MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-201K09
Chromosome	1 (Build37)
Map Location	182,629,673 - 182,774,259
singlet/doublet	doublet
Overlap gene	LOC666431, Acbd3, H3f3a
Upstream gene	Gm1305, Ahctf1, LOC100040914, LOC100042190, Cdc42bpa, Cabc1, Psen2, EG277333, Itpkb, 6330403A02Rik, Gm821, Parp1, Lin9, Mixl1
Downstream gene	BC031781, Lefty2, Pycr2, Lefty1, Tmem63a, Ephx1, 9130409I23Rik, EG625597, Fgfr3-ps, Nvl, Cnih4, Wdr26, LOC100042363, LOC666519, Cnih3, Ccdc121, A230079K17Rik, Lbr
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm1305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383592 MGI:2686151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Ahctf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226747 MGI:1915033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100042190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 10 Proteins pseudo : _no_value

name	Cdc42bpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 122 ESTs, 12 Proteins

name	Cabc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67426 MGI:1914676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psen2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19165 MGI:109284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG277333 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277333 MGI:3644516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Itpkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320404 MGI:109235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330403A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381310 MGI:2138735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329305 MGI:2685667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Parp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11545 MGI:1340806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lin9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72568 MGI:1919818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mixl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27217 MGI:1351322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 84 ESTs, 2 Proteins pseudo : _no_value

name	Acbd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170760 MGI:2181074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H3f3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15078 MGI:1097686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC031781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208768 MGI:2384788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lefty2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320202 MGI:2443573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pycr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69051 MGI:1277956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lefty1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13590 MGI:107405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem63a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208795 MGI:2384789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ephx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13849 MGI:95405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130409I23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619326 MGI:3588271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625597 MGI:3644763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Fgfr3-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14185 MGI:109607
definition	note : fibroblast growth factor receptor 3, pseudogene pseudo : _no_value

name	Nvl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67459 MGI:1914709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnih4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98417 MGI:1925828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226757 MGI:1923825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 556 ESTs, 5 Proteins

name	LOC666519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 97 ESTs, 3 Proteins pseudo : _no_value

name	Cnih3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72978 MGI:1920228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403180 MGI:2685601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 3 Proteins

name	A230079K17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240960 MGI:2444525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98386 MGI:2138281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245388 GeneID:383592 MGI:2686151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : gene model 1305, (NCBI) transcript_id : XM_357140.6

name	Ahctf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006852 GeneID:226747 MGI:1915033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT hook containing transcription factor 1 transcript_id : NM_026375.1

name	LOC100040914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245392 GeneID:100040914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040914 transcript_id : XM_001475479.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364568 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 116 ESTs, 8 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 16 transcript_id : XM_991276.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364570 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 108 ESTs, 8 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 14 transcript_id : XM_991198.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364572 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 110 ESTs, 10 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 15 transcript_id : XM_991226.1

name	Cdc42bpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364574 GeneID:226751 MGI:2441841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 105 ESTs, 10 Proteins product : Cdc42 binding protein kinase alpha, transcript variant 13 transcript_id : XM_991179.1

name	Cabc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778881 GeneID:67426 MGI:1914676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperone, ABC1 activity of bc1 complex like (S. pombe) transcript_id : NM_023341.2

name	Psen2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755187 GeneID:19165 MGI:109284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : presenilin 2 transcript_id : NM_011183.1

name	Itpkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487166 GeneID:320404 MGI:109235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase B transcript_id : NM_001081175.1

name	6330403A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487002 GeneID:381310 MGI:2138735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330403A02 gene transcript_id : NM_001081227.1

name	Gm821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364582 GeneID:329305 MGI:2685667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 821, (NCBI) transcript_id : XM_287066.3

name	Parp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20806108 GeneID:11545 MGI:1340806
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 1 transcript_id : NM_007415.2

name	Lin9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347560 GeneID:72568 MGI:1919818
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lin-9 homolog (C. elegans) transcript_id : NM_175186.3

name	Mixl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543252 GeneID:27217 MGI:1351322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mix1 homeobox-like 1 (Xenopus laevis) transcript_id : NM_013729.2

name	Acbd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364602 GeneID:170760 MGI:2181074
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 3 transcript_id : NM_133225.2

