MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-180D01
Chromosome	1 (Build37)
Map Location	85,238,442 - 85,279,058
singlet/doublet	doublet
Overlap gene	C130026I21Rik
Upstream gene	5033414K04Rik, LOC100039638, Dner, Trip12, Fbxo36, Slc16a14, LOC100039695, EG665317, LOC100039723, A530032D15Rik, LOC100039742, LOC100040158, LOC621835, EG665378
Downstream gene	LOC100040135, LOC639868
Link	Open Mouse BAC browser

Click to get alignment info.

name	5033414K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98496 MGI:2138391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039638 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Dner (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227325 MGI:2152889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trip12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14897 MGI:1309481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66153 MGI:1289192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71781 MGI:1919031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039695 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 875 ESTs, 8 Proteins

name	EG665317 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665317 MGI:3643856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs, 4 Proteins

name	LOC100039723 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein

name	A530032D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381287 MGI:3037746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 4 Proteins

name	LOC100040158 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 1 Protein

name	LOC621835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	EG665378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665378 MGI:3644536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C130026I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620078 MGI:3612702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 1 Protein

name	LOC639868 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein

name	5033414K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556212 GeneID:98496 MGI:2138391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5033414K04 gene transcript_id : NM_001003948.1

name	Dner (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23097345 GeneID:227325 MGI:2152889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : delta/notch-like EGF-related receptor transcript_id : NM_152915.1

name	Trip12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91932790 GeneID:14897 MGI:1309481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor interactor 12 transcript_id : NM_133975.4

name	Fbxo36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371227 GeneID:66153 MGI:1289192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 36 transcript_id : NM_025386.2

name	Slc16a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281605 GeneID:71781 MGI:1919031
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 14 transcript_id : NM_027921.1

name	LOC100039695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234141 GeneID:100039695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 875 ESTs, 8 Proteins product : similar to Ribosomal protein L19 transcript_id : XM_001473348.1

name	EG665317 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234143 GeneID:665317 MGI:3643856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs, 4 Proteins product : predicted gene, EG665317, transcript variant 1 transcript_id : XM_979163.2

name	LOC100039723 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234145 GeneID:100039723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : similar to SP140 nuclear body protein family member transcript_id : XM_001473384.1

name	A530032D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215537 GeneID:381287 MGI:3037746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530032D15Rik gene transcript_id : NM_213615.2

name	LOC100039742 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234147 GeneID:100039742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 4 Proteins product : similar to SP140 nuclear body protein family member transcript_id : XM_001473420.1

name	LOC100040158 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234154 GeneID:100040158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 1 Protein product : similar to putative G-protein coupled receptor transcript_id : XM_001474098.1

name	EG665378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215546 GeneID:665378 MGI:3644536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG665378 transcript_id : NM_001081746.1

name	C130026I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130487814 GeneID:620078 MGI:3612702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130026I21 gene transcript_id : NM_001037909.3

name	C130026I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130495347 GeneID:620078 MGI:3612702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130026I21 gene transcript_id : NM_175219.3

name	LOC100040135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234152 GeneID:100040135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 1 Protein product : similar to HSR transcript_id : XM_001474085.1

name	LOC639868 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234150 GeneID:639868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein product : similar to SP140 nuclear body protein family member transcript_id : XM_001473499.1

name	Dner (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23097346 CCDS:CCDS15105.1 GeneID:227325 MGI:2152889
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005112 - Notch binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0010001 - glial cell differentiation [Evidence IDA] [Evidence IMP]; GO:0007220 - Notch receptor processing [Evidence IDA]; GO:0048741 - skeletal muscle fiber development [Evidence IDA] codon_start : 1 note : transmembrane protein Bet product : delta/notch-like EGF-related receptor protein_id : NP_690879.1

name	Trip12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91932791 GeneID:14897 MGI:1309481
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : thyroid receptor interactor TRIP12; gene trap locus 6 product : thyroid hormone receptor interactor 12 protein_id : NP_598736.4

name	Fbxo36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384764 GeneID:66153 MGI:1289192
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box only protein 36 protein_id : NP_079662.1

name	Slc16a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281606 CCDS:CCDS15106.1 GeneID:71781 MGI:1919031
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 16 (monocarboxylic acid transporters), member 14 protein_id : NP_082197.1

