MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-190H24
Chromosome	1 (Build37)
Map Location	94,404,104 - 94,576,971
singlet/doublet	doublet
Overlap gene	Olfr1414, Olfr1413, Olfr1412, Olfr1411, Olfr1410, Olfr12, Myeov2, Otos
Upstream gene	Traf3ip1, Asb1, Twist2, Hdac4, LOC100040419, LOC665883, Ndufa10, Olfr1416, Olfr1415
Downstream gene	Gpc1, Ankmy1, Dusp28, LOC100040511, Rnpepl1, Capn10, Gpr35, Aqp12, Kif1a, Agxt, 2310007B03Rik, E030010N08Rik, Sned1, Mterfd2, LOC665966, Pask, Ppp1r7, Tmem16g, Hdlbp, Sept2, Farp2, Stk25
Link	Open Mouse BAC browser

Click to get alignment info.

name	Traf3ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74019 MGI:1921269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65247 MGI:1929735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Twist2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13345 MGI:104685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208727 MGI:3036234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC665883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ndufa10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67273 MGI:1914523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1416 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259040 MGI:3031250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1415 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258228 MGI:3031249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259041 MGI:3031248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259039 MGI:3031247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258274 MGI:3031246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1411 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258483 MGI:3031245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1410 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258484 MGI:3031244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257890 MGI:107863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myeov2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66915 MGI:1914165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 143 ESTs

name	Otos (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260301 MGI:2672814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14733 MGI:1194891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankmy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241158 MGI:3045261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67446 MGI:1914696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rnpepl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108657 MGI:1914170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23830 MGI:1344392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64095 MGI:1929509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208760 MGI:2664636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16560 MGI:108391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agxt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11611 MGI:1329033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310007B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71874 MGI:1919124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E030010N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381284 MGI:3045962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Sned1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208777 MGI:3045960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mterfd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69821 MGI:1918355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins pseudo : _no_value

name	Pask (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269224 MGI:2155936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66385 MGI:1913635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404545 MGI:3052714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdlbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110611 MGI:99256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18000 MGI:97298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Farp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227377 MGI:2385126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59041 MGI:1891699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf3ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63147417 GeneID:74019 MGI:1921269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TNF receptor-associated factor 3 interacting protein 1 transcript_id : NM_028718.1

name	Asb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472023 GeneID:65247 MGI:1929735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 1 transcript_id : NM_001039126.2

name	Asb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472020 GeneID:65247 MGI:1929735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 1 transcript_id : NM_023046.4

name	Twist2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131151 GeneID:13345 MGI:104685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : twist homolog 2 (Drosophila) transcript_id : NM_007855.2

name	Hdac4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402200 GeneID:208727 MGI:3036234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 4 transcript_id : NM_207225.1

name	Ndufa10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195623 GeneID:67273 MGI:1914523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10 transcript_id : NM_024197.1

name	Olfr1416 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128868 GeneID:259040 MGI:3031250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1416 transcript_id : NM_147038.1

name	Olfr1415 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372123 GeneID:258228 MGI:3031249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1415 transcript_id : NM_001011525.1

name	Olfr1414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128870 GeneID:259041 MGI:3031248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1414 transcript_id : NM_147039.1

name	Olfr1413 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128874 GeneID:259039 MGI:3031247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1413 transcript_id : NM_147037.1

name	Olfr1412 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129728 GeneID:258274 MGI:3031246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1412 transcript_id : NM_146277.1

name	Olfr1411 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239103 GeneID:258483 MGI:3031245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1411 transcript_id : NM_146490.1

name	Olfr1410 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239101 GeneID:258484 MGI:3031244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1410 transcript_id : NM_146491.1

name	Olfr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047463 GeneID:257890 MGI:107863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 12 transcript_id : NM_206896.1

name	Myeov2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234223 GeneID:66915 MGI:1914165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 143 ESTs product : myeloma overexpressed 2 transcript_id : XM_888711.3

name	Otos (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896643 GeneID:260301 MGI:2672814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otospiralin transcript_id : NM_153114.2

name	Gpc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802707 GeneID:14733 MGI:1194891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 1 transcript_id : NM_016696.2

name	Ankmy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356868 GeneID:241158 MGI:3045261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and MYND domain containing 1 transcript_id : NM_172850.2

name	Dusp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75750527 GeneID:67446 MGI:1914696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 28 transcript_id : NM_175118.3

name	LOC100040511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234195 GeneID:100040511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040511 transcript_id : XM_001474840.1

name	Rnpepl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340969 GeneID:108657 MGI:1914170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginyl aminopeptidase (aminopeptidase B)-like 1 transcript_id : NM_181405.2

name	Capn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87080822 GeneID:23830 MGI:1344392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 10 transcript_id : NM_011796.2

name	Gpr35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356082 GeneID:64095 MGI:1929509
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 35 transcript_id : NM_022320.3

name	Aqp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29243943 GeneID:208760 MGI:2664636
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 12 transcript_id : NM_177587.1

name	Kif1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801924 GeneID:16560 MGI:108391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1A transcript_id : NM_008440.2

name	Agxt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038129 GeneID:11611 MGI:1329033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanine-glyoxylate aminotransferase transcript_id : NM_016702.2