name	H3f3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385020 GeneID:15078 MGI:1097686
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H3 histone, family 3A transcript_id : NM_008210.3

name	BC031781 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122372 GeneID:208768 MGI:2384788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC031781 transcript_id : NM_145943.1

name	Lefty2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734479 GeneID:320202 MGI:2443573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Left-right determination factor 2 transcript_id : NM_177099.3

name	Pycr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526877 GeneID:69051 MGI:1277956
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrroline-5-carboxylate reductase family, member 2 transcript_id : NM_133705.1

name	Lefty1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012509 GeneID:13590 MGI:107405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : left right determination factor 1 transcript_id : NM_010094.3

name	Tmem63a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892318 GeneID:208795 MGI:2384789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 63a transcript_id : NM_144794.2

name	Ephx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981782 GeneID:13849 MGI:95405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epoxide hydrolase 1, microsomal transcript_id : NM_010145.2

name	9130409I23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352582 GeneID:619326 MGI:3588271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130409I23 gene transcript_id : NM_001033819.2

name	EG625597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82883334 GeneID:625597 MGI:3644763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG625597 transcript_id : XM_890175.1

name	Nvl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468980 GeneID:67459 MGI:1914709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear VCP-like transcript_id : NM_026171.1

name	Cnih4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68226733 GeneID:98417 MGI:1925828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornichon homolog 4 (Drosophila) transcript_id : NM_030131.2

name	Wdr26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649738 GeneID:226757 MGI:1923825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 26 transcript_id : NM_145514.3

name	LOC100042363 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245459 GeneID:100042363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 556 ESTs, 5 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001478698.1

name	Cnih3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364355 GeneID:72978 MGI:1920228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornichon homolog 3 (Drosophila) transcript_id : NM_028408.2

name	Ccdc121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364589 GeneID:403180 MGI:2685601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 3 Proteins product : coiled-coil domain containing 121 transcript_id : XM_619714.3

name	A230079K17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347386 GeneID:240960 MGI:2444525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230079K17 gene transcript_id : NM_172846.2

name	Lbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527033 GeneID:98386 MGI:2138281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lamin B receptor transcript_id : NM_133815.1

name	Gm1305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245389 GeneID:383592 MGI:2686151
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357140.6

name	Ahctf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006853 CCDS:CCDS15564.1 GeneID:226747 MGI:1915033
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : embryonic large molecule derived from yolk sac; putative transcription factor; AT hook containing transciption factor 1 product : transcription factor ELYS protein_id : NP_080651.1

name	LOC100040914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245393 GeneID:100040914
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475529.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364569 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 16 protein_id : XP_996370.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364571 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 14 protein_id : XP_996292.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364573 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 15 protein_id : XP_996320.1

name	Cdc42bpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364575 GeneID:226751 MGI:2441841
definition	codon_start : 1 product : Cdc42 binding protein kinase alpha isoform 13 protein_id : XP_996273.1

name	Cabc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778882 CCDS:CCDS15566.1 GeneID:67426 MGI:1914676
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : chaperone, ABC1 activity of bc1 complex like protein_id : NP_075830.2

name	Psen2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755188 CCDS:CCDS15567.1 GeneID:19165 MGI:109284
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence ISS]; GO:0042640 - anagen [Evidence IGI]; GO:0001708 - cell fate specification [Evidence IGI]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0007220 - Notch receptor processing [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IGI]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS]; GO:0016485 - protein processing [Evidence ISS]; GO:0051605 - proteolysis during protein maturation [Evidence IGI] codon_start : 1 exception : mismatches in translation product : presenilin 2 protein_id : NP_035313.1

name	Itpkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487167 GeneID:320404 MGI:109235
definition	GO_function : GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IDA] [Evidence IEA] [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IMP]; GO:0046638 - positive regulation of alpha-beta T cell differentiation [Evidence IMP]; GO:0046579 - positive regulation of Ras protein signal transduction [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0030217 - T cell differentiation [Evidence IMP]; GO:0045061 - thymic T cell selection [Evidence IMP] codon_start : 1 product : inositol 1,4,5-trisphosphate 3-kinase B protein_id : NP_001074644.1

name	6330403A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487003 GeneID:381310 MGI:2138735
definition	codon_start : 1 product : hypothetical protein LOC381310 protein_id : NP_001074696.1