name	LOC100039695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234142 GeneID:100039695
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473398.1

name	EG665317 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234144 GeneID:665317 MGI:3643856
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_984257.2

name	LOC100039723 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234146 GeneID:100039723
definition	codon_start : 1 product : similar to SP140 nuclear body protein family member protein_id : XP_001473434.1

name	A530032D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126215538 CCDS:CCDS15107.1 GeneID:381287 MGI:3037746
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SP140 nuclear body protein family member protein_id : NP_998780.2

name	LOC100039742 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234148 GeneID:100039742
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473470.1

name	LOC100040158 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234155 GeneID:100040158
definition	codon_start : 1 product : similar to putative G-protein coupled receptor protein_id : XP_001474148.1

name	EG665378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126215547 GeneID:665378 MGI:3644536
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : predicted gene, EG665378 protein_id : NP_001075215.1

name	C130026I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126352632 CCDS:CCDS15109.1 GeneID:620078 MGI:3612702
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; SP140 nuclear body protein family member product : SP140 nuclear body protein family member isoform 2 protein_id : NP_001032998.2

name	C130026I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424850 GeneID:620078 MGI:3612702
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; SP140 nuclear body protein family member product : SP140 nuclear body protein family member isoform 1 protein_id : NP_780428.1

name	LOC100040135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234153 GeneID:100040135
definition	codon_start : 1 product : similar to HSR protein_id : XP_001474135.1

name	LOC639868 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234151 GeneID:639868
definition	codon_start : 1 product : similar to SP140 nuclear body protein family member protein_id : XP_001473549.1

name	LOC100039638 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039638
definition	number : 2 pseudo : _no_value

name	LOC100039638 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039638
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:209794
definition	standard_name : RH127183

name	(CDS detail)
type	STS
link
xref	UniSTS:128806
definition	standard_name : D1Mit438

name	(CDS detail)
type	STS
link
xref	UniSTS:125604
definition	standard_name : Results_ER_9_5_95_27.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:212197
definition	standard_name : RH128889

name	(CDS detail)
type	STS
link
xref	UniSTS:463331
definition	standard_name : TRIP12_3930

name	(CDS detail)
type	STS
link
xref	UniSTS:162649
definition	standard_name : RH125936

name	(CDS detail)
type	STS
link
xref	UniSTS:225226
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:163187
definition	standard_name : RH126479

name	(CDS detail)
type	STS
link
xref	UniSTS:210268
definition	standard_name : RH136275

name	(CDS detail)
type	STS
link
xref	UniSTS:167293
definition	standard_name : D1Ertd757e

name	(CDS detail)
type	STS
link
xref	UniSTS:124054
definition	standard_name : 33.MMHAP85FRC12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125107
definition	standard_name : MHAa28f10.seq

name	LOC621835 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234149 GeneID:621835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to SP140 nuclear body protein family member pseudo : _no_value transcript_id : XR_031226.1