name	2310007B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803386 GeneID:71874 MGI:1919124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310007B03 gene transcript_id : NM_172411.3

name	E030010N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234197 GeneID:381284 MGI:3045962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA E030010N08 gene transcript_id : XM_001474855.1

name	Sned1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254324 GeneID:208777 MGI:3045960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi, nidogen and EGF-like domains 1 transcript_id : NM_172463.3

name	Mterfd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852399 GeneID:69821 MGI:1918355
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MTERF domain containing 2 transcript_id : NM_178051.3

name	Pask (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18497291 GeneID:269224 MGI:2155936
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PAS domain containing serine/threonine kinase transcript_id : NM_080850.1

name	Ppp1r7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892536 GeneID:66385 MGI:1913635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 7 transcript_id : NM_023200.2

name	Tmem16g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309608 GeneID:404545 MGI:3052714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16g transcript_id : NM_207031.1

name	Hdlbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801781 GeneID:110611 MGI:99256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high density lipoprotein (HDL) binding protein transcript_id : NM_133808.3

name	Sept2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754815 GeneID:18000 MGI:97298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 2 transcript_id : NM_010891.1

name	Farp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704021 GeneID:227377 MGI:2385126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM, RhoGEF and pleckstrin domain protein 2 transcript_id : NM_145519.1

name	Stk25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337276 GeneID:59041 MGI:1891699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 25 (yeast) transcript_id : NM_021537.3

name	Traf3ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63147418 GeneID:74019 MGI:1921269
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0015630 - microtubule cytoskeleton [Evidence ISS] GO_function : GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS]; GO:0015631 - tubulin binding [Evidence ISS] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0042527 - negative regulation of tyrosine phosphorylation of Stat6 protein [Evidence ISS]; GO:0051101 - regulation of DNA binding [Evidence ISS] codon_start : 1 note : microtubule-interacting protein that associates with TRAF3 product : TNF receptor-associated factor 3 interacting protein 1 protein_id : NP_082994.1

name	Asb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85060518 GeneID:65247 MGI:1929735
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030539 - male genitalia development [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1; ankyrin repeat-containing SOCS box protein 1 product : ankyrin repeat and SOCS box-containing protein 1 isoform a protein_id : NP_001034215.1

name	Asb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85060520 GeneID:65247 MGI:1929735
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030539 - male genitalia development [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2; ankyrin repeat-containing SOCS box protein 1 product : ankyrin repeat and SOCS box-containing protein 1 isoform b protein_id : NP_075533.3

name	Twist2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681177 CCDS:CCDS15166.1 GeneID:13345 MGI:104685
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : dermis expressed 1 product : twist homolog 2 protein_id : NP_031881.1

name	Hdac4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402201 GeneID:208727 MGI:3036234
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] [Evidence IMP] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IMP] [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IMP] [Evidence IDA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : histone deacetylase 4 protein_id : NP_997108.1

name	Ndufa10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195624 CCDS:CCDS15167.1 GeneID:67273 MGI:1914523
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10 protein_id : NP_077159.1

name	Olfr1416 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128869 CCDS:CCDS15168.1 GeneID:259040 MGI:3031250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81277975-81278913; olfactory receptor MOR103-3 product : olfactory receptor 1416 protein_id : NP_667249.1

name	Olfr1415 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372124 CCDS:CCDS15169.1 GeneID:258228 MGI:3031249
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81266841-81267776; olfactory receptor MOR103-12 product : olfactory receptor 1415 protein_id : NP_001011525.1

name	Olfr1414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128871 CCDS:CCDS15170.1 GeneID:259041 MGI:3031248
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81245243-81246181; olfactory receptor MOR103-2 product : olfactory receptor 1414 protein_id : NP_667250.1

name	Olfr1413 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128875 CCDS:CCDS15171.1 GeneID:259039 MGI:3031247
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81180849-81179878; olfactory receptor MOR208-1 product : olfactory receptor 1413 protein_id : NP_667248.1

name	Olfr1412 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129729 CCDS:CCDS15172.1 GeneID:258274 MGI:3031246
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81165686-81164721; olfactory receptor MOR208-4 product : olfactory receptor 1412 protein_id : NP_666389.1

name	Olfr1411 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239104 CCDS:CCDS15173.1 GeneID:258483 MGI:3031245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81157497-81156526; olfactory receptor MOR208-3 product : olfactory receptor 1411 protein_id : NP_666701.1

name	Olfr1410 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239102 GeneID:258484 MGI:3031244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81146179-81145211; olfactory receptor MOR208-2 product : olfactory receptor 1410 protein_id : NP_666702.1

name	Olfr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047464 CCDS:CCDS15174.1 GeneID:257890 MGI:107863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2R7CC-81134096-81133095 product : olfactory receptor 12 protein_id : NP_996779.1

name	Myeov2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82881000 GeneID:66915 MGI:1914165
definition	codon_start : 1 product : hypothetical protein LOC66915 protein_id : XP_893804.1

name	Otos (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346551 GeneID:260301 MGI:2672814
definition	GO_process : GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 note : organ of Corti 10 kDa protein product : otospiralin protein_id : NP_694754.1