name	Gm821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28483679 GeneID:329305 MGI:2685667
definition	codon_start : 1 product : hypothetical protein protein_id : XP_287066.1

name	Parp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806109 CCDS:CCDS15569.1 GeneID:11545 MGI:1340806
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IMP]; GO:0006259 - DNA metabolism [Evidence IMP]; GO:0006281 - DNA repair [Evidence TAS]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA]; GO:0040009 - regulation of growth rate [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IMP] codon_start : 1 note : ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) 1; ADP-ribosyltransferase (NAD+, poly (ADP-ribose) polymerase) 1 product : poly (ADP-ribose) polymerase family, member 1 protein_id : NP_031441.2

name	Lin9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424802 CCDS:CCDS15570.1 GeneID:72568 MGI:1919818
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : type I interferon receptor beta chain-associated protein_id : NP_780395.1

name	Mixl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305269 CCDS:CCDS15571.1 GeneID:27217 MGI:1351322
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007492 - endoderm development [Evidence IMP]; GO:0007369 - gastrulation [Evidence IMP]; GO:0048565 - gut development [Evidence IMP]; GO:0007507 - heart development [Evidence IMP] codon_start : 1 note : mouse Mix-like product : Mix1 homeobox-like 1 protein_id : NP_038757.1

name	Acbd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469029 CCDS:CCDS15572.1 GeneID:170760 MGI:2181074
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PBR associated protein; peripherial benzodiazepine receptor associated protein; golgi complex associated protein 1, 60 kDa product : acyl-Coenzyme A binding domain containing 3 protein_id : NP_573488.1

name	H3f3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680159 CCDS:CCDS15573.1 GeneID:15078 MGI:1097686
definition	GO_component : GO:0001740 - Barr body [Evidence IDA]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : H3 histone, family 3A protein_id : NP_032236.1

name	BC031781 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122373 CCDS:CCDS15574.1 GeneID:208768 MGI:2384788
definition	codon_start : 1 product : hypothetical protein LOC208768 protein_id : NP_666055.1

name	Lefty2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893031 CCDS:CCDS15575.1 GeneID:320202 MGI:2443573
definition	codon_start : 1 note : left-right determination, factor A; endometrial bleeding associated factor product : Left-right determination factor 2 protein_id : NP_796073.1

name	Pycr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526878 CCDS:CCDS15576.1 GeneID:69051 MGI:1277956
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : pyrroline-5-carboxylate reductase family, member 2 protein_id : NP_598466.1

name	Lefty1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753702 CCDS:CCDS15577.1 GeneID:13590 MGI:107405
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0009948 - anterior/posterior axis specification [Evidence IGI]; GO:0042074 - cell migration involved in gastrulation [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0008285 - negative regulation of cell proliferation [Evidence IGI] codon_start : 1 note : left-right determination, factor B product : left right determination factor 1 protein_id : NP_034224.1

name	Tmem63a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450147 CCDS:CCDS15578.1 GeneID:208795 MGI:2384789
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : transmembrane protein 63a protein_id : NP_659043.1

name	Ephx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753762 CCDS:CCDS15579.1 GeneID:13849 MGI:95405
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004301 - epoxide hydrolase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0019439 - aromatic compound catabolism [Evidence IEA]; GO:0009636 - response to toxin [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IEA] codon_start : 1 product : epoxide hydrolase 1, microsomal protein_id : NP_034275.1

name	9130409I23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702159 GeneID:619326 MGI:3588271
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA] GO_process : GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC619326 protein_id : NP_001028991.1

name	EG625597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883335 GeneID:625597 MGI:3644763
definition	codon_start : 1 product : similar to fatty acid desaturase protein_id : XP_895268.1

name	Nvl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468981 CCDS:CCDS15581.1 GeneID:67459 MGI:1914709
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : nuclear VCP-like protein_id : NP_080447.1

name	Cnih4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68131553 CCDS:CCDS15582.1 GeneID:98417 MGI:1925828
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : cornichon homolog 4 protein_id : NP_084407.1

name	Wdr26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649739 CCDS:CCDS15583.1 GeneID:226757 MGI:1923825
definition	codon_start : 1 product : WD repeat domain 26 protein_id : NP_663489.3

