MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-263J09
Chromosome	1 (Build37)
Map Location	73,976,126 - 74,102,702
singlet/doublet	doublet
Overlap gene	Tns1
Upstream gene	LOC672187, LOC100042860, Tnp1, 1700027A15Rik, Pinc, LOC672208, LOC100043291
Downstream gene	Rufy4, Il8rb, Il8ra, Arpc2, Gpbar1, Aamp, Pnkd, Tmbim1, 2410125D13Rik, Gm216, Slc11a1, Ctdsp1, Vil1, Usp37, Rqcd1, Plcd4, Zfp142, Bcs1l, Rnf25, Stk36, Ttll4, Cyp27a1, Prkag3, Wnt6, Wnt10a, LOC100042901, Cdk5r2, Fev, Cryba2, Ccdc108, Ihh, Nhej1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC672187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100042860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tnp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21958 MGI:98784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69449 MGI:1916699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs

name	Pinc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:723792 MGI:3623820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Tns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21961 MGI:104552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 258 ESTs, 2 Proteins

name	Rufy4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435626 MGI:3588214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il8rb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12765 MGI:105303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il8ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227288 MGI:2448715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76709 MGI:1923959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpbar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227289 MGI:2653863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aamp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227290 MGI:107809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnkd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Tmbim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69660 MGI:1916910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410125D13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73709 MGI:1920959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Gm216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241112 MGI:2685062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc11a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18173 MGI:1345275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctdsp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227292 MGI:2654470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22349 MGI:98930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319651 MGI:2442483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rqcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58184 MGI:1928902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18802 MGI:107469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77264 MGI:1924514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcs1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66821 MGI:1914071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57751 MGI:1890215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269209 MGI:1920831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67534 MGI:1914784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp27a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104086 MGI:88594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241113 MGI:1891343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wnt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22420 MGI:98960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22409 MGI:108071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Cdk5r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12570 MGI:1330828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fev (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260298 MGI:2449712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryba2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12958 MGI:104336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241116 MGI:2444274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ihh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16147 MGI:96533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nhej1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75570 MGI:1922820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233890 GeneID:100042860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042860 transcript_id : XM_001478941.1

name	Tnp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678394 GeneID:21958 MGI:98784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transition protein 1 transcript_id : NM_009407.1

name	1700027A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363484 GeneID:69449 MGI:1916699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs product : RIKEN cDNA 1700027A15 gene transcript_id : XM_993673.1

name	LOC100043291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233930 GeneID:100043291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043291 transcript_id : XM_001480012.1

name	Tns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363486 GeneID:21961 MGI:104552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 258 ESTs, 2 Proteins product : tensin 1 transcript_id : XM_619639.3

name	Rufy4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364398 GeneID:435626 MGI:3588214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 4 transcript_id : NM_001034060.2

name	Il8rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299639 GeneID:12765 MGI:105303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 8 receptor, beta transcript_id : NM_009909.3

name	Il8ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665720 GeneID:227288 MGI:2448715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 8 receptor, alpha transcript_id : NM_178241.4

name	Arpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363071 GeneID:76709 MGI:1923959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 2 transcript_id : NM_029711.1

name	Gpbar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27923942 GeneID:227289 MGI:2653863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled bile acid receptor 1 transcript_id : NM_174985.1

name	Aamp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82524293 GeneID:227290 MGI:107809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angio-associated migratory protein transcript_id : NM_146110.2

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239983 GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_001039509.1

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239987 GeneID:56695 MGI:1930773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_025580.2

name	Tmbim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349627 GeneID:69660 MGI:1916910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane BAX inhibitor motif containing 1 transcript_id : NM_027154.4

name	2410125D13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149233932 GeneID:73709 MGI:1920959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2410125D13 gene transcript_id : XM_001480060.1

name	Pnkd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239998 GeneID:56695 MGI:1930773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paroxysmal nonkinesiogenic dyskinesia transcript_id : NM_019999.2

name	Gm216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803113 GeneID:241112 MGI:2685062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 216, (NCBI) transcript_id : NM_001033345.2

name	Slc11a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7363450 GeneID:18173 MGI:1345275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 transcript_id : NM_013612.1

name	Ctdsp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346508 GeneID:227292 MGI:2654470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 transcript_id : NM_153088.1