name	Gpc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710028 CCDS:CCDS15177.1 GeneID:14733 MGI:1194891
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : glypican 1 protein_id : NP_057905.1

name	Ankmy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370284 CCDS:CCDS15178.1 GeneID:241158 MGI:3045261
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat and MYND domain containing 1 protein_id : NP_766438.1

name	Dusp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29171320 CCDS:CCDS15179.1 GeneID:67446 MGI:1914696
definition	GO_function : GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 28 protein_id : NP_780327.1

name	LOC100040511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234196 GeneID:100040511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474890.1

name	Rnpepl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088904 CCDS:CCDS15180.1 GeneID:108657 MGI:1914170
definition	GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0004179 - membrane alanyl aminopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arginyl aminopeptidase (aminopeptidase B)-like 1 protein_id : NP_852070.1

name	Capn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87080823 CCDS:CCDS15181.1 GeneID:23830 MGI:1344392
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004198 - calpain activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : calpain 8 product : calpain 10 protein_id : NP_035926.2

name	Gpr35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560294 CCDS:CCDS15182.1 GeneID:64095 MGI:1929509
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G-protein coupled receptor; internal gene name of KIRIN laboratory:M20 product : G protein-coupled receptor 35 protein_id : NP_071715.2

name	Aqp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243944 CCDS:CCDS15183.1 GeneID:208760 MGI:2664636
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : aquaporin 12 protein_id : NP_808255.1

name	Kif1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680558 GeneID:16560 MGI:108391
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : kinesin heavy chain member 1A; N-3 kinesin product : kinesin family member 1A protein_id : NP_032466.1

name	Agxt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111038130 CCDS:CCDS15184.1 GeneID:11611 MGI:1329033
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008453 - alanine-glyoxylate transaminase activity [Evidence IEA]; GO:0004760 - serine-pyruvate transaminase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : alanine-glyoxylate aminotransferase 1 product : alanine-glyoxylate aminotransferase protein_id : NP_057911.2

name	2310007B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59709443 CCDS:CCDS15185.1 GeneID:71874 MGI:1919124
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC71874 protein_id : NP_765999.2

name	E030010N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234198 GeneID:381284 MGI:3045962
definition	codon_start : 1 product : similar to ciliary rootlet coiled-coil, rootletin protein_id : XP_001474905.1

name	Sned1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254325 GeneID:208777 MGI:3045960
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation function : extracellular matrix component note : secreted protein SST3 product : secreted nidogen domain protein protein_id : NP_766051.3

name	Mterfd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017341 GeneID:69821 MGI:1918355
definition	codon_start : 1 product : MTERF domain containing 2 protein_id : NP_835152.1

name	Pask (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18497292 CCDS:CCDS15186.1 GeneID:269224 MGI:2155936
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : putative sensor protein note : paskin product : PAS domain containing serine/threonine kinase protein_id : NP_543126.1

name	Ppp1r7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963569 CCDS:CCDS15187.1 GeneID:66385 MGI:1913635
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : protein phosphatase-1 regulatory subunit 7 protein_id : NP_075689.1

name	Tmem16g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309609 CCDS:CCDS15188.1 GeneID:404545 MGI:3052714
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] codon_start : 1 note : new gene expressed in prostate; prostate cancer associated protein 5 product : transmembrane protein 16g protein_id : NP_996914.1

name	Hdlbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527028 CCDS:CCDS15189.1 GeneID:110611 MGI:99256
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vigilin product : high density lipoprotein binding protein protein_id : NP_598569.1

name	Sept2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754816 CCDS:CCDS15190.1 GeneID:18000 MGI:97298
definition	GO_component : GO:0005826 - contractile ring [Evidence NAS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence NAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence NAS] codon_start : 1 function : cytoskeletal component interacting with actin-based structures note : neural precursor cell expressed, developmentally down-regulated gene 5 product : septin 2 protein_id : NP_035021.1

name	Farp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704022 CCDS:CCDS15191.1 GeneID:227377 MGI:2385126
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016322 - neuron remodeling [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : FERM, RhoGEF and pleckstrin domain protein 2 protein_id : NP_663494.1

name	Stk25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89337277 CCDS:CCDS15192.1 GeneID:59041 MGI:1891699
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Ste20-like kinase; serine/threonine kinase 25 (Ste20, yeast homolog); Yeast Sps1/Ste20-related kinase 1 product : serine/threonine kinase 25 protein_id : NP_067512.3

name	LOC100040419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040419
definition	number : 1 pseudo : _no_value

name	LOC100040419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040419
definition	number : 2 pseudo : _no_value

name	LOC100040419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040419
definition	number : 3 pseudo : _no_value

name	LOC665883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665883
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:158830
definition	standard_name : AU041749

name	(CDS detail)
type	STS
link
xref	UniSTS:178440
definition	standard_name : AI851378

name	(CDS detail)
type	STS
link
xref	UniSTS:178434
definition	standard_name : AI426616

name	(CDS detail)
type	STS
link
xref	UniSTS:161241
definition	standard_name : RH124419

name	(CDS detail)
type	STS
link
xref	UniSTS:125733
definition	standard_name : U36384

