS]; GO:0016485 - protein processing [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nicastrin protein_id : NP_067620.2

name	Copa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981828 GeneID:12847 MGI:1334462
definition	GO_component : GO:0030126 - COPI vesicle coat [Evidence IEA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005792 - microsome [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS]; GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0030157 - pancreatic juice secretion [Evidence ISS]; GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 exception : mismatches in translation product : coatomer protein complex subunit alpha protein_id : NP_034068.2

name	Pex19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543533 CCDS:CCDS15508.1 GeneID:19298 MGI:1334458
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : peroxisomal farnesylated protein product : peroxisome biogenesis factor 19 protein_id : NP_075528.2

name	LOC100041219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245416 GeneID:100041219
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477017.1

name	Wdr42a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956326 CCDS:CCDS15509.1 GeneID:98193 MGI:91860
definition	codon_start : 1 product : H326 protein_id : NP_705783.1

name	Pea15a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426847 CCDS:CCDS15510.1 GeneID:18611 MGI:104799
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS]; GO:0005875 - microtubule associated complex [Evidence NAS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence TAS]; GO:0005351 - sugar porter activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence TAS]; GO:0046325 - negative regulation of glucose import [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; mammary transforming gene 1; phosphoprotein enriched in astrocytes 15 product : phosphoprotein enriched in astrocytes 15 isoform 2 protein_id : NP_035193.1

name	Casq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753290 GeneID:12372 MGI:1309468
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0016529 - sarcoplasmic reticulum [Evidence TAS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence TAS] codon_start : 1 function : calcium binding protein product : calsequestrin 1 protein_id : NP_033943.1

name	Atp1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409956 GeneID:98660 MGI:88106
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IGI]; GO:0002026 - cardiac inotropy [Evidence IMP]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0040011 - locomotion [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0045822 - negative regulation of heart contraction [Evidence IMP]; GO:0002087 - neurological control of breathing [Evidence IMP]; GO:0001504 - neurotransmitter uptake [Evidence IMP]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0051481 - reduction of cytosolic calcium ion concentration [Evidence IMP]; GO:0006937 - regulation of muscle contraction [Evidence IMP]; GO:0006940 - regulation of smooth muscle contraction [Evidence IMP]; GO:0006942 - regulation of striated muscle contraction [Evidence IMP]; GO:0019229 - regulation of vasoconstriction [Evidence IMP] [Evidence IGI]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATPase, Na+/K+ transporting, alpha 2 polypeptide protein_id : NP_848492.1

name	Igsf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189434 CCDS:CCDS15511.1 GeneID:140559 MGI:2154090
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006928 - cell motility [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0007338 - fertilization (sensu Metazoa) [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0007519 - striated muscle development [Evidence ISS] codon_start : 1 note : PG regulatory-like protein product : immunoglobulin superfamily, member 8 protein_id : NP_536344.1

name	Kcnj9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607443 GeneID:16524 MGI:108007
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel subfamily J9 protein_id : NP_032455.2

name	Kcnj10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87116686 CCDS:CCDS15512.1 GeneID:16513 MGI:1194504
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel J10 protein_id : NP_001034573.1

name	Pigm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19920329 CCDS:CCDS15513.1 GeneID:67556 MGI:1914806
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000030 - mannosyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : phosphatidylinositol glycan, class M protein_id : NP_080510.1

name	Slamf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982610 CCDS:CCDS15514.1 GeneID:98365 MGI:1923692
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CD2 antigen family, member 10 product : SLAM family member 9 protein_id : NP_083888.2

name	LOC100040274 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245329 GeneID:100040274
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474451.1

name	Igsf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18426807 CCDS:CCDS15515.1 GeneID:93842 MGI:2135283
definition	GO_component : GO:0030425 - dendrite [Evidence IMP] GO_process : GO:0016358 - dendrite development [Evidence IMP] codon_start : 1 exception : mismatches in translation note : NCAM-like protein NRT1; neural cell adhesion molecule (Ncam)-like product : immunoglobulin superfamily, member 9 protein_id : NP_291086.1

name	Tagln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519911 GeneID:21346 MGI:1312985
definition	codon_start : 1 note : putative; transgelin 2 (MGD\|MGI:1312985 GB\|BC049861, evidence: BLASTN, 99%, match=1379) product : transgelin 2 protein_id : NP_848713.1