name	Vil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678572 GeneID:22349 MGI:98930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : villin 1 transcript_id : NM_009509.1

name	Usp37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367967 GeneID:319651 MGI:2442483
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 37 transcript_id : NM_176972.3

name	Rqcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543606 GeneID:58184 MGI:1928902
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rcd1 (required for cell differentiation) homolog 1 (S. pombe) transcript_id : NM_021383.3

name	Plcd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347157 GeneID:18802 MGI:107469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 4 transcript_id : NM_001081456.1

name	Plcd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347170 GeneID:18802 MGI:107469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, delta 4 transcript_id : NM_148937.2

name	Zfp142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801887 GeneID:77264 MGI:1924514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 142 transcript_id : NM_029888.2

name	Bcs1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344956 GeneID:66821 MGI:1914071
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCS1-like (yeast) transcript_id : NM_025784.3

name	Rnf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946615 GeneID:57751 MGI:1890215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 25 transcript_id : NM_021313.1

name	Stk36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846120 GeneID:269209 MGI:1920831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 36 (fused homolog, Drosophila) transcript_id : NM_175031.3

name	Ttll4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62510078 GeneID:67534 MGI:1914784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 4 transcript_id : NM_001014974.1

name	Cyp27a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367423 GeneID:104086 MGI:88594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 27, subfamily a, polypeptide 1 transcript_id : NM_024264.4

name	Prkag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24371222 GeneID:241113 MGI:1891343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit transcript_id : NM_153744.1

name	Prkag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130072 GeneID:241113 MGI:1891343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit transcript_id : NM_153745.2

name	Wnt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672921 GeneID:22420 MGI:98960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 6 transcript_id : NM_009526.3

name	Wnt10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678586 GeneID:22409 MGI:108071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless related MMTV integration site 10a transcript_id : NM_009518.1

name	LOC100042901 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149233897 GeneID:100042901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Nucleolar, serine-rich protein with a role in preribosome assembly or transport; may function as a chaperone of small nucleolar ribonucleoprotein particles (snoRNPs); immunologically and structurally to rat Nopp140 transcript_id : XM_001479026.1

name	Cdk5r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116875853 GeneID:12570 MGI:1330828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 5, regulatory subunit 2 (p39) transcript_id : NM_009872.2

name	Fev (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346544 GeneID:260298 MGI:2449712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FEV (ETS oncogene family) transcript_id : NM_153111.1

name	Cryba2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892777 GeneID:12958 MGI:104336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta A2 transcript_id : NM_021541.2

name	Ccdc108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87162475 GeneID:241116 MGI:2444274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 108 transcript_id : NM_001039495.1

name	Ihh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981670 GeneID:16147 MGI:96533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Indian hedgehog transcript_id : NM_010544.2

name	Nhej1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244080 GeneID:75570 MGI:1922820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nonhomologous end-joining factor 1 transcript_id : NM_029342.3

name	LOC100042860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233891 GeneID:100042860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478991.1

name	Tnp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678395 GeneID:21958 MGI:98784
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0001673 - male germ cell nucleus [Evidence TAS]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence ISS]; GO:0006342 - chromatin silencing [Evidence ISS]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0035042 - fertilization, exchange of chromosomal proteins [Evidence ISS]; GO:0006337 - nucleosome disassembly [Evidence ISS]; GO:0019953 - sexual reproduction [Evidence ISS]; GO:0000012 - single strand break repair [Evidence ISS]; GO:0030317 - sperm motility [Evidence ISS]; GO:0007290 - spermatid nuclear elongation [Evidence ISS]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 product : transition protein 1 protein_id : NP_033433.1

name	1700027A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363485 GeneID:69449 MGI:1916699
definition	codon_start : 1 product : hypothetical protein LOC69449 protein_id : XP_998767.1

name	LOC100043291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233931 GeneID:100043291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480062.1

name	Tns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363487 GeneID:21961 MGI:104552
definition	codon_start : 1 product : tensin 1 protein_id : XP_619639.3

name	Rufy4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702191 CCDS:CCDS15039.1 GeneID:435626 MGI:3588214
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RUN and FYVE domain containing 4 protein_id : NP_001029232.1