name	(CDS detail)
type	STS
link
xref	UniSTS:128942
definition	standard_name : D1Mit84

name	(CDS detail)
type	STS
link
xref	UniSTS:234175
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234174
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234176
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128724
definition	standard_name : D1Mit365

name	(CDS detail)
type	STS
link
xref	UniSTS:124327
definition	standard_name : 39.MMHAP59FRE12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:489501
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492963
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491768
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485063
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492935
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485105
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491961
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125100
definition	standard_name : MHAa27a6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:498343
definition	standard_name : Gpc1

name	(CDS detail)
type	STS
link
xref	UniSTS:498431
definition	standard_name : Gpc1

name	(CDS detail)
type	STS
link
xref	UniSTS:466038
definition	standard_name : Gpc1

name	(CDS detail)
type	STS
link
xref	UniSTS:207191
definition	standard_name : AW555635

name	(CDS detail)
type	STS
link
xref	UniSTS:123433
definition	standard_name : 19.MMHAP66FLG1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158835
definition	standard_name : AI462976

name	(CDS detail)
type	STS
link
xref	UniSTS:128731
definition	standard_name : D1Mit371.1

name	(CDS detail)
type	STS
link
xref	UniSTS:491841
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178437
definition	standard_name : AV005521

name	(CDS detail)
type	STS
link
xref	UniSTS:165091
definition	standard_name : AI894167

name	(CDS detail)
type	STS
link
xref	UniSTS:158834
definition	standard_name : AI430010

name	(CDS detail)
type	STS
link
xref	UniSTS:178441
definition	standard_name : AW049679

name	(CDS detail)
type	STS
link
xref	UniSTS:128820
definition	standard_name : D1Mit45

name	(CDS detail)
type	STS
link
xref	UniSTS:124822
definition	standard_name : D29951

name	(CDS detail)
type	STS
link
xref	UniSTS:163258
definition	standard_name : D29951

name	(CDS detail)
type	STS
link
xref	UniSTS:224090
definition	standard_name : Agxt

name	(CDS detail)
type	STS
link
xref	UniSTS:124732
definition	standard_name : D17849

name	(CDS detail)
type	STS
link
xref	UniSTS:94223
definition	standard_name : G42365

name	(CDS detail)
type	STS
link
xref	UniSTS:163078
definition	standard_name : RH126370

name	(CDS detail)
type	STS
link
xref	UniSTS:123372
definition	standard_name : 18.MMHAP23FLF3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:209949
definition	standard_name : RH135953

name	(CDS detail)
type	STS
link
xref	UniSTS:178438
definition	standard_name : AI642697

name	(CDS detail)
type	STS
link
xref	UniSTS:271769
definition	standard_name : PMC193927P1

name	(CDS detail)
type	STS
link
xref	UniSTS:124152
definition	standard_name : 35.MMHAP65FRD11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158833
definition	standard_name : AI118566

name	(CDS detail)
type	STS
link
xref	UniSTS:243391
definition	standard_name : AI009079

name	(CDS detail)
type	STS
link
xref	UniSTS:158832
definition	standard_name : AA960365

name	(CDS detail)
type	STS
link
xref	UniSTS:167260
definition	standard_name : D1Ertd101e

name	(CDS detail)
type	STS
link
xref	UniSTS:185447
definition	standard_name : BB136667

name	(CDS detail)
type	STS
link
xref	UniSTS:122757
definition	standard_name : 03.MMHAP94FRA9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128901
definition	standard_name : D1Mit534

name	(CDS detail)
type	STS
link
xref	UniSTS:234178
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128920
definition	standard_name : D1Mit60

name	(CDS detail)
type	STS
link
xref	UniSTS:210452
definition	standard_name : RH136467

name	(CDS detail)
type	STS
link
xref	UniSTS:207193
definition	standard_name : C86992

name	(CDS detail)
type	STS
link
xref	UniSTS:158836
definition	standard_name : C86992

name	(CDS detail)
type	STS
link
xref	UniSTS:178442
definition	standard_name : AI042849

name	LOC665966 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234199 GeneID:665966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : similar to hCG1641837 pseudo : _no_value transcript_id : XR_031959.1