name	Ccdc19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63480006 GeneID:71870 MGI:1919120
definition	codon_start : 1 product : nasopharyngeal epithelium specific protein 1 isoform 1 protein_id : XP_355284.3

name	EG240916 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244188 CCDS:CCDS15516.1 GeneID:240916 MGI:3642995
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC240916 protein_id : NP_808391.1

name	Slamf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625804 CCDS:CCDS15517.1 GeneID:74748 MGI:1921998
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : B lymphocyte activator macrophage expressed protein_id : NP_083360.2

name	Fcrl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245418 GeneID:677296 MGI:3618339
definition	codon_start : 1 product : similar to FCRL6 protein_id : XP_001477257.1

name	Dusp23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55926215 CCDS:CCDS15518.1 GeneID:68440 MGI:1915690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : low-molecular-mass dual-specificity phosphatase product : dual specificity phosphatase 23 protein_id : NP_081001.1

name	Crp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87162478 GeneID:12944 MGI:88512
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C-reactive protein, petaxin related protein_id : NP_031794.2

name	LOC665819 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665819
definition	number : 1 pseudo : _no_value

name	LOC665819 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665819
definition	number : 2 pseudo : _no_value

name	LOC665819 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665819
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:158884
definition	standard_name : AI326426

name	(CDS detail)
type	STS
link
xref	UniSTS:128619
definition	standard_name : D1Mit270

name	(CDS detail)
type	STS
link
xref	UniSTS:178508
definition	standard_name : AW061147

name	(CDS detail)
type	STS
link
xref	UniSTS:178514
definition	standard_name : AW049275

name	(CDS detail)
type	STS
link
xref	UniSTS:143022
definition	standard_name : AA027408

name	(CDS detail)
type	STS
link
xref	UniSTS:185457
definition	standard_name : BB219290

name	(CDS detail)
type	STS
link
xref	UniSTS:123612
definition	standard_name : 23.MMHAP61FLH2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125784
definition	standard_name : X04648

name	(CDS detail)
type	STS
link
xref	UniSTS:165121
definition	standard_name : AI528646

name	(CDS detail)
type	STS
link
xref	UniSTS:128484
definition	standard_name : D1Mit147

name	(CDS detail)
type	STS
link
xref	UniSTS:128485
definition	standard_name : D1Mit148

name	(CDS detail)
type	STS
link
xref	UniSTS:128483
definition	standard_name : D1Mit146

name	(CDS detail)
type	STS
link
xref	UniSTS:178510
definition	standard_name : M14215

name	(CDS detail)
type	STS
link
xref	UniSTS:123914
definition	standard_name : 30.MMHAP69FRB12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178509
definition	standard_name : AV282292

name	(CDS detail)
type	STS
link
xref	UniSTS:207247
definition	standard_name : AW742715

name	(CDS detail)
type	STS
link
xref	UniSTS:210535
definition	standard_name : RH136553

name	(CDS detail)
type	STS
link
xref	UniSTS:158883
definition	standard_name : AI316496

name	(CDS detail)
type	STS
link
xref	UniSTS:123661
definition	standard_name : 24.MMHAP87FRH9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234265
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143018
definition	standard_name : AA209988

name	(CDS detail)
type	STS
link
xref	UniSTS:164138
definition	standard_name : AI551208

name	(CDS detail)
type	STS
link
xref	UniSTS:272971
definition	standard_name : PMC316377P4

name	(CDS detail)
type	STS
link
xref	UniSTS:141108
definition	standard_name : Apoa2

name	(CDS detail)
type	STS
link
xref	UniSTS:143082
definition	standard_name : Fcer1g

name	(CDS detail)
type	STS
link
xref	UniSTS:165122
definition	standard_name : AI573376

name	(CDS detail)
type	STS
link
xref	UniSTS:224644
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161025
definition	standard_name : RH124203

name	(CDS detail)
type	STS
link
xref	UniSTS:499184
definition	standard_name : Ndufs2

name	(CDS detail)
type	STS
link
xref	UniSTS:495974
definition	standard_name : Adamts4

name	(CDS detail)
type	STS
link
xref	UniSTS:234266
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161960
definition	standard_name : RH125138

name	(CDS detail)
type	STS
link
xref	UniSTS:32953
definition	standard_name : RH64578