name	Il8rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753456 CCDS:CCDS15040.1 GeneID:12765 MGI:105303
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004950 - chemokine receptor activity [Evidence TAS] [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004918 - interleukin-8 receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006935 - chemotaxis [Evidence TAS]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : IL-8 receptor alpha chain; interleukin-8 receptor type B; chemokine (C-X-C) receptor 2 product : interleukin 8 receptor beta protein_id : NP_034039.1

name	Il8ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142679 CCDS:CCDS15041.1 GeneID:227288 MGI:2448715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004918 - interleukin-8 receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CXC chemokine receptor 1-like product : interleukin 8 receptor, alpha protein_id : NP_839972.1

name	Arpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363072 GeneID:76709 MGI:1923959
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030833 - regulation of actin filament polymerization [Evidence IEA] codon_start : 1 note : actin related protein 2/3 complex, subunit 2 (34 kDa) product : actin related protein 2/3 complex, subunit 2 protein_id : NP_083987.1

name	Gpbar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923943 CCDS:CCDS15042.1 GeneID:227289 MGI:2653863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor TGR5; membrane bile acid receptor product : G protein-coupled bile acid receptor 1 protein_id : NP_778150.1

name	Aamp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82524294 CCDS:CCDS15043.1 GeneID:227290 MGI:107809
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : angio-associated migratory protein protein_id : NP_666222.2

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239984 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 3 protein_id : NP_001034598.1

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239988 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 2 protein_id : NP_079856.2

name	Tmbim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980814 CCDS:CCDS15044.1 GeneID:69660 MGI:1916910
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : transmembrane BAX inhibitor motif containing 1 protein_id : NP_081430.2

name	2410125D13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149233933 GeneID:73709 MGI:1920959
definition	codon_start : 1 product : hypothetical protein LOC73709 protein_id : XP_001480110.1

name	Pnkd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910442 CCDS:CCDS15045.1 GeneID:56695 MGI:1930773
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; trans-activated by hepatitis C virus core protein 2; myofibrillogenesis regulator 1; brain protein 17 product : brain protein 17 isoform 1 protein_id : NP_064383.1

name	Gm216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701842 CCDS:CCDS15046.1 GeneID:241112 MGI:2685062
definition	codon_start : 1 product : hypothetical protein LOC241112 protein_id : NP_001028517.1

name	Slc11a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7363451 CCDS:CCDS15047.1 GeneID:18173 MGI:1345275
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : natural resistance-associated macrophage protein 1; host resistance locus Bcg/Ity/Lsh product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 protein_id : NP_038640.1

name	Ctdsp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346509 CCDS:CCDS15048.1 GeneID:227292 MGI:2654470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] codon_start : 1 note : nuclear LIM interactor-interacting factor 3; NLI-interacting factor 3; golli-interacting protein product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 protein_id : NP_694728.1

name	Vil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678573 CCDS:CCDS15049.1 GeneID:22349 MGI:98930
definition	GO_component : GO:0005903 - brush border [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : villin 1 protein_id : NP_033535.1

name	Usp37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892803 CCDS:CCDS15050.1 GeneID:319651 MGI:2442483
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 37 protein_id : NP_795946.1

name	Rqcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946722 GeneID:58184 MGI:1928902
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA] codon_start : 1 product : rcd1 (required for cell differentiation) homolog 1 protein_id : NP_067358.1

name	Plcd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347171 GeneID:18802 MGI:107469
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0004629 - phospholipase C activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence IMP]; GO:0030384 - phosphoinositide metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : phospholipase C, delta 4 isoform 2 protein_id : NP_683739.2

name	Plcd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347158 GeneID:18802 MGI:107469
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0004629 - phospholipase C activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence IMP]; GO:0030384 - phosphoinositide metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : phospholipase C, delta 4 isoform 1 protein_id : NP_001074925.1

name	Zfp142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626083 GeneID:77264 MGI:1924514
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 142 protein_id : NP_084164.1

name	Bcs1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313544 CCDS:CCDS15051.1 GeneID:66821 MGI:1914071
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : BCS1-like protein_id : NP_080060.1

name	Rnf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946616 CCDS:CCDS15052.1 GeneID:57751 MGI:1890215
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation function : associated with ubiquitin conjugating enzyme note : RING finger protein AO7 product : ring finger protein 25 protein_id : NP_067288.1