name	LOC100042363 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245460 GeneID:100042363
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478748.1

name	Cnih3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386310 GeneID:72978 MGI:1920228
definition	codon_start : 1 product : cornichon homolog 3 protein_id : NP_082684.1

name	Ccdc121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63480792 GeneID:403180 MGI:2685601
definition	codon_start : 1 product : coiled-coil domain containing 121 protein_id : XP_619714.1

name	A230079K17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370276 GeneID:240960 MGI:2444525
definition	GO_function : GO:0042624 - ATPase activity, uncoupled [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240960 protein_id : NP_766434.1

name	Lbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527034 CCDS:CCDS15584.1 GeneID:98386 MGI:2138281
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005637 - nuclear inner membrane [Evidence TAS]; GO:0005652 - nuclear lamina [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ichthyosis product : lamin B receptor protein_id : NP_598576.1

name	(CDS detail)
type	STS
link
xref	UniSTS:165125
definition	standard_name : AV011447

name	(CDS detail)
type	STS
link
xref	UniSTS:234277
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165127
definition	standard_name : AI462003

name	(CDS detail)
type	STS
link
xref	UniSTS:234278
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207258
definition	standard_name : AI303601

name	(CDS detail)
type	STS
link
xref	UniSTS:178530
definition	standard_name : AI266870

name	(CDS detail)
type	STS
link
xref	UniSTS:273073
definition	standard_name : PMC317124P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273074
definition	standard_name : PMC317124P3

name	(CDS detail)
type	STS
link
xref	UniSTS:273072
definition	standard_name : PMC317124P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234290
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:222724
definition	standard_name : RH140655

name	(CDS detail)
type	STS
link
xref	UniSTS:119902
definition	standard_name : RH94655

name	(CDS detail)
type	STS
link
xref	UniSTS:128792
definition	standard_name : D1Mit426

name	(CDS detail)
type	STS
link
xref	UniSTS:162083
definition	standard_name : RH125261

name	(CDS detail)
type	STS
link
xref	UniSTS:125553
definition	standard_name : R75555

name	(CDS detail)
type	STS
link
xref	UniSTS:123704
definition	standard_name : 25.MMHAP90FRA10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:162836
definition	standard_name : RH126124

name	(CDS detail)
type	STS
link
xref	UniSTS:207259
definition	standard_name : RH126937

name	(CDS detail)
type	STS
link
xref	UniSTS:178531
definition	standard_name : AI893648

name	(CDS detail)
type	STS
link
xref	UniSTS:123546
definition	standard_name : 21.MMHAP97FRG9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234279
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161144
definition	standard_name : RH124322

name	(CDS detail)
type	STS
link
xref	UniSTS:234289
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161370
definition	standard_name : RH124548

name	(CDS detail)
type	STS
link
xref	UniSTS:162671
definition	standard_name : RH125959

name	(CDS detail)
type	STS
link
xref	UniSTS:250338
definition	standard_name : AI234525

name	(CDS detail)
type	STS
link
xref	UniSTS:207261
definition	standard_name : C76375

name	(CDS detail)
type	STS
link
xref	UniSTS:128878
definition	standard_name : D1Mit509

name	(CDS detail)
type	STS
link
xref	UniSTS:234283
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234288
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234282
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207260
definition	standard_name : BB380616

name	(CDS detail)
type	STS
link
xref	UniSTS:165126
definition	standard_name : AV214969

name	(CDS detail)
type	STS
link
xref	UniSTS:165126
definition	standard_name : AV214969

name	(CDS detail)
type	STS
link
xref	UniSTS:234280
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158899
definition	standard_name : AI450052

name	(CDS detail)
type	STS
link
xref	UniSTS:125940
definition	standard_name : Z73151

name	(CDS detail)
type	STS
link
xref	UniSTS:268295
definition	standard_name : MARC_17431-17432:1022875841:6

name	(CDS detail)
type	STS
link
xref	UniSTS:234291
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:185460
definition	standard_name : AI195553

name	(CDS detail)
type	STS
link
xref	UniSTS:142997
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:186694
definition	standard_name : Ephx1

name	(CDS detail)
type	STS
link
xref	UniSTS:273684
definition	standard_name : PMC99591P2

name	(CDS detail)
type	STS
link
xref	UniSTS:278342
definition	standard_name : EPHX1