name	(CDS detail)
type	STS
link
xref	UniSTS:178515
definition	standard_name : AW125175

name	(CDS detail)
type	STS
link
xref	UniSTS:211850
definition	standard_name : RH128542

name	(CDS detail)
type	STS
link
xref	UniSTS:144255
definition	standard_name : Ppox

name	(CDS detail)
type	STS
link
xref	UniSTS:94919
definition	standard_name : G43283

name	(CDS detail)
type	STS
link
xref	UniSTS:143014
definition	standard_name : W53272

name	(CDS detail)
type	STS
link
xref	UniSTS:72126
definition	standard_name : STS-Z40895

name	(CDS detail)
type	STS
link
xref	UniSTS:143015
definition	standard_name : AA062310

name	(CDS detail)
type	STS
link
xref	UniSTS:163270
definition	standard_name : AF069985

name	(CDS detail)
type	STS
link
xref	UniSTS:249726
definition	standard_name : AA818913

name	(CDS detail)
type	STS
link
xref	UniSTS:178511
definition	standard_name : AI255805

name	(CDS detail)
type	STS
link
xref	UniSTS:272016
definition	standard_name : PMC21147P2

name	(CDS detail)
type	STS
link
xref	UniSTS:269327
definition	standard_name : MARC_4129-4130:996679399:1

name	(CDS detail)
type	STS
link
xref	UniSTS:144737
definition	standard_name : Usf1

name	(CDS detail)
type	STS
link
xref	UniSTS:164139
definition	standard_name : AV065366

name	(CDS detail)
type	STS
link
xref	UniSTS:143019
definition	standard_name : AA638916

name	(CDS detail)
type	STS
link
xref	UniSTS:479247
definition	standard_name : Refbp2

name	(CDS detail)
type	STS
link
xref	UniSTS:479293
definition	standard_name : Thoc4

name	(CDS detail)
type	STS
link
xref	UniSTS:158882
definition	standard_name : M84412

name	(CDS detail)
type	STS
link
xref	UniSTS:143805
definition	standard_name : Ly9

name	(CDS detail)
type	STS
link
xref	UniSTS:178507
definition	standard_name : AI893573

name	(CDS detail)
type	STS
link
xref	UniSTS:105078
definition	standard_name : G42060

name	(CDS detail)
type	STS
link
xref	UniSTS:123946
definition	standard_name : 31.MMHAP57FLC4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123236
definition	standard_name : 14.MMHAP90FLE2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178512
definition	standard_name : AW610730

name	(CDS detail)
type	STS
link
xref	UniSTS:165120
definition	standard_name : AI449234

name	(CDS detail)
type	STS
link
xref	UniSTS:141286
definition	standard_name : Cd48

name	(CDS detail)
type	STS
link
xref	UniSTS:141287
definition	standard_name : Cd48

name	(CDS detail)
type	STS
link
xref	UniSTS:142282
definition	standard_name : D1Wsu1e

name	(CDS detail)
type	STS
link
xref	UniSTS:105054
definition	standard_name : G42029

name	(CDS detail)
type	STS
link
xref	UniSTS:128447
definition	standard_name : D1Mit113

name	(CDS detail)
type	STS
link
xref	UniSTS:105073
definition	standard_name : G42048

name	(CDS detail)
type	STS
link
xref	UniSTS:226176
definition	standard_name : Ly108

name	(CDS detail)
type	STS
link
xref	UniSTS:105072
definition	standard_name : G42047

name	(CDS detail)
type	STS
link
xref	UniSTS:105067
definition	standard_name : G42042

name	(CDS detail)
type	STS
link
xref	UniSTS:105050
definition	standard_name : G42025

name	(CDS detail)
type	STS
link
xref	UniSTS:225842
definition	standard_name : G64929

name	(CDS detail)
type	STS
link
xref	UniSTS:105070
definition	standard_name : G42045

name	(CDS detail)
type	STS
link
xref	UniSTS:144017
definition	standard_name : Nhlh1

name	(CDS detail)
type	STS
link
xref	UniSTS:22843
definition	standard_name : RH11634

name	(CDS detail)
type	STS
link
xref	UniSTS:222335
definition	standard_name : RH140256

name	(CDS detail)
type	STS
link
xref	UniSTS:105071
definition	standard_name : G42046