name	Stk36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846121 GeneID:269209 MGI:1920831
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009791 - post-embryonic development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0051090 - regulation of transcription factor activity [Evidence ISS] codon_start : 1 product : serine/threonine kinase 36 protein_id : NP_778196.2

name	Ttll4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62510079 CCDS:CCDS15053.1 GeneID:67534 MGI:1914784
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : polyglutamylase product : tubulin tyrosine ligase-like family, member 4 protein_id : NP_001014974.1

name	Cyp27a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30578401 CCDS:CCDS15054.1 GeneID:104086 MGI:88594
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0047749 - cholestanetriol 26-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, 27; cholesterol 27 hydroxylase; cytochrome P450, 27a1 product : cytochrome P450, family 27, subfamily a, polypeptide 1 protein_id : NP_077226.2

name	Prkag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371223 CCDS:CCDS15055.1 GeneID:241113 MGI:1891343
definition	GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0015758 - glucose transport [Evidence IMP]; GO:0005978 - glycogen biosynthesis [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : long isoform is encoded by transcript variant 1; AMP-activated protein kinase gamma 3; AMP-activated protein kinase gamma subunit product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit long isoform protein_id : NP_714966.1

name	Prkag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371227 GeneID:241113 MGI:1891343
definition	GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0015758 - glucose transport [Evidence IMP]; GO:0005978 - glycogen biosynthesis [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : short isoform is encoded by transcript variant 2; AMP-activated protein kinase gamma 3; AMP-activated protein kinase gamma subunit product : protein kinase, AMP-activated, gamma 3 non-catatlytic subunit short isoform protein_id : NP_714967.1

name	Wnt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328158 CCDS:CCDS15056.1 GeneID:22420 MGI:98960
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless-related MMTV integration site 6 protein_id : NP_033552.2

name	Wnt10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678587 CCDS:CCDS15057.1 GeneID:22409 MGI:108071
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless related MMTV integration site 10a protein_id : NP_033544.1

name	LOC100042901 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149233898 GeneID:100042901
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479076.1

name	Cdk5r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116875854 GeneID:12570 MGI:1330828
definition	GO_component : GO:0016533 - cyclin-dependent protein kinase 5 activator complex [Evidence IEA] GO_function : GO:0016534 - cyclin-dependent protein kinase 5 activator activity [Evidence TAS]; GO:0008092 - cytoskeletal protein binding [Evidence TAS] codon_start : 1 product : cyclin-dependent kinase 5, regulatory subunit 2 protein_id : NP_034002.2

name	Fev (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346545 CCDS:CCDS15058.1 GeneID:260298 MGI:2449712
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : ETS-domain transcription factor Pet-1; FEV (fifth Ewing variant) product : FEV (ETS oncogene family) protein_id : NP_694751.1

name	Cryba2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946978 CCDS:CCDS15059.1 GeneID:12958 MGI:104336
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0005212 - structural constituent of eye lens [Evidence TAS] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 note : betaA2-crystallin; lens structural protein product : crystallin, beta A2 protein_id : NP_067516.1

name	Ccdc108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87162476 CCDS:CCDS15060.1 GeneID:241116 MGI:2444274
definition	codon_start : 1 product : hypothetical protein LOC241116 protein_id : NP_001034584.1

name	Ihh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149643 CCDS:CCDS15061.1 GeneID:16147 MGI:96533
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0048469 - cell maturation [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0016539 - intein-mediated protein splicing [Evidence IEA]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0001649 - osteoblast differentiation [Evidence IMP]; GO:0007389 - pattern specification [Evidence IEA]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : Indian hedgehog protein_id : NP_034674.1

name	Nhej1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244081 GeneID:75570 MGI:1922820
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : nonhomologous end-joining factor 1 protein_id : NP_083618.2