name	(CDS detail)
type	STS
link
xref	UniSTS:128489
definition	standard_name : D1Mit151

name	(CDS detail)
type	STS
link
xref	UniSTS:178547
definition	standard_name : AI647760

name	(CDS detail)
type	STS
link
xref	UniSTS:178532
definition	standard_name : AW050376

name	(CDS detail)
type	STS
link
xref	UniSTS:158898
definition	standard_name : AU044014

name	(CDS detail)
type	STS
link
xref	UniSTS:234284
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158904
definition	standard_name : AI447817

name	(CDS detail)
type	STS
link
xref	UniSTS:162994
definition	standard_name : RH126286

name	(CDS detail)
type	STS
link
xref	UniSTS:124158
definition	standard_name : 35.MMHAP85FLD5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:209715
definition	standard_name : RH126601

name	(CDS detail)
type	STS
link
xref	UniSTS:128911
definition	standard_name : D1Mit542

name	(CDS detail)
type	STS
link
xref	UniSTS:125435
definition	standard_name : MHAa88e6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234293
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128622
definition	standard_name : D1Mit273

name	(CDS detail)
type	STS
link
xref	UniSTS:123519
definition	standard_name : 21.MMHAP34FRG9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128891
definition	standard_name : D1Mit525

name	(CDS detail)
type	STS
link
xref	UniSTS:128891
definition	standard_name : D1Mit525

name	(CDS detail)
type	STS
link
xref	UniSTS:178546
definition	standard_name : AI505894

name	LOC100042190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245447 GeneID:100042190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033682.1

name	EG277333 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149245210 GeneID:277333 MGI:3644516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG277333 pseudo : _no_value transcript_id : XR_035074.1

name	LOC666431 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245456 GeneID:666431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 84 ESTs, 2 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033759.1

name	LOC666519 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245405 GeneID:666519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 97 ESTs, 3 Proteins product : similar to 2310022K01Rik protein pseudo : _no_value transcript_id : XR_032406.1