name	(CDS detail)
type	STS
link
xref	UniSTS:151313
definition	standard_name : D1S2004E

name	(CDS detail)
type	STS
link
xref	UniSTS:141376
definition	standard_name : Copa

name	(CDS detail)
type	STS
link
xref	UniSTS:105057
definition	standard_name : G42032

name	(CDS detail)
type	STS
link
xref	UniSTS:209425
definition	standard_name : RH126904

name	(CDS detail)
type	STS
link
xref	UniSTS:158888
definition	standard_name : AU040324

name	(CDS detail)
type	STS
link
xref	UniSTS:144308
definition	standard_name : Pxf

name	(CDS detail)
type	STS
link
xref	UniSTS:234269
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:105069
definition	standard_name : G42044

name	(CDS detail)
type	STS
link
xref	UniSTS:142280
definition	standard_name : D1Ucla4

name	(CDS detail)
type	STS
link
xref	UniSTS:105051
definition	standard_name : G42026

name	(CDS detail)
type	STS
link
xref	UniSTS:161760
definition	standard_name : RH124938

name	(CDS detail)
type	STS
link
xref	UniSTS:105068
definition	standard_name : G42043

name	(CDS detail)
type	STS
link
xref	UniSTS:158889
definition	standard_name : C76055

name	(CDS detail)
type	STS
link
xref	UniSTS:161606
definition	standard_name : RH124784

name	(CDS detail)
type	STS
link
xref	UniSTS:210508
definition	standard_name : RH136526

name	(CDS detail)
type	STS
link
xref	UniSTS:178517
definition	standard_name : AI323543

name	(CDS detail)
type	STS
link
xref	UniSTS:144159
definition	standard_name : Pea15

name	(CDS detail)
type	STS
link
xref	UniSTS:108990
definition	standard_name : G49234

name	(CDS detail)
type	STS
link
xref	UniSTS:217047
definition	standard_name : RH133764

name	(CDS detail)
type	STS
link
xref	UniSTS:105060
definition	standard_name : G42035

name	(CDS detail)
type	STS
link
xref	UniSTS:225846
definition	standard_name : G64925

name	(CDS detail)
type	STS
link
xref	UniSTS:142273
definition	standard_name : D1Sta3

name	(CDS detail)
type	STS
link
xref	UniSTS:105063
definition	standard_name : G42038

name	(CDS detail)
type	STS
link
xref	UniSTS:178518
definition	standard_name : AW060654

name	(CDS detail)
type	STS
link
xref	UniSTS:105064
definition	standard_name : G42039

name	(CDS detail)
type	STS
link
xref	UniSTS:141127
definition	standard_name : Atp1a2

name	(CDS detail)
type	STS
link
xref	UniSTS:225843
definition	standard_name : G64926

name	(CDS detail)
type	STS
link
xref	UniSTS:105049
definition	standard_name : G42024

name	(CDS detail)
type	STS
link
xref	UniSTS:143020
definition	standard_name : AA033172

name	(CDS detail)
type	STS
link
xref	UniSTS:162045
definition	standard_name : RH125223

name	(CDS detail)
type	STS
link
xref	UniSTS:498314
definition	standard_name : Kcnj9

name	(CDS detail)
type	STS
link
xref	UniSTS:143669
definition	standard_name : Kcnj9

name	(CDS detail)
type	STS
link
xref	UniSTS:143668
definition	standard_name : Kcnj9

name	(CDS detail)
type	STS
link
xref	UniSTS:158890
definition	standard_name : U11860

name	(CDS detail)
type	STS
link
xref	UniSTS:105077
definition	standard_name : G42052

name	(CDS detail)
type	STS
link
xref	UniSTS:105079
definition	standard_name : G42061

name	(CDS detail)
type	STS
link
xref	UniSTS:105062
definition	standard_name : G42037

name	(CDS detail)
type	STS
link
xref	UniSTS:105065
definition	standard_name : G42040

name	(CDS detail)
type	STS
link
xref	UniSTS:225849
definition	standard_name : G64928

name	(CDS detail)
type	STS
link
xref	UniSTS:165123
definition	standard_name : AI465509

name	(CDS detail)
type	STS
link
xref	UniSTS:185458
definition	standard_name : AI644422

name	(CDS detail)
type	STS
link
xref	UniSTS:234270
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178516
definition	standard_name : AV302080