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 5 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 4 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 3 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 2 pseudo : _no_value

name	LOC672187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672187
definition	number : 1 pseudo : _no_value

name	LOC672208 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672208
definition	number : 1 pseudo : _no_value

name	LOC672208 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672208
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:225117
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128741
definition	standard_name : D1Mit380

name	(CDS detail)
type	STS
link
xref	UniSTS:271682
definition	standard_name : PMC18293P1

name	(CDS detail)
type	STS
link
xref	UniSTS:158808
definition	standard_name : X12521

name	(CDS detail)
type	STS
link
xref	UniSTS:158807
definition	standard_name : X12521

name	(CDS detail)
type	STS
link
xref	UniSTS:270992
definition	standard_name : PMC141152P1

name	(CDS detail)
type	STS
link
xref	UniSTS:128635
definition	standard_name : D1Mit282

name	(CDS detail)
type	STS
link
xref	UniSTS:128900
definition	standard_name : D1Mit532

name	(CDS detail)
type	STS
link
xref	UniSTS:128848
definition	standard_name : D1Mit482

name	(CDS detail)
type	STS
link
xref	UniSTS:111358
definition	standard_name : AU046535

name	(CDS detail)
type	STS
link
xref	UniSTS:111358
definition	standard_name : AU046535

name	(CDS detail)
type	STS
link
xref	UniSTS:207171
definition	standard_name : BE200114

name	(CDS detail)
type	STS
link
xref	UniSTS:703
definition	standard_name : STS-Z40715

name	(CDS detail)
type	STS
link
xref	UniSTS:116252
definition	standard_name : D1Mit19

name	(CDS detail)
type	STS
link
xref	UniSTS:128934
definition	standard_name : D1Mit77

name	(CDS detail)
type	STS
link
xref	UniSTS:178413
definition	standard_name : AI648117

name	(CDS detail)
type	STS
link
xref	UniSTS:234149
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128519
definition	standard_name : D1Mit180

name	(CDS detail)
type	STS
link
xref	UniSTS:122836
definition	standard_name : 05.MMHAP84FRB8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:142236
definition	standard_name : D1Mcg105

name	(CDS detail)
type	STS
link
xref	UniSTS:272638
definition	standard_name : PMC310709P2

name	(CDS detail)
type	STS
link
xref	UniSTS:141355
definition	standard_name : Cmkar2

name	(CDS detail)
type	STS
link
xref	UniSTS:158811
definition	standard_name : D17630

name	(CDS detail)
type	STS
link
xref	UniSTS:124880
definition	standard_name : L23637

name	(CDS detail)
type	STS
link
xref	UniSTS:221307
definition	standard_name : RH139221

name	(CDS detail)
type	STS
link
xref	UniSTS:142238
definition	standard_name : D1Mcg165

name	(CDS detail)
type	STS
link
xref	UniSTS:492747
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:140993
definition	standard_name : Aamp-rs

name	(CDS detail)
type	STS
link
xref	UniSTS:158810
definition	standard_name : AU040907

name	(CDS detail)
type	STS
link
xref	UniSTS:161969
definition	standard_name : RH125147

name	(CDS detail)
type	STS
link
xref	UniSTS:181078
definition	standard_name : AI854243

name	(CDS detail)
type	STS
link
xref	UniSTS:211936
definition	standard_name : RH128628

name	(CDS detail)
type	STS
link
xref	UniSTS:163166
definition	standard_name : RH126458

name	(CDS detail)
type	STS
link
xref	UniSTS:160553
definition	standard_name : AA960455

name	(CDS detail)
type	STS
link
xref	UniSTS:185438
definition	standard_name : AU024746

name	(CDS detail)
type	STS
link
xref	UniSTS:167272
definition	standard_name : RH127186

name	(CDS detail)
type	STS
link
xref	UniSTS:160917
definition	standard_name : RH118242

name	(CDS detail)
type	STS
link
xref	UniSTS:142239
definition	standard_name : D1Mcg4

name	(CDS detail)
type	STS
link
xref	UniSTS:144409
definition	standard_name : Slc11a1

name	(CDS detail)
type	STS
link
xref	UniSTS:116253
definition	standard_name : D1Mit24

name	(CDS detail)
type	STS
link
xref	UniSTS:142235
definition	standard_name : D1Mcg101

name	(CDS detail)
type	STS
link
xref	UniSTS:144756
definition	standard_name : Vil

name	(CDS detail)
type	STS
link
xref	UniSTS:128520
definition	standard_name : D1Mit181

name	(CDS detail)
type	STS
link
xref	UniSTS:164120
definition	standard_name : AI593551

name	(CDS detail)
type	STS
link
xref	UniSTS:248396
definition	standard_name : AI045490