clone name	MSMg01-487A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504I12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-367K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-270P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-186B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-067L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374M09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-305F08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-329H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-406F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-151F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-378B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-382N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-370N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-151G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-085I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517M10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394J04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-397G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153O01
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-281D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221D05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-180D01.b	B6Ng01-180D01.g
ACC	GA006695	GA006696
length	765	1,037
definition	B6Ng01-180D01.b	B6Ng01-180D01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(85,238,442 - 85,239,205)	(85,278,039 - 85,279,058)
sequence	gaattcttcacccattagaccctcgatgcacctatggaggggtcagatga taggttggtggggaccatcaccatcacagtgccaggtgttctctttaaag ggcatagatgagggagccacgtgctttctcagactggtatctttggtttg gtttttctgatatgattttaatttgcttataggaatctacatacagtccc agttcactctaacaagtttatagagaggaccttctctatacccaggagta agtaatttatcatctgtgttgtgtagtcagggttaagcagatggtgctgt tcatacttccagccaggcacagagtcatcttacatctgcaaacagaatct aaagcttcttgtaaaaagaagtctctcagcccggcagtgaggtgaacacc tttaatcccagcaccggtgggtctctgagttcgaggccagcctggtctac agagcaagttccaggacaattaaggccacataaagaaaccctgtcttaaa aaatccaaacaaaccaaaacccaaaacctacctctcaccctccagaaggc aagacacaatctgaaaacaacaacaaccatgacaacagaaacccctaaca acattatgaacaaaccagtaccccggagcacttgactctatctgcatatg tatcaaaagatggcctagtcggccatcaatggaaagagcggcccattgga cttgcaaactttatatgcaggggaatgccagggccaaaaattgggtgtgg gtgggtagggggagt	gaattctttgaatcagttctagggaaattaagctagggaacagataatgg tagagcctaaggatgacttctgggcatgagaaaccaagaatttgtgaagg gaaaacaagaaccagatatgaggagataaagacttgagcagctggagtat tggatcgtttgcctgctatcccagcacttgaaagcatccaggaccatgga aagaactgaggtgggagaaaacggacttggaaggcttccaggaagcaatg gggaaaccaatggatgacagtatcagaaaggtcacagtgtttttatcatt attatcattatcataattatgacatttatcagtatgtggaggttgggcat atgttctttggtacacatggagaggccaagaaacaacttgtgagttgggt ctgttcttccaccatatgggtttcagggatcaaattcaggtcaccaggct tggtggcaaggacctcgagctagtgagccatttgccagaccaatgacaca ttttaattgactggtgacatctcagagtagaagatgggagagcgccaaag gcgaggtgggaataggtagtcaggtggacatcgaacctgcttgccaccat gaggtttaagtgacagataatggatgttgcctgcctatgatttaccagga agcattttccttctgggggaggctagtgtaccagtcacaccaagcagttg tggatgggagttcagtgaatttgagcaaatgcttggttcaatatgtctaa gtgccttcttgttacctataattttttgcaaagcctttgaggaaggcgga gtgagaagaaaatgaggagatgccatgtgatttgcagacacacaatggat gctcgcatgatggatgctaggatgtgctatagctagaagaacaggaagcg tcacatgggaaaggatgtcctgttaccctttcttgtttgcaggtgttgca gggtaactaccttccctggggcatttccaggtcatttgcttgctgggaga gtcatcttttttccccctaggaaaagaaacggaattc