clone name	MSMg01-487D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-170H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-049L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-201K09.b	B6Ng01-201K09.g
ACC	GA022365	GA022366
length	393	1,095
definition	B6Ng01-201K09.b	B6Ng01-201K09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(182,629,673 - 182,630,071)	(182,773,184 - 182,774,259)
sequence	ttcaacctgctacgtggaaatcctcccgggtcctttgtccatcactgtcc tctgccaccttctgtctgccccagaagaaccctacagggcagggaaacgg actgagggaaataatggcaggctgtgtacacagctggggctgtgtgtggc cagaaatcatagtgcaatttgtgatctgagaatcctctaatccaaccaac aggcatcatttttaaaaaccatttccttcagatttgtcccatattgtaat atgtattgaacaagagctcagaaactctcatcctctcttccttttgccct aaatttagcttttcttattctaccccctctctgtctctatatctctgtct gtttgtgggtctcttcctccaccccatctgtgtgtgtgtgtgt	gaattctctatgtagaccaggctggcctcaaactgggaataaagggtgtg ctccaccacacctggcatccttagaggttctatgttttgtctttggtatc tcacgtaaggacttaatagtccatttgcttctctagtttgaggtaaagat tcaactttggagggataggagtgggtttgctgctgtctttttttttttgt tttggtttttttttgttgttgtttttgtttttcgagacagggtttctctt tatagccctggctgtcctggaactcactttgtagaccaggctggcctcaa actcagaaatccgcctgcctctgtctctgcctcccgagtgctgggattaa aggcgtgtgccaccacgcccggcttgctgttgtcttttgagacagggttt ctgtgtagccccagtcattctggaacttgtgctgtagaccaggctgacct cgaactcacagagatccacttgcctctgcatccgctctgcatcctgagtg gtgggattaaaggcatgcaacaccatcacctggcttgatagtctactttt ttccccctaagatttatttattgttatttgtaagtacactgtatctgtct tcagatagactctatctgaagacacaccagaagagaacatcagatctcat tatggatgtttgtgaaccaccatgtggttgctggggatttgaactcagga cctttggaagagcagtcagtgctcttaaaccgctgagccatgtctccagc cctgacatttctagtcttgtactttttcacatagacattgatgttctctt acagtactctctttttcttcactggctctgatgctaccactgatgtaaat gccagcaaggtccttctatggcactctgccccccaccccccaccccatca gcttgcagctcagagaacaactttcagtgttttatcctccctctttttta gtagattcagctagcaatgtcctttccttgggtctttacaagccgttctt ctctcccttgaatctagcaataaacaaggtcatatactatcaatgaggtt gaaagtgtgtgtggcttcgtggcagagtgaacccttactcccgtg
quality values	Open. Hide. 62 62 31 24 36 62 62 62 62 62 54 56 62 62 62 62 62 47 62 42 47 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 59 36 62 62 62 59 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 59 59 62 62 59 62 62 59 59 62 59 59 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 42 54 62 54 43 49 54 54 59 59 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 31	Open. Hide. 62 47 51 47 62 62 62 62 47 56 62 62 59 59 56 44 59 44 46 59 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 35 59 50 54 50 49 59 62 59 62 59 51 50 45 32 50 50 56 59 59 59 59 62 62 62 62 62 62 59 62 62 56 59 59 59 62 51 59 59 59 62 62 59 59 62 62 62 62 49 48 36 56 59 46 54 56 62 59 59 62 62 50 59 59 62 56 56 56 59 59 59 51 34 62 59 56 56 56 56 51 56 59 59 62 59 59 62 59 59 54 46 56 59 59 59 59 56 59 59 59 62 62 51 62 54 46 62 59 59 62 62 59 59 59 62 62 62 62 49 62 59 62 62 62 62 62 62 62 59 62 62 45 59 45 56 56 59 59 62 56 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 59 59 56 50 34 34 50 59 62 59 62 59 59 50 59 62 62 59 51 38 44 59 45 59 62 56 56 62 62 62 62 62 56 56 62 50 62 56 56 56 51 56 35 54 51 47 56 56 56 62 56 62 62 51 56 56 56 42 51 56 38 62 62 56 62 56 40 49 43 47 47 56 47 56 62 56 62 62 56 56 56 56 56 62 62 56 62 56 56 56 56 62 56 62 62 56 56 62 54 62 62 62 47 47 62 62 62 56 62 62 62 47 25 54 56 56 56 56 62 56 56 56 62 56 47 56 46 46 39 41 39 56 54 42 52 52 52 47 54 52 62 48 62 62 50 42 31 22 43 39 54 48 52 62 52 62 62 54 54 62 52 52 54 47 52 48 43 62 33 62 47 52 48 58 54 54 58 58 58 42 46 46 58 58 58 58 35 42 58 46 54 52 54 52 45 54 54 41 54 52 49 54 58 54 54 54 54 50 42 52 54 52 52 32 58 37 54 46 35 37 52 54 58 52 54 41 40 54 33 22 52 35 28 22 40 27 58 54 31 58 32 54 52 27 33 54 52 52 50 58 42 52 54 46 34 34 58 30 23 43 49 51 50 49 32 58 58 51 40 50 54 47 33 37 40 50 34 35 32 47 26 38 45 13 28 50 40 47 42 51 54 10 46 23 58 47 50 51 50 32 34 36 41 22 44 37 16 21 18 42 34 34 49 44 37 28 58 13 50 32 16 20 19 21 19 37 58 37 48 36 26 39 13 54 11 40 29 32 41 58 50 51 10 6 5 6 10 18 28 32 53 35 32 25 32 28 37 21 23 40 38 23 32 28 58 25 33 31 52 41 40 32 52 47 53 20 23 27 12 54 54 54 13 29 23 37 21 49 38 13 39 32 51 6 11 30 51 26 38 33 33 33 26 16 6 14 29 29 17 34 25 34 32 45 34 34 52 32 54 54 37 23 30 28 31 39 24 32 40 38 51 33 38 37 40 32 42 23 38 32 34 30 31 25 9 12 25 31 22 14 21 28 24 47 23 30 40 26 40 27 23 31 27 18 30 32 18 52 30 32 32 30 15 17 34 40 32 11 20 23 34 31 28 32 16 31 31 31 30 29 23 31 37 45 31 37 22 18 25 30 37 38 30 12 9 31 31 25 26 24 25 9 28 13 15 23 13 27 9 36 12 31 23 7 9 9 15 7 26 16 12 16 12 8 30 38 48 46 8 18 11 5 4 6 14 31 22 13 9 16 46 46 46 37 29 29 21 12 19 6 31 25 21 26 22 25 43 30 31 21 14 37 25 20 27 9 9 27 22 33 11 42 20 17 18 29 31 10 6 10 11 38 24 8 7 6 31 16 11 12 24 33 11 22 7 7 36 8 7 9 24 22 26 8 18 31 11 16 19 21 31 11 10 18 22 9 6 8 22 8 7 9 8 24 9 12 25 16 9 26 5 14 14 16 10 32 7 6 7 10 18 16 10 14 4 12 22 19 31 14 22 11 23 7 7 8 8 6 15 26 6 12 9 31 7 5 26 7 6 6 6 14 5 8 23 7 8 15 26 21 8 10 5 19 7 28 22 9 4 5 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_182629673_182630071
seq2: B6Ng01-201K09.b_43_441