name	(CDS detail)
type	STS
link
xref	UniSTS:185439
definition	standard_name : BB154236

name	(CDS detail)
type	STS
link
xref	UniSTS:268654
definition	standard_name : MARC_21861-21862:1027094738:1

name	(CDS detail)
type	STS
link
xref	UniSTS:125250
definition	standard_name : MHAa64b12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234156
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:124425
definition	standard_name : 41.MMHAP75FRF11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:158812
definition	standard_name : AI451681

name	(CDS detail)
type	STS
link
xref	UniSTS:462986
definition	standard_name : Cyp27a1

name	(CDS detail)
type	STS
link
xref	UniSTS:256607
definition	standard_name : Cyp27a1

name	(CDS detail)
type	STS
link
xref	UniSTS:471328
definition	standard_name : Wnt6

name	(CDS detail)
type	STS
link
xref	UniSTS:465424
definition	standard_name : Wnt6

name	(CDS detail)
type	STS
link
xref	UniSTS:161656
definition	standard_name : RH124834

name	(CDS detail)
type	STS
link
xref	UniSTS:124997
definition	standard_name : M89800

name	(CDS detail)
type	STS
link
xref	UniSTS:471320
definition	standard_name : Wnt10a

name	(CDS detail)
type	STS
link
xref	UniSTS:163251
definition	standard_name : U61969

name	(CDS detail)
type	STS
link
xref	UniSTS:484839
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:217943
definition	standard_name : RH134664

name	(CDS detail)
type	STS
link
xref	UniSTS:207175
definition	standard_name : AI323361

name	(CDS detail)
type	STS
link
xref	UniSTS:158813
definition	standard_name : U85610

name	(CDS detail)
type	STS
link
xref	UniSTS:143529
definition	standard_name : Ihh

name	(CDS detail)
type	STS
link
xref	UniSTS:143530
definition	standard_name : Ihh

name	(CDS detail)
type	STS
link
xref	UniSTS:128928
definition	standard_name : D1Mit7

name	(CDS detail)
type	STS
link
xref	UniSTS:234154
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128596
definition	standard_name : D1Mit252

name	(CDS detail)
type	STS
link
xref	UniSTS:128597
definition	standard_name : D1Mit252.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128574
definition	standard_name : D1Mit23

name	Pinc (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:115392000 GeneID:723792 MGI:3623820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy induced noncoding RNA transcript_id : NR_003202.1