quality values	Open. Hide. 47 31 28 32 52 62 43 62 27 18 56 62 33 20 62 47 47 62 62 43 37 49 49 62 56 47 54 62 59 43 59 62 12 16 15 9 10 8 8 10 10 7 9 6 5 9 9 49 62 59 34 59 62 59 62 62 62 62 62 62 62 62 59 59 30 56 43 62 59 51 62 59 59 62 62 62 62 14 16 11 10 13 9 10 10 10 9 13 10 10 10 14 51 49 62 59 62 54 54 62 62 62 62 62 62 62 59 59 62 54 62 59 54 62 59 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 59 54 43 35 43 59 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 37 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 41 34 18 18 12 13 18 13 18 25 18 30 34 62 62 62 62 62 62 62 62 43 62 62 62 49 62 62 62 62 62 32 50 31 27 27 41 41 56 56 50 56 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 49 58 58 58 58 58 54 47 54 58 58 42 58 52 58 48 54 58 52 54 52 58 58 58 58 58 58 58 58 58 58 54 48 58 58 54 54 58 52 58 58 45 58 58 58 49 51 53 58 58 49 52 58 51 54 58 49 54 58 51 58 48 47 50 43 44 50 50 58 58 58 58 58 58 58 42 48 42 31 38 49 51 51 51 54 54 51 49 49 58 58 46 54 41 39 58 51 49 58 50 54 52 58 58 58 53 51 54 50 44 38 42 53 58 54 51 58 49 54 58 58 54 50 51 21 58 41 20 58 54 41 31 46 58 47 39 41 51 52 54 42 38 29 49 54 54 54 54 54 35 49 41 53 54 38 39 54 53 32 54 54 49 37 46 39 49 54 49 40 37 51 54 50 32 33 31 47 40 41 45 40 39 39 33 49 54 54 54 13 16 54 31 14 9 9 39 42 30 46 40 51 54 54 54 33 39 31 20 27 38 40 32 36 32 22 15 30 32 22 27 33 17 24 31 22 13 14 5 6	Open. Hide. 46 35 32 47 62 62 62 62 62 62 49 62 13 12 8 8 11 11 9 6 10 12 13 10 11 18 62 59 62 62 59 62 62 59 59 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 20 18 13 10 25 13 11 13 23 11 13 13 13 18 48 56 62 62 62 62 62 54 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 54 49 54 54 42 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 54 62 62 62 62 54 62 62 62 62 62 54 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 56 43 38 56 59 56 49 38 38 62 62 46 37 49 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 47 47 56 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 56 62 62 56 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 54 43 62 62 56 62 62 56 62 33 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 52 62 62 36 62 54 62 62 62 52 42 39 62 62 62 62 62 62 62 62 62 50 54 62 43 62 54 45 41 58 50 58 54 54 54 52 58 58 54 37 54 52 58 52 54 37 41 58 46 58 41 58 58 58 54 40 58 54 58 39 49 54 49 49 43 38 23 52 24 39 42 41 52 41 58 58 58 46 47 40 28 36 58 42 41 58 54 58 52 54 58 58 58 58 50 58 16 58 19 42 22 24 50 53 51 50 26 26 13 11 16 30 37 50 46 45 25 35 51 51 58 49 37 38 33 40 50 54 49 37 33 49 58 30 58 34 27 42 53 46 23 18 51 51 25 21 58 50 51 38 29 50 13 51 6 14 51 40 58 50 58 32 16 51 39 27 21 9 11 13 26 41 54 29 18 44 25 39 50 19 58 39 52 46 12 49 44 25 27 33 32 25 17 40 45 51 35 39 54 54 49 52 32 44 33 29 44 28 24 39 29 32 54 54 49 49 18 37 49 29 14 19 17 30 20 18 7 10 25 52 37 46 16 6 51 53 52 32 31 24 24 6 27 15 13 9 9 13 10 27 12 13 26 16 18 28 7 33 7 15 33 18 16 24 13 14 17 26 32 15 26 21 41 23 31 28 40 20 9 26 28 34 37 32 35 31 13 11 31 34 22 36 32 22 31 18 42 32 23 19 21 25 10 14 29 31 30 16 41 33 29 26 26 25 19 32 12 15 5 12 14 33 5 9 31 12 9 18 7 9 6 25 20 21 19 33 42 17 6 46 19 11 21 28 22 12 18 30 8 24 8 16 42 12 31 46 18 38 8 46 28 10 20 14 10 9 23 31 39 18 12 11 18 15 32 24 33 39 15 5 8 6 11 14 9 16 19 22 33 9 38 13 7 29 36 41 12 12 13 20 19 28 21 9 6 8 6 6 31 20 37 38 14 32 18 25 9 37 34 10 11 29 11 9 8 22 8 8 29 17 8 25 24 33 33 37 11 7 8 19 17 26 14 18 29 10 7 15 7 15 5 14 22 36 26 11 16 15 22 32 22 34 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_85238442_85239205
seq2: B6Ng01-180D01.b_47_811