clone name	MSMg01-151N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494K02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-174K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-299N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308L8
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-190H24.b	B6Ng01-190H24.g
ACC	GA014240	GA014241
length	1,079	1,139
definition	B6Ng01-190H24.b	B6Ng01-190H24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(94,575,893 - 94,576,971)	(94,404,104 - 94,405,251)
sequence	gaattctctgatgtagaagctgcacagtaacatctgtcccctacctattc cccaggcaagcccctgactcccagctggtaatatacgggactactcaggt ctgcaggcagaggaacaggagccgcctcgttaggcagggtggatggctat gtactgtggcatatgtttagaggacagaagggaaagtctttgaagaagga cacggggcctttctgctctatgtggccaagctctgtgccatcagctatgt ggggtccagtgtaggcaggaccagaaaggcaagggcatcttcgctcatat ggtaccagacccacaatgtccatctgagtgtcacagtgactgggggatca cagatcaaccccttcttcttctgggcttagaaggggtaggatccctaagt ttgaagcctagcaggcctccagtggctttagggatgtgtaggtatcagct gcctgtccaggtaaagtggtaaaaggaaattggatgcactggcatccaat gggtactctttggcaatgatgcctttgaagatggcacagagaccaatgga ctgacttcagaatgagaggagagaacctccctatcccctcacgtgatgcc ctcaatggcagtgactccggagagtgtaacccacagcactctgaggtagt ctaggaactctcaaaaaggaaggcatgggggctgggatggaatacaactg gtacatcctcatgtgcagcttcctttgaatgcccagactgttgaagcctg aaatacacaagggacaaacacacatgcttatgtataaattatagatgtaa attacatcttgtgttatgtatcaattgtttgtgaattatacatacataat ttatacataaattatgcaccatatttatataaaatacataaaatacttta ttcatatttatgtctcatgtatttagatattaatatactcctgcctttca gctttctatttcatttaataattgatgctgaaattcttccatgtaggaca taggatctatctaattctctcgatggctgcttcccagccgtttcgaagga acgtcttatcaactaattcaatccactcc	gaattcatcagaagatatatctcctatttgaaacatccatggagtaatct ccagcgactggtagaagcactctaccaattggaagagttccacagcaatt gggtttcatagacacacatggtcctcttgccttttacccacctatgccac caattttctgaaatgtcattttaactctgaatttggcaagttaattgagt caactgaactgtgatggtaagagtcactaaagacaataagatccattccc actggaaagcacatgctgatcccatgaaaacagttcctgcaaccctgcag ccctaacattgggagcccacatacctccctcaccctgctaagtgttgggg agctttaatgttcaggtgggttttcagctggagaagaaagtctgtgatct tccaattgaggacaaagacctttcattatccagaattgagaggcccagtt cttattacagcaccagagaaagacagtttcaggggcaagctggccacagc tgtatcaaaccctgcaaccatattctctaaaacttagagaccctgaaact gtagttcatatggataaccccaaagctgctaccccagccctagcctcctg gttggaacatctgctggagacccaagacaatgctgagaagatgggcaagt ttctcctagaagaaggtggacagctttcccaagcacatggacaggacttt cttggcttgatggcagacttactatcccttcttacttgttgctgtcttag tcttttctcctcttccttccttacagtcatggatgactttagtgagggtt tctgctctagcagaaaaaaaatcagaacagttactttggctgtgggctag cagtcagacaactttcctggaaaggtaagtgcctcttgggggttctcatc ctgcaaccccaggagaagattgggaagatgtctcagacagtgtagatgtt gctgatgcttgcctttctaggtccactggagtcatcagagcatttccagc tgggagcctgtctatgatgcttgggaaggtgcattgcacacccagagtca cacactgagacctgggtctgtagtccaagttattaacctatgtggaaatt atcgaatagtccatggggtcattcactagcatgcctttt
quality values	Open. Hide. 58 42 18 22 58 42 20 18 36 49 38 31 47 52 47 47 62 54 47 62 49 38 62 56 62 39 62 62 62 62 62 54 49 62 62 49 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 42 49 49 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 54 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 54 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 58 58 58 58 58 54 58 58 58 58 58 58 52 58 58 58 58 58 58 58 43 49 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 52 58 40 58 58 54 52 54 58 52 58 49 45 46 54 54 58 58 58 58 58 54 54 58 54 54 58 54 54 52 47 58 51 49 58 58 51 58 41 58 58 32 58 53 58 45 42 58 58 58 58 58 51 58 51 49 58 58 58 58 53 53 58 58 50 51 49 51 58 47 58 58 51 51 40 58 53 58 58 48 49 51 51 58 39 47 58 54 54 47 58 39 27 39 46 50 58 46 49 50 49 58 54 52 51 52 53 58 50 49 58 52 58 47 28 12 58 38 53 37 50 58 53 53 