seq1  GAATTCTTCAACCTGCTACGTGGAAATCCTCCCGGGTCCTTTGTCCATCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCAACCTGCTACGTGGAAATCCTCCCGGGTCCTTTGTCCATCA  50

seq1  CTGTCCTCTGCCACCTTCTGTCTGCCCCAGAAGAACCCTACAGGGCAGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCCTCTGCCACCTTCTGTCTGCCCCAGAAGAACCCTACAGGGCAGGG  100

seq1  AAACGGACTGAGGGAAATAATGGCAGGCTGTGTACACAGCTGGGGCTGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGGACTGAGGGAAATAATGGCAGGCTGTGTACACAGCTGGGGCTGTG  150

seq1  TGTGGCCAGAAATCATAGTGCAATTTGTGATCTGAGAATCCTCTAATCCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGCCAGAAATCATAGTGCAATTTGTGATCTGAGAATCCTCTAATCCA  200

seq1  ACCAACAGGCATCATTTTTAAAAACCATTTCCTTCAGATTTGTCCCATAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAACAGGCATCATTTTTAAAAACCATTTCCTTCAGATTTGTCCCATAT  250

seq1  TGTAATATGTATTGAACAAGAGCTCAGAAACTCTCATCCTCTCTTCCTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAATATGTATTGAACAAGAGCTCAGAAACTCTCATCCTCTCTTCCTTT  300

seq1  TGCCCTAAATTTAGCTTTTCTTATTCTACCCCCTCTCTGTCTCTATATCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCTAAATTTAGCTTTTCTTATTCTACCCCCTCTCTGTCTCTATATCT  350

seq1  CTGTCTGTTTGTGGGTCTCTTCCTCCACCCCATCTGTGTGTGTGTGTGT  399
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTGTTTGTGGGTCTCTTCCTCCACCCCATCTGTGTGTGTGTGTGT  399

seq1: chr1_182773184_182774259
seq2: B6Ng01-201K09.g_64_1158 (reverse)

seq1  CACGGGGGTA--GGGTCACTCTGCCACGGAGCCACACAC---TTCAGCCT  45
      |||||| |||  || ||||||||||||| ||||||||||   |||| |||
seq2  CACGGGAGTAAGGGTTCACTCTGCCACGAAGCCACACACACTTTCAACCT  50

seq1  CA-TGATAGT-TTTGACC-TGTTTATTGCTAAGATCAAGG--GAGGAGAA  90
      || ||||||| | ||||| ||||||||||||   ||||||  ||| ||||
seq2  CATTGATAGTATATGACCTTGTTTATTGCTAGATTCAAGGGAGAGAAGAA  100

seq1  C-GCTTGTAAAAGACCAAGG-AAGGACATTGCTAGCTGAATCTACTAAAA  138
      | |||||||||   |||||| |||||||||||||||||||||||||||||
seq2  CGGCTTGTAAAGACCCAAGGAAAGGACATTGCTAGCTGAATCTACTAAAA  150

seq1  AAGAGGGAGATTAAAACACTGAA--GTGTTCTCTGAGCTGCAAGCTGATG  186
      |||||||||  ||||||||||||   ||||||||||||||||||||||||
seq2  AAGAGGGAGGATAAAACACTGAAAGTTGTTCTCTGAGCTGCAAGCTGATG  200