seq1  GAATTCTTCACCCATTAGACCCTCGATGCACCTACGGAGTGGTCAGATGA  50
      |||||||||||||||||||||||||||||||||| |||| ||||||||||
seq2  GAATTCTTCACCCATTAGACCCTCGATGCACCTATGGAGGGGTCAGATGA  50

seq1  TAGGTTGGTGGGGACCATCACCATCACAGTGCCAGGTGTTCTCTTTAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTTGGTGGGGACCATCACCATCACAGTGCCAGGTGTTCTCTTTAAAG  100

seq1  GGCATAGATGAGGGAGCCACGTGCTTTCTCAGACTGGTATCTTTGGTTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATAGATGAGGGAGCCACGTGCTTTCTCAGACTGGTATCTTTGGTTTG  150

seq1  GTTTTTCTGATATGATTTTAATTTGCTTATAGGAATCTACATACAGTCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTCTGATATGATTTTAATTTGCTTATAGGAATCTACATACAGTCCC  200

seq1  AGTTCACTCTAACAAGTTTATAGAGAGGACCTTCTCTATACCCAGGAGTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCACTCTAACAAGTTTATAGAGAGGACCTTCTCTATACCCAGGAGTA  250

seq1  AGTAATTTATCATCTGTGTTGTGTAGTCAGGGTTAAGCAGATGGTGCTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAATTTATCATCTGTGTTGTGTAGTCAGGGTTAAGCAGATGGTGCTGT  300

seq1  TCATACTTCCAGCCAGGCACAGAGTCATCTTACATCTGCAAACAGAATCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATACTTCCAGCCAGGCACAGAGTCATCTTACATCTGCAAACAGAATCT  350

seq1  AAAGCTTCTTGTAAAAAGAAGTCTCTCAGCCCGGCAGTGAGGTGAACACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCTTCTTGTAAAAAGAAGTCTCTCAGCCCGGCAGTGAGGTGAACACC  400

seq1  TTTAATCCCAGCACCAGTGGGTCTCTGAGTTCGAGGCCAGCCTGGTCTAC  450
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  TTTAATCCCAGCACCGGTGGGTCTCTGAGTTCGAGGCCAGCCTGGTCTAC  450

seq1  AGAGCAAGTTCCAGGACAACTAAGGCCACATAAAGAAACCCTGTCTTAAA  500
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  AGAGCAAGTTCCAGGACAATTAAGGCCACATAAAGAAACCCTGTCTTAAA  500

seq1  AAATCCAAACAAACCAAAACCCAAAACCTACCTCTCACCCTCCAGAAGGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCCAAACAAACCAAAACCCAAAACCTACCTCTCACCCTCCAGAAGGC  550

seq1  AAGACACAATCTGAAAACAACAACAACCATGACAACAGAAACCCCTAACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACACAATCTGAAAACAACAACAACCATGACAACAGAAACCCCTAACA  600

seq1  ACATTATGAACAAACCAGTACCCAGGAGCACTTGACTCTATCTGCATATG  650
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  ACATTATGAACAAACCAGTACCCCGGAGCACTTGACTCTATCTGCATATG  650

seq1  TATCAAAAGATGGCCTAGTCGGCCATCAATGGAAAGAGTGGCCCATTGGA  700
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  TATCAAAAGATGGCCTAGTCGGCCATCAATGGAAAGAGCGGCCCATTGGA  700

seq1  CTTGCAAACTTTATATGCAGGGGAATGCCAGGGCCAAAAATTGGGAGTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||| ||| 
seq2  CTTGCAAACTTTATATGCAGGGGAATGCCAGGGCCAAAAATTGGGTGTGG  750

seq1  GTGGGTA-GGGGAGT  764
      ||||||| |||||||
seq2  GTGGGTAGGGGGAGT  765

seq1: chr1_85278039_85279058
seq2: B6Ng01-180D01.g_67_1103 (reverse)

seq1  GAATTCCGTTTCTTTTGCTAGTGG--TAAAAGATGACTCT-CCAGC-AGC  46
      |||||||||||||||| |||| ||   ||||||||||||| ||||| |||
seq2  GAATTCCGTTTCTTTTCCTAGGGGGAAAAAAGATGACTCTCCCAGCAAGC  50

seq1  AAATGACCTGGCAATGGCCCA-GGAAG-----TACCCTGC-ACACCTGCA  89
      ||||||||||| |||| |||| |||||     |||||||| |||||||||
seq2  AAATGACCTGGAAATGCCCCAGGGAAGGTAGTTACCCTGCAACACCTGCA  100

seq1  AACAAGAAAGG--TACA-GACATCCTTTCCCATGTGACGCTTCCTGTTCT  136
      |||||||||||   ||| ||||||||||||||||||||||||||||||||
seq2  AACAAGAAAGGGTAACAGGACATCCTTTCCCATGTGACGCTTCCTGTTCT  150

seq1  TCTAGCTGTAGAACATCCTAGCATCCATGATGCGAGCATCCATTGTGTGT  186
      ||||||| ||| |||||||||||||||| |||||||||||||||||||||
seq2  TCTAGCTATAGCACATCCTAGCATCCATCATGCGAGCATCCATTGTGTGT  200