53 58 51 49 41 58 53 54 53 36 58 58 58 49 40 58 41 52 38 58 21 41 53 58 58 58 58 58 52 49 49 58 58 35 40 54 51 49 54 35 40 42 37 46 41 39 54 54 37 31 41 34 49 54 51 39 45 37 35 44 41 53 49 42 39 50 47 29 28 54 46 54 44 32 33 31 39 39 20 54 46 37 30 34 37 37 49 46 52 42 39 53 32 37 51 45 54 47 49 41 52 37 46 40 30 14 9 10 36 18 31 34 34 54 51 41 37 47 32 52 32 32 52 53 51 31 42 40 53 32 42 32 48 53 20 52 31 45 40 31 35 40 21 40 32 39 52 53 40 36 33 34 31 37 52 45 16 28 17 44 30 24 45 31 51 29 30 30 31 35 12 30 31 45 31 51 30 41 33 29 31 25 14 30 30 34 30 32 29 42 35 42 20 41 31 31 29 51 42 23 34 25 33 26 27 13 48 31 29 27 30 31 38 36 32 31 46 28 31 31 19 46 23 26 31 31 31 23 41 37 6 32 23 41 21 36 32 46 46 44 31 31 31 31 48 39 31 26 32 31 31 31 25 32 46 28 24 31 41 32 31 27 23 24 32 32 23 24 29 46 24 28 24 31 24 31 32 13 9 31 17 26 19 27 35 32 27 24 27 31 29 32 27 48 31 31 18 9 31 33 44 33 31 11 9 29 43 44 19 14 19 44 30 22 28 27 21 26 9 18 30 32 19 28 21 20 30 33 48 28 13 12 21 25 30 19 17 5 20 32 23 26 25 14 33 13 17 21 14 25 43 29 29 22 15 13 21 33 31 30 24 30 22 11 9 11 17 25 9 17 9 23 21 8 16 27 29 29 27 14 22 13 4 5 3 5 6 21 18 6 28 10 11 9 9 7 26 22 16 23 12 6 4 4 4 6 8 9 8 9 19 13 21 13 12 7 5 9 16 24 17 8 6 5 4 10	Open. Hide. 62 47 51 39 62 54 44 62 49 47 32 59 51 34 25 27 43 56 56 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 49 49 62 59 59 62 62 62 59 59 62 54 62 59 62 59 62 62 62 62 62 59 62 42 54 62 62 59 62 62 62 54 54 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 59 62 59 43 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 37 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 58 54 58 58 58 58 58 49 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 54 52 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 46 52 58 58 58 52 58 58 58 52 58 54 58 54 58 58 58 58 51 58 58 49 58 58 49 58 51 58 58 51 53 54 53 58 58 58 46 41 50 49 50 58 58 45 46 58 51 52 58 58 58 58 49 50 51 58 58 51 40 52 58 58 58 49 51 42 58 58 52 53 58 53 58 50 51 49 48 58 49 51 53 52 53 53 58 58 53 51 58 58 58 31 52 39 58 48 42 50 48 39 35 50 58 51 58 53 58 58 39 26 58 46 36 51 41 58 58 50 50 50 58 52 51 49 45 53 53 52 58 41 53 29 58 50 39 51 50 21 49 25 54 49 47 32 32 51 52 54 49 42 39 54 49 21 52 42 52 35 42 39 39 54 38 15 29 35 40 54 32 23 43 54 49 52 42 39 51 47 39 54 40 50 35 39 42 21 21 45 23 52 33 40 53 37 40 37 40 45 37 54 54 47 31 39 33 34 40 34 37 42 49 28 53 43 37 42 46 37 52 26 39 42 24 36 53 29 49 49 36 40 26 39 53 31 42 32 32 35 34 41 26 28 51 29 42 31 37 32 39 34 39 34 33 32 32 20 21 37 29 18 33 51 45 33 25 34 42 38 23 51 46 30 51 30 31 31 36 31 45 43 36 43 22 31 31 23 51 51 51 51 51 46 46 51 31 37 31 14 46 33 26 28 27 25 31 29 31 43 47 41 41 43 31 43 35 29 32 47 42 36 38 31 23 33 36 28 38 38 33 27 33 18 24 19 26 39 48 25 31 33 31 21 31 15 46 9 29 31 12 29 26 20 27 24 21 31 24 30 25 33 37 46 48 46 30 24 32 31 27 26 31 30 23 35 21 31 28 21 22 31 33 28 25 18 21 33 24 13 32 34 18 31 14 30 29 43 31 22 30 23 21 17 37 31 32 35 25 25 11 25 16 5 6 9 21 21 26 27 30 20 33 34 31 15 19 32 32 33 18 31 30 21 33 30 30 14 30 48 32 32 9 16 4 4 16 8 5 4 18 27 21 24 4 8 13 32 24 28 27 7 7 5 13 16 11 24 47 24 17 15 18 27 21 10 18 34 7 10 5 9 14 18 25 14 16 27 31 6 14 24 24 28 15 14 11 10 21 18 17 12 9 12 13 8 25 15 11 13 21 18 7 11 19 24 30 21 12 7 25 30 6 7 5 9 11 9 11 21 15 6 12 6 18 6 15 16 14 8 17 5 12 7 19 4 2 5 12 14 8 12 13 4 11 10 10 9 23 8 7 11 20 5 3 5 15 6 5 5 20 24 14 2 4 5 7 6 4 3 8 2 3 1 1 11 25 10 4 12 11 11 21 5 3 1 5 12 3 5 5 3 11 6 7 7 8 14 10 4 16 17 29 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_94575893_94576971
seq2: B6Ng01-190H24.b_36_1114 (reverse)