name	(CDS detail)
type	STS
link
xref	UniSTS:105080
definition	standard_name : G42063

name	(CDS detail)
type	STS
link
xref	UniSTS:225844
definition	standard_name : G64924

name	(CDS detail)
type	STS
link
xref	UniSTS:105075
definition	standard_name : G42050

name	(CDS detail)
type	STS
link
xref	UniSTS:165124
definition	standard_name : AI462096

name	(CDS detail)
type	STS
link
xref	UniSTS:144540
definition	standard_name : Tagln2

name	(CDS detail)
type	STS
link
xref	UniSTS:128826
definition	standard_name : D1Mit456

name	(CDS detail)
type	STS
link
xref	UniSTS:123987
definition	standard_name : 32.MMHAP50FRC11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128487
definition	standard_name : D1Mit149.1

name	(CDS detail)
type	STS
link
xref	UniSTS:141404
definition	standard_name : Crp

name	(CDS detail)
type	STS
link
xref	UniSTS:128486
definition	standard_name : D1Mit149

name	(CDS detail)
type	STS
link
xref	UniSTS:141402
definition	standard_name : Crp

name	(CDS detail)
type	STS
link
xref	UniSTS:178519
definition	standard_name : AI255847

name	(CDS detail)
type	STS
link
xref	UniSTS:141403
definition	standard_name : Crp

name	LOC100040320 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245340 GeneID:100040320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 168 ESTs, 2 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_031779.1