seq1  GGGTGGGGGGTGGGGGGCAGAGTGCCATAGAAGGACCTTGCTGGCATTTA  236
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGGGGGGTGGGGGGCAGAGTGCCATAGAAGGACCTTGCTGGCATTTA  250

seq1  CATCAGTGGTAGCATCAGAGCCAGTGAAGAAAAAGAGAGTACTGT-AGAG  285
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CATCAGTGGTAGCATCAGAGCCAGTGAAGAAAAAGAGAGTACTGTAAGAG  300

seq1  AACATCATTGTCTATGTG-AAAAGTACAAGACTAG-AATGTCAGGGCTGG  333
      ||||||| |||||||||| |||||||||||||||| ||||||||||||||
seq2  AACATCAATGTCTATGTGAAAAAGTACAAGACTAGAAATGTCAGGGCTGG  350

seq1  AGACATGGCTCAGCGG-TTAAGAGCACTGACTGCTCTTCCAAAGGTCCTG  382
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  AGACATGGCTCAGCGGTTTAAGAGCACTGACTGCTCTTCCAAAGGTCCTG  400

seq1  AGTTCAAAT-CCCAGCAACCACATGGTGGTTCACAAACATCCATAATGAG  431
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAAATCCCCAGCAACCACATGGTGGTTCACAAACATCCATAATGAG  450

seq1  ATCTGATGTTCTCTTCTGGTGTGTCTTCAGATAGAGTCTATCTGAAGACA  481
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGATGTTCTCTTCTGGTGTGTCTTCAGATAGAGTCTATCTGAAGACA  500

seq1  GATACAGTGTACTTACAAATAACAATAAATAAATCTTAGGGGGAAAAAAG  531
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATACAGTGTACTTACAAATAACAATAAATAAATCTTAGGGGGAAAAAAG  550

seq1  TAGACTATCAAGCCAGGTGATGGTGTTGCATGCCTTTAATCCCACCACTC  581
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACTATCAAGCCAGGTGATGGTGTTGCATGCCTTTAATCCCACCACTC  600

seq1  AGGATGCAGAGCGGATGCAGAGGCAAGTGGATCTCTGTGAGTTCGAGGTC  631
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGCAGAGCGGATGCAGAGGCAAGTGGATCTCTGTGAGTTCGAGGTC  650

seq1  AGCCTGGTCTACAGCACAAGTTCCAGAATGACTGGGGCTACACAGAAACC  681
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGGTCTACAGCACAAGTTCCAGAATGACTGGGGCTACACAGAAACC  700

seq1  CTGTCTCAAAAGACAACAGCAAGCCGGGCGTGGTGGCACACGCCTTTAAT  731
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTCAAAAGACAACAGCAAGCCGGGCGTGGTGGCACACGCCTTTAAT  750

seq1  CCCAGCACTCGGGAGGCAGAGACAGAGGCAGGCGGATTTCTGAGTTTGAG  781
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCACTCGGGAGGCAGAGACAGAGGCAGGCGGATTTCTGAGTTTGAG  800

seq1  GCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATAAAGAG  831
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATAAAGAG  850

seq1  AAACCCTGTCTCGAAAAACAAAAACAACAACAAAAAAAAACCAAAACAAA  881
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCCTGTCTCGAAAAACAAAAACAACAACAAAAAAAAACCAAAACAAA  900

seq1  AAAAAAAAGACAGCAGCAAACCCACTCCTATCCCTCCAAAGTTGAATCTT  931
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAGACAGCAGCAAACCCACTCCTATCCCTCCAAAGTTGAATCTT  950

seq1  TACCTCAAACTAGAGAAGCAAATGGACTATTAAGTCCTTACGTGAGATAC  981
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTCAAACTAGAGAAGCAAATGGACTATTAAGTCCTTACGTGAGATAC  1000

seq1  CAAAGACAAAACATAGAACCTCTAAGGATGCCAGGTGTGGTGGAGCACAC  1031
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGACAAAACATAGAACCTCTAAGGATGCCAGGTGTGGTGGAGCACAC  1050

seq1  CCTTTATTCCCAGTTTGAGGCCAGCCTGGTCTACATAGAGAATTC  1076
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTATTCCCAGTTTGAGGCCAGCCTGGTCTACATAGAGAATTC  1095

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information