seq1  GGAGTGGA-TGAATTAG-TGAT-AGACGTTCC-TCGGAACGGCCTGGGAA  46
      |||||||| |||||||| |||| ||||||||| ||| ||||| |||||||
seq2  GGAGTGGATTGAATTAGTTGATAAGACGTTCCTTCGAAACGG-CTGGGAA  49

seq1  GCAGCCATCGGAGAGAATTAGATAGATCCCTATGTCCTACATGGGAAGAA  96
      ||||||||| ||||||||||||||||| |||||||||||||| |||||||
seq2  GCAGCCATC-GAGAGAATTAGATAGAT-CCTATGTCCTACAT-GGAAGAA  96

seq1  TTTCAGCATCAATTATTAAATGAAAATAGAAAGCTGAAAGGCAGGAGTAT  146
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  TTTCAGCATCAATTATTAAATG-AAATAGAAAGCTGAAAGGCAGGAGTAT  145

seq1  ATTAATATCTAAATACATGAGACATAAATATGAATAAAGTATTTTATGTA  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAATATCTAAATACATGAGACATAAATATGAATAAAGTATTTTATGTA  195

seq1  -TTTATATAAATATGGTGCATAATTTATGTATAAATTATGTATGTATAAT  245
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATATAAATATGGTGCATAATTTATGTATAAATTATGTATGTATAAT  245

seq1  TCACAAACAATTGATACATAACACAAGATGTAATTTACATCTATAATTTA  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAAACAATTGATACATAACACAAGATGTAATTTACATCTATAATTTA  295

seq1  TACATAAGCATGTGTGTTTGTCCCTTGTGTATTTCAGGCTTCAACAGTCT  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATAAGCATGTGTGTTTGTCCCTTGTGTATTTCAGGCTTCAACAGTCT  345

seq1  GGGCATTCAAAGGAAGCTGCACATGAGGATGTACCAGTTGTATTCCATCC  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCATTCAAAGGAAGCTGCACATGAGGATGTACCAGTTGTATTCCATCC  395

seq1  CAGCCCCCATGCCTTCCTTTTTGAGAGTTCCTAGACTACCTCAGAGTGCT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCCCCATGCCTTCCTTTTTGAGAGTTCCTAGACTACCTCAGAGTGCT  445

seq1  GTGGGTTACACTCTCCGGAGTCACTGCCATTGAGGGCATCACGTGAGGGG  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGTTACACTCTCCGGAGTCACTGCCATTGAGGGCATCACGTGAGGGG  495

seq1  ATAGGGAGGTTCTCTCCTCTCATTCTGAAGTCAGTCCATTGGTCTCTGTG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGGAGGTTCTCTCCTCTCATTCTGAAGTCAGTCCATTGGTCTCTGTG  545

seq1  CCATCTTCAAAGGCATCATTGCCAAAGAGTACCCATTGGATGCCAGTGCA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTTCAAAGGCATCATTGCCAAAGAGTACCCATTGGATGCCAGTGCA  595

seq1  TCCAATTTCCTTTTACCACTTTACCTGGACAGGCAGCTGATACCTACACA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAATTTCCTTTTACCACTTTACCTGGACAGGCAGCTGATACCTACACA  645

seq1  TCCCTAAAGCCACTGGAGGCCTGCTAGGCTTCAAACTTAGGGATCCTACC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTAAAGCCACTGGAGGCCTGCTAGGCTTCAAACTTAGGGATCCTACC  695

seq1  CCTTCTAAGCCCAGAAGAAGAAGGGGTTGATCTGTGATCCCCCAGTCACT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCTAAGCCCAGAAGAAGAAGGGGTTGATCTGTGATCCCCCAGTCACT  745

seq1  GTGACACTCAGATGGACATTGTGGGTCTGGTACCATATGAGCGAAGATGC  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACACTCAGATGGACATTGTGGGTCTGGTACCATATGAGCGAAGATGC  795

seq1  CCTTGCCTTTCTGGTCCTGCCTACACTGGACCCCACATAGCTGATGGCAC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGCCTTTCTGGTCCTGCCTACACTGGACCCCACATAGCTGATGGCAC  845

seq1  AGAGCTTGGCCACATAGAGCAGAAAGGCCCCGTGTCCTTCTTCAAAGACT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTTGGCCACATAGAGCAGAAAGGCCCCGTGTCCTTCTTCAAAGACT  895

seq1  TTCCCTTCTGTCCTCTAAACATATGCCACAGTACATAGCCATCCACCCTG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCTTCTGTCCTCTAAACATATGCCACAGTACATAGCCATCCACCCTG  945

seq1  CCTAACGAGGCGGCTCCTGTTCCTCTGCCTGCAGACCTGAGTAGTCCCGT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAACGAGGCGGCTCCTGTTCCTCTGCCTGCAGACCTGAGTAGTCCCGT  995

seq1  ATATTACCAGCTGGGAGTCAGGGGCTTGCCTGGGGAATAGGTAGGGGACA  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTACCAGCTGGGAGTCAGGGGCTTGCCTGGGGAATAGGTAGGGGACA  1045

seq1  GATGTTACTGTGCAGCTTCTACATCAGAGAATTC  1079
      ||||||||||||||||||||||||||||||||||
seq2  GATGTTACTGTGCAGCTTCTACATCAGAGAATTC  1079

seq1: chr1_94404104_94405251
seq2: B6Ng01-190H24.g_63_1201

seq1  GAATTCATCAGAAGATATATCTCCTATTTGAAACATCCATGGAGTAATCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCAGAAGATATATCTCCTATTTGAAACATCCATGGAGTAATCT  50

seq1  CCAGTGACTGGTAGAAGCACTCTACCAATTGGAAGAGTTCCACAGCAATT  100
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCGACTGGTAGAAGCACTCTACCAATTGGAAGAGTTCCACAGCAATT  100

seq1  GGGTTTCATAGACACACATGGTCCTCTTGCCTTTTACCCACCTATGCCAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTTCATAGACACACATGGTCCTCTTGCCTTTTACCCACCTATGCCAC  150