clone name	MSMg01-317D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-316B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-151L04.b	B6Ng01-151L04.g
ACC	DH947454	DH947455
length	1,205	887
definition	DH947454\|Mus musculus domesticus DNA, BAC clone: B6Ng01-151L04, 5' end.	DH947455\|Mus musculus domesticus DNA, BAC clone: B6Ng01-151L04, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctgtttttacgttgttatactttcagtccttgagaattattaaaa aatctcagtaacatgggtaacattaaattgttgacaaaacatctcaaatg cttgactataatagccagttccagcagctgttttaatctgacttgtaaca ccaagcataaaaaaaaaattaacataggcaatgactaattacatttttag ttgcttctcttgttagagcagttacaactagaaagcctgaaaaggtatca atagtcacatatgcgtattttatttttctaaaatcagaaatatgagtatc catttgcaataactgattaagtataagtccttgagaattaacactattat gtggaacaggtagaaactgaggacattgagacaagtctttacaatttgac atgcacagtctctaaaaataccaaattatcatctcaagccattactattt tgatgatgtaaagaatgagattatgtggccaattgttcttgtgtataaat ctggggtggcatcgccttaaggggtcttgtccaggcaatctaggatgagt tcttaaatgtctaaagacagtcctttaaaggaacagtactttctcttaac taaagttgtatatgcataaacagttgcaaatttgagaattagcagtatct aaaaagggaacaatttcaagcaattgtaagcctatgtatatatgttaatt agcctctcccttcccaaggggcatggccttcccaaagtttcttttcacag tcaatggaataccaacaattttaaccataatttttaagtttcctttgcaa tattagaatatatccataacttttggaaagtaaaacccaattttaaccaa tctattctctttaaaatcaataacaaaatcatcattttcacgttacaagt ttggctgccaattcgtatatatgaatgcatggtagtgcaacttttaatgc ttcattaaagagacattgttttaaatcttatctcttataagtctagtttc taggatagaattacacaaatattatcgaaatttagagtatttttagagcc tggtttcctgggctgggtcatgccacgtgctgttaaaataacttcaccct gagttaccagttagctaacttcttggtacaatgttacaccttttaacatg gccataactatatatcccattcttcatggaccaggactgtcgcagagcga catat	gaattccaggtgccacctggataacatgggaagattcttcctctgtaggg agaggaacttggggactggaacgaggagaggaaagaggagagggaaagga aacagagcgttccagaatagtatgctagcagggttgtctggaatgtacac atagaatgcttaaagtggagcaatggctttctgcatgctggagcggctga gaacccatgaggctgtcccagcctcttattgatgtcctggattgtcctag ttgtctgtctgtattggaagactgaagaagctggagtcaggtgttagtgg aggacagtgaaagcaactaggagaatagacacaagcaggaagccgtgcta ggccaatcagcatgcaccaggatattttattgaatcacccactaaacggt cccatccactccaggcaagtgtctttttgtgagtgttacagctctgaggg gaaaggtttccccaatgcaagtcttatagctctgaagggaaagttgtcct ggaaggtgggagtcaaggaacaccaccaagtcacattgcacaacaaacct catgcaagaaacttactgggaaagacaatggctgcctctgctcctttgag aagcaggagggaactgagctggaggcaggcttttatacagggtttctttg gcagcagttttccaggataaggatttccaggattggtggggtttcaagtc ctgagcttggggtgagcccaggaattggtgggatttcaagatcaggattg gtggatttgaactcggatttggtggttttcaacctggacataagctcaga cgtttttttttttttaccctacactttttcttcagtttaattcttgaaaa cgccccatatatggccccaagggttggttgattctgg
quality values	Open. Hide. 7 8 7 9 61 53 43 33 61 61 61 61 47 50 43 43 47 50 61 50 61 50 47 61 61 11 12 12 16 8 10 19 19 28 28 30 44 59 59 61 61 59 61 61 59 61 61 61 59 55 55 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 59 45 52 52 35 36 49 36 59 59 61 59 61 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 59 59 59 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 49 59 59 59 55 55 61 61 61 61 61 59 55 43 59 52 61 43 59 59 59 52 36 61 59 59 61 59 61 59 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 52 55 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 55 55 55 55 52 55 61 61 61 61 61 61 55 61 61 55 55 55 43 43 37 43 52 50 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 55 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 53 61 61 61 53 53 47 33 42 47 50 47 61 61 61 61 61 61 61 61 61 61 61 45 47 39 43 42 61 61 61 61 61 61 53 57 53 53 51 43 53 47 47 47 53 53 57 53 53 53 53 57 53 40 42 57 52 57 45 50 53 45 50 42 38 43 47 43 45 57 45 53 47 53 53 53 50 47 52 45 40 50 47 46 52 57 45 53 52 53 57 53 47 47 53 50 57 51 36 41 57 53 50 52 53 45 52 52 47 39 53 47 52 53 47 32 53 38 47 57 47 43 53 53 57 57 57 38 52 45 57 53 42 53 53 45 52 53 43 53 52 50 53 52 41 52 57 57 50 52 57 53 50 53 47 27 31 27 57 52 45 50 52 53 53 39 53 