seq1  CTGC-AATCACATGGCGTCTCCTCATTTTCTTCTCACTCTGCCTTCCTCA  235
      |||| ||||||||||| |||||||||||||||||||||| ||||||||||
seq2  CTGCAAATCACATGGCATCTCCTCATTTTCTTCTCACTCCGCCTTCCTCA  250

seq1  AAGGCTTTGC-AAAAATTATAGGTAACAAGAAGGCACTTAGACATATTGA  284
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTTTGCAAAAAATTATAGGTAACAAGAAGGCACTTAGACATATTGA  300

seq1  ACCAAGCA-TTGCTCAAATTCACTGAACTCCCATCCACAACTGCTTGGTG  333
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAGCATTTGCTCAAATTCACTGAACTCCCATCCACAACTGCTTGGTG  350

seq1  TGACTGGTACACTAGCCTCCCCCAGAAGGAAAATGCTTCCTGGTAAATCA  383
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGGTACACTAGCCTCCCCCAGAAGGAAAATGCTTCCTGGTAAATCA  400

seq1  TAGGCAGGCAACATCCATTATCTGTCACTTAAACCTCATGGTGGCAAGCA  433
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCAGGCAACATCCATTATCTGTCACTTAAACCTCATGGTGGCAAGCA  450

seq1  GGTTGGATGTCCACCTGACTACCTATTCCCACCTCGCCTTTGGCGCTCTC  483
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCGATGTCCACCTGACTACCTATTCCCACCTCGCCTTTGGCGCTCTC  500

seq1  CCATCTTCTACTCTGAGATGTCACCAGTCAATTAAAATGTGTCATTGGTC  533
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTTCTACTCTGAGATGTCACCAGTCAATTAAAATGTGTCATTGGTC  550

seq1  TGGCAAATGGCTCACTAGCTCAAGGTCCTTGCCACCAAGCCTGGTGACCT  583
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  TGGCAAATGGCTCACTAGCTCGAGGTCCTTGCCACCAAGCCTGGTGACCT  600

seq1  GAATTTGATCCCTGAAACCCATATGGTGGAAGAACAGACCCAACTCACAA  633
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTTGATCCCTGAAACCCATATGGTGGAAGAACAGACCCAACTCACAA  650

seq1  GTTGTTTCTTGGCCTCTCCATGTGTACCATGGAACATATGCCCAACCTCC  683
      |||||||||||||||||||||||||||||  |||||||||||||||||||
seq2  GTTGTTTCTTGGCCTCTCCATGTGTACCAAAGAACATATGCCCAACCTCC  700

seq1  ACATACTGATAAATGTCATAATTATGATAATGATAATAATGATAAAAACA  733
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACTGATAAATGTCATAATTATGATAATGATAATAATGATAAAAACA  750

seq1  CTGTGACCTTTCTGATACTGTCATCCATTGGTTTCCCCATTGCTTCCTGG  783
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGACCTTTCTGATACTGTCATCCATTGGTTTCCCCATTGCTTCCTGG  800

seq1  AAGCCTTCCAAGTCCGTTTTCTCCCACCTCAGTTCTTTCCATGGTCCTGG  833
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCTTCCAAGTCCGTTTTCTCCCACCTCAGTTCTTTCCATGGTCCTGG  850

seq1  ATGCTTTCAAGTGCTGGGATAGCAGGCAAATGATCCAATACTCCAGCTGC  883
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  ATGCTTTCAAGTGCTGGGATAGCAGGCAAACGATCCAATACTCCAGCTGC  900

seq1  TCAAGTCTTTATCTCCTCATGTCTGGTTCTTGTTTTCCCTTCACAAATTC  933
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  TCAAGTCTTTATCTCCTCATATCTGGTTCTTGTTTTCCCTTCACAAATTC  950

seq1  TTGGTTTCTCATGCCCAGAAGTCATCCTTAGGATCTACCATTATCTGTTC  983
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TTGGTTTCTCATGCCCAGAAGTCATCCTTAGGCTCTACCATTATCTGTTC  1000

seq1  CCTAGCTTAATTTCCCAAGAACTGATTCAAAGAATTC  1020
      |||||||||||||||| ||||||||||||||||||||
seq2  CCTAGCTTAATTTCCCTAGAACTGATTCAAAGAATTC  1037

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information