seq1  CAATTTTCTGAAATGTCATTTTAACTCTGAATTTGGCAAGTTAATTGAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTTTCTGAAATGTCATTTTAACTCTGAATTTGGCAAGTTAATTGAGT  200

seq1  CAACTGAACTGTGATGGTAAGAGTCACTAAAGACAATAAGATCCATTCCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGAACTGTGATGGTAAGAGTCACTAAAGACAATAAGATCCATTCCC  250

seq1  ACTGGAAAGCACATGCTGATCCCATGAAAACAGTTCCTGCAACCCTGCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGAAAGCACATGCTGATCCCATGAAAACAGTTCCTGCAACCCTGCAG  300

seq1  CCCTAACATTGGGAGCCCACATACCTCCCTCACCCTGCTAAGTGTTGGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAACATTGGGAGCCCACATACCTCCCTCACCCTGCTAAGTGTTGGGG  350

seq1  AGCTTTAATGTTCAGGTGGGTTTTCAGCTGGAGAAGAAAGTCTGTGATCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTTAATGTTCAGGTGGGTTTTCAGCTGGAGAAGAAAGTCTGTGATCT  400

seq1  TCCAATTGAGGACAAAGACCTTTCATTATCCAGAATTGAGAGGCCCAGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAATTGAGGACAAAGACCTTTCATTATCCAGAATTGAGAGGCCCAGTT  450

seq1  CTTATTACAGCACCAGAGAAAGACAGTTTCAGGGGCAAGCTGGCCACAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATTACAGCACCAGAGAAAGACAGTTTCAGGGGCAAGCTGGCCACAGC  500

seq1  TGTATCAAACCCTGCAACCATATTCTCTAAAACTTAGAGACCCTGAAACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATCAAACCCTGCAACCATATTCTCTAAAACTTAGAGACCCTGAAACT  550

seq1  GTAGTTCATATGGATAACCCCAAAGCTGCTACCCCAGCCCTAGCCTCCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGTTCATATGGATAACCCCAAAGCTGCTACCCCAGCCCTAGCCTCCTG  600

seq1  GTTGGAACATCTGCTGGAGACCCAAGACAATGCTGAGAAGATGGGCAAGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGAACATCTGCTGGAGACCCAAGACAATGCTGAGAAGATGGGCAAGT  650

seq1  TTCTCCTAGAAGAAGGTGGACAGCTTTCCCAAGCACATGGACAGGACTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCCTAGAAGAAGGTGGACAGCTTTCCCAAGCACATGGACAGGACTTT  700

seq1  CTTGGCTTGATGGCAGACTTACTATCCCTTCTTACTTGTTGCTGTCTTAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGCTTGATGGCAGACTTACTATCCCTTCTTACTTGTTGCTGTCTTAG  750

seq1  TCTTTTCTCCTCTTCCTTCCTTACAGTCATGGATGACTTTAGTGAGGGTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTCTCCTCTTCCTTCCTTACAGTCATGGATGACTTTAGTGAGGGTT  800

seq1  TCTGCTCTAGCAGAAAAAAAATCAGAACAGTTACTTTGGCTGTGGGCTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCTCTAGCAGAAAAAAAATCAGAACAGTTACTTTGGCTGTGGGCTAG  850

seq1  CAGTCAGACAACTTTCCTGG-AAGGTAAGTGCCTCTTGGGGGTTCTCATC  899
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  CAGTCAGACAACTTTCCTGGAAAGGTAAGTGCCTCTTGGGGGTTCTCATC  900

seq1  CTGCAACCCCAGGAGAAGATTGGGAAGATGTCTCAGACAGTGTAGATGTT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCAACCCCAGGAGAAGATTGGGAAGATGTCTCAGACAGTGTAGATGTT  950

seq1  GCTGATGCTTGCCTTTCTAAGTTCACTGGAGTCATCAGGAGCATTTCCAG  999
      ||||||||||||||||||| || |||||||||||||| ||||||||||||
seq2  GCTGATGCTTGCCTTTCTAGGTCCACTGGAGTCATCA-GAGCATTTCCAG  999

seq1  CTGGGAGCCTGTCTAATGATGCTTGGGAAAGGTGCATTGCACACCCAGAG  1049
      |||||||||||||| |||||||||||| ||||||||||||||||||||| 
seq2  CTGGGAGCCTGTCT-ATGATGCTTGGG-AAGGTGCATTGCACACCCAGA-  1046

seq1  GTCACACACTGAAGACCTGGGGTCTGTAAGTCCAAGTTATT-ACCTATGT  1098
      ||||||||||| |||||| |||||||| ||||||||||||| ||||||||
seq2  GTCACACACTG-AGACCT-GGGTCTGT-AGTCCAAGTTATTAACCTATGT  1093

seq1  -GAAATTATCAGATTAAATCCATGGTGTCCTTTTCACTAAGCATGGCTTT  1147
       |||||||||  ||  | ||||||| |||   |||||| |||||| ||||
seq2  GGAAATTATCGAAT--AGTCCATGGGGTC--ATTCACT-AGCATGCCTTT  1138

seq1  T  1148
      |
seq2  T  1139

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information