31 52 57 38 57 52 38 47 35 34 52 37 57 50 38 42 42 42 42 36 52 28 39 53 32 26 33 34 33 41 37 38 37 39 24 39 39 39 38 21 38 39 33 38 38 57 46 52 33 34 40 52 53 17 53 37 16 14 37 20 12 42 52 29 31 57 47 38 25 57 57 40 34 22 45 20 37 27 35 23 23 23 57 44 40 14 21 35 31 27 21 40 45 22 37 25 57 57 36 30 33 35 29 23 33 34 48 32 51 51 51 30 32 39 32 48 46 29 29 31 21 46 11 19 31 29 31 27 29 15 32 44 28 43 44 27 30 33 31 30 24 41 17 31 28 33 27 34 51 51 35 23 12 31 51 27 26 18 39 35 29 29 28 30 29 14 31 28 51 51 33 18 19 24 32 13 26 29 29 27 32 29 27 29 24 27 27 51 29 32 46 46 15 24 21 14 27 24 35 29 22 24 41 51 30 23 29 28 28 23 29 24 43 46 7 10 15 29 20 29 29 27 24 37 29 23 26 46 15 25 22 25 29 28 22 29 19 33 21 32 28 15 7 14 11 8 7 4 6 11 28 39 29 29 24 23 23 46 33 7 27 27 13 14 18 23 23 28 31 51 51 38 20 28 17 38 23 29 23 26 16 22 35 15 51 36 17 18 10 19 12 10 25 12 25 20 51 51 29 14 51 33 28 24 19 31 17 28 22 30 31 33 26 24 17 5 32 28 24 21 26 22 31 28 51 17 8 5 14 23 16 22 13 32 8 28 22 17 25 11 15 9 21 30 32 26 17 16 19 19 16 18 19 19 25 39 21 19 44 21 12 10 17 5 11 8 12 39 44 42 29 27 15 12 30 7 15 13 23 23 7 44 21 12 23 29 27 28 25 8 8 7 24 20 11 7 15 13 16 17 7 4 8 4 3 5 29 29 6 13 9 13 42 42 19 6 8 12 22 13 8 18 13 6 42 22 17 13 6 5 8 13 14 16 21 22 6 26 6 4 6 21 15 23 18 12 24 11 8 10 19 14 12 25 9 23 8 10 4 10 6 14 19 13 11 16 23 11 36 22 17 10 3 5 6 7 12 5 10 17 4 5 17 9 17 18 4 10 18 3 5 4 11 14 14 9 2 1 7 6 6 4 5 12 16 9 18 9 20 8 3 6 3 2 3 5 6 4 3 3 1 4 10 6 4 5 7 4 5 6 6 13	Open. Hide. 61 61 47 39 61 12 21 8 8 10 14 20 17 11 11 36 43 52 55 55 47 61 61 61 61 61 61 61 59 61 61 61 61 59 49 61 61 61 61 61 61 61 61 61 61 59 52 28 52 41 28 28 30 28 36 59 59 59 61 61 61 61 61 61 59 59 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 59 52 61 61 61 61 61 61 59 61 61 61 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 59 52 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 59 45 59 59 59 61 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 61 61 61 61 59 52 43 52 52 52 52 61 61 61 59 61 61 61 59 52 59 59 52 59 45 52 45 59 52 52 61 61 59 59 59 59 52 59 61 59 61 52 43 59 52 59 52 52 59 59 52 43 59 59 59 61 59 59 59 59 59 49 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 59 52 59 52 55 52 52 55 52 55 55 61 61 55 52 55 55 55 52 55 55 55 52 55 55 55 47 49 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 55 55 52 52 61 55 52 55 55 55 49 55 52 52 61 61 55 55 47 55 50 50 50 50 50 43 49 49 55 55 50 49 50 61 61 50 61 61 61 61 55 50 61 61 55 61 61 61 61 55 61 55 61 61 61 43 61 61 49 16 14 14 9 19 12 61 47 38 47 49 61 55 50 61 53 52 53 50 50 52 52 50 50 50 43 39 47 45 50 47 32 18 12 17 14 16 23 50 47 50 50 36 39 50 40 45 53 52 32 43 34 32 32 27 33 39 50 33 31 36 50 61 47 46 52 34 31 28 31 39 45 47 47 61 61 61 34 53 33 23 61 53 53 50 42 50 52 43 45 50 45 45 50 43 38 22 42 45 50 53 52 47 22 42 31 26 43 45 24 57 52 30 57 30 43 32 33 35 33 53 38 47 53 53 53 37 13 53 37 32 20 57 29 37 57 57 39 34 37 45 45 39 33 57 47 47 46 50 40 22 53 8 41 23 35 38 42 53 45 43 42 30 28 20 20 30 12 30 32 47 32 50 35 8 41 27 17 30 20 19 23 14 23 26 33 36 32 33 38 28 53 57 46 53 33 33 42 42 24 37 40 37 34 40 40 38 33 31 37 33 26 37 53 53 37 21 20 31 19 17 41 44 24 12 20 29 27 21 29 37 46 41 53 53 44 32 28 40 37 29 25 30 37 44 32 22 11 8 14 17 17 11 13 24 12 14 24 6 9 46 39 13 17 38 33 34 28 30 30 8 12 46 23 34 16 16 51 45 23 36 30 22 10 14 30 30 27 29 31 48 29 28 25 31 18 12 5 18 29 29 24 21 27 17 25 15 6 27 25 39 36 43 46 43 46 46 46 29 25 28 46 29 24 11 29 29 17 11 30 22 9 7 10 6 7 11 12 26 41 32 21 27 14 28 19 25 8 8 27 29 30 17 18 11 11 22 26 27 21 14 5 19 6 10 23 24 16 8 32 36 29 23 14 32 43 15 17 6 13 29 19 18 26 29 27 15 19 23 12 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_173676411_173677305
seq2: B6Ng01-151L04.g_68_954

seq1  GAATTCCAGGTGCCACCTGGATAACATGGGAAGATTCTTCCTCTGTAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGTGCCACCTGGATAACATGGGAAGATTCTTCCTCTGTAGGG  50

seq1  AGAGGAACTTGGGGACTGGAACGAGGAGAGGAAAGAGGAGAGGGAAAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGAACTTGGGGACTGGAACGAGGAGAGGAAAGAGGAGAGGGAAAGGA  100

seq1  AACAGAGCGTTCCAGAATAGTATGCTAGCAGGGTTGTCTGGAATGTACAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGAGCGTTCCAGAATAGTATGCTAGCAGGGTTGTCTGGAATGTACAC  150

seq1  ATAGAATGCTTAAAGTGGAGCAATGGCTTTCTGCATGCTGGAGCGGCTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAATGCTTAAAGTGGAGCAATGGCTTTCTGCATGCTGGAGCGGCTGA  200

seq1  GAACCCATGAGGCTGTCCCAGCCTCTTATTGATGTCCTGGATTGTCCTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCCATGAGGCTGTCCCAGCCTCTTATTGATGTCCTGGATTGTCCTAG  250

seq1  TTGTCTGTCTGTATTGGAAGACTGAAGAAGCTGGAGTCAGGTGTTAGTGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCTGTCTGTATTGGAAGACTGAAGAAGCTGGAGTCAGGTGTTAGTGG  300

seq1  AGGACAGTGAAAGCAACTAGGAGAATAGACACAAGCAGGAAGCCGTGCTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACAGTGAAAGCAACTAGGAGAATAGACACAAGCAGGAAGCCGTGCTA  350

seq1  GGCCAATCAGCATGCACCAGGATATTTTATTGAATCACCCACTAAACGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAATCAGCATGCACCAGGATATTTTATTGAATCACCCACTAAACGGT  400

seq1  CCCATCCACTCCAGGCAAGTGTCTTTTTGTGAGTGTTACAGCTCTGAGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCCACTCCAGGCAAGTGTCTTTTTGTGAGTGTTACAGCTCTGAGGG  450

seq1  GAAAGGTTTCCCCAATGCAAGTCTTATAGCTCTGAAGGGAAAGTTGTCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGTTTCCCCAATGCAAGTCTTATAGCTCTGAAGGGAAAGTTGTCCT  500

seq1  GGAAGGTGGGAGTCAAGGAACACCACCAAGTCACATTGCACAACAAACCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGTGGGAGTCAAGGAACACCACCAAGTCACATTGCACAACAAACCT  550

seq1  CATGCAAGAAACTTACTGGGAAAGACAATGGCTGCCTCTGCTCCTTTGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCAAGAAACTTACTGGGAAAGACAATGGCTGCCTCTGCTCCTTTGAG  600

seq1  AAGCAGGAGGGAACTGAGCTGGAGGCAGGC-TTTATACAGGGTTTC-TTG  648
      |||||||||||||||||||||||||||||| ||||||||||||||| |||
seq2  AAGCAGGAGGGAACTGAGCTGGAGGCAGGCTTTTATACAGGGTTTCTTTG  650

seq1  GCAGCAGTTTTCCAGGATAAGGATTTCCAGGATTGGTGGGGTTTCAAGTC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAGTTTTCCAGGATAAGGATTTCCAGGATTGGTGGGGTTTCAAGTC  700

seq1  CTGAGCTTGGGGTGAGCCCAGGAATTGGTGGGATTTCAAGATCAGGGATT  748
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  CTGAGCTTGGGGTGAGCCCAGGAATTGGTGGGATTTCAAGATCA-GGATT  749

seq1  GGTGGGATTTTGAACTCGGGATTTGGTGGGTTTTCAAACCTGGACATAAG  798
      |||||   ||||||||| ||||||||| ||||||| ||||||||||||||
seq2  GGTGG--ATTTGAACTC-GGATTTGGT-GGTTTTC-AACCTGGACATAAG  794

seq1  CTCAGACGTTTTTTTTTTTTTACCCTACACTTTTTCTTTCAGTTTTTAAT  848
      |||||||||||||||||||||||||||||||||||| |||||  ||||||
seq2  CTCAGACGTTTTTTTTTTTTTACCCTACACTTTTTC-TTCAG--TTTAAT  841

seq1  TCCTGAAAACGCCCCAGATATTGGCCCCAAGGGTTGGTTGATTCTGG  895
      || ||||||||||||| ||| ||||||||||||||||||||||||||
seq2  TCTTGAAAACGCCCCATATA-TGGCCCCAAGGGTTGGTTGATTCTGG  887

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information