clone name	MSMg01-100L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-263J09.b	B6Ng01-263J09.g
ACC	GA067717	GA067718
length	1,178	1,140
definition	B6Ng01-263J09.b	B6Ng01-263J09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(73,976,126 - 73,977,313)	(74,101,566 - 74,102,702)
sequence	gaattctctttaggaaacaaggtagcaggtgaattggttggtggtctgct ctagcttgtcccctcagcccagagaaggagagtaatttgctcaggacaca aaaccagcctagggctgtgcctagcaccatgtctccaacctcacaatata ggttctggctggcctaagggaacccacagtctcacagggacaccaacaca tgagccagagaaatgtcagatcgacaggatcacccgtagtggcaaaaaca gccaagagtcagtcatgtgaggtttgtaaggtatggagagcgtaagtacc cagcccgtatggggcagaggtggcataggtacccaggcaagacagtcttc cagccagctgttactcacaggtcctaagactacccaaacttgggaagcca gtggcctgttcctccccacgcctgccactccatctgaacattcccaggct cccctaggtgctcagcccagctccatttgcttccccgtgacacacagcca tcctctcacccagagagccctgtaacccacagcctccacttgcctggcaa gggctccggcactggccacagcagaggacaaacccagagtcacatgaccc tcccttccagccccacccagacatcactttgcctaagaagttagacccaa tccacgcactctgctgtctttaagccttgaaaaatcagattgaaacctac attgaccatctttcctacccctctcccactccacccttatctgcaccccc gtggccatattctacctgcttctccccaggcctcttcctctatgactcca gatggctttggcctttggctggattggttgagtccttactggcagggaga ctgggagggagaagatgagttgtagcccatcctctatttatctccagcag tactggctcctgggtgggcagagacagctcccaccctgctagggagctca ccctctcttgtcatctgcgcttttcagtcacctactggaacaaaccacgg gcttctgccagatctcacccacaccattaggtaagcaccgcactctacgc taatctcttttttaaagcccatatttcttgccacaggagctagagaaagc cacaagtcgaagagtcacgccaatcaaacaggtatgaatctgtcctgctg aagtccatctggactctgccttccctgt	gaattcaggtctagtgtgcctaggcttctagatgggatctgggcatagcc agtccttcctttcatccctagaatgtgagaaatcctgctgataattggca tgtgtggagtcagcgggattttcatggccatgtttgaaggggagtgacag tgtcccctcacagggtagattttcagctgcttccagctttgggaagggac aaccccaagttggaataactgtctttctttctggggacacagctatactg cccttctttcccatgagggctgaagtagtctgtcagttcctctttctggt ctgatcagcttgggaccagagagaccaagcagagagaccgaggtggttta ccacggatccccggcaggaattgtggtcatgtggcaggtgactgtgtgga tatgtaagtgtaacttgaggaagacgctgaggtggtggtggatgtgacct agagaaccagagggaccttctggggtgtgaactagtgggagagccagctg cccttctgactggacagagctccctgcagttcttcaggggcctgattttc ccaaaggctagaatggtaccatgggaacttgggagaaagagacgctgtgc tatgtaagggaagaactttaaatatatctaatcacccctcccataggact ttgatttctgtattggttactttcatgttgctggggccacagcacctgag tgaaataacacaaagcaagaacattccattttggctcatggtttttagag ggtttcaatacattatgactgggaaggtgtaacaaattagttggaacaaa ttagtttttgccagtagtgttgtgcggcagaaggctattcacattatagt aggcaaagaagcggagagcaaggcagaaaccaggggtttagccttaaaag ccacactcctagtgacccactctcccaccttgcctcaccagcatgagaat ccccacccccgctcccaacaacctcacaagctgaagaacaggcccaaaac accgagctgtgggggacatacacatcaataagtaacagcatctgctacct tactggtgggcagtggcccttcatgtaagagagagactggaagcttgagg tggttagaggtatagagaagggatagacacaccagaaatg
quality values	Open. Hide. 62 41 33 35 62 62 62 62 62 62 47 51 47 49 47 62 62 56 32 47 62 62 62 62 62 62 59 62 62 62 51 44 28 27 45 43 27 28 48 54 54 59 62 59 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 59 59 62 59 49 42 31 54 56 59 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 58 54 58 54 58 58 58 58 54 58 58 54 58 58 54 58 58 45 54 58 58 54 58 58 52 58 37 31 23 50 54 58 58 53 58 58 58 54 58 52 58 58 54 54 54 58 58 42 45 58 58 58 58 58 58 58 58 51 49 40 51 58 58 58 58 53 58 58 51 41 53 58 49 50 58 52 52 54 58 58 58 51 54 58 41 40 58 50 58 44 50 53 54 51 53 51 37 58 58 50 49 51 54 43 50 51 53 54 50 47 58 54 47 58 51 39 49 50 53 53 58 39 39 58 50 51 51 58 58 47 38 43 58 58 50 52 50 33 50 41 21 58 53 53 58 50 41 58 41 39 39 41 51 53 54 39 32 52 39 54 53 49 49 50 54 51 45 42 33 54 54 54 52 53 40 32 54 51 39 49 51 45 34 35 37 54 50 49 34 45 45 49 42 53 37 34 32 54 54 54 54 36 19 44 35 29 37 26 52 40 41 39 45 35 38 36 54 41 44 39 54 45 40 34 22 54 49 35 34 34 51 31 52 34 32 35 53 30 52 31 33 34 36 39 32 31 18 42 28 37 28 31 53 29 32 52 30 52 53 52 31 19 16 47 40 51 42 32 42 31 39 31 41 22 23 31 26 34 30 31 30 46 26 34 31 42 35 31 30 28 31 41 45 31 16 6 47 25 18 18 26 25 26 30 48 42 32 9 47 46 38 23 41 36 20 37 25 36 38 21 42 31 30 24 33 18 31 41 21 25 36 33 31 26 27 30 31 28 47 31 26 36 33 38 27 32 18 31 36 36 24 26 32 30 22 31 41 27 37 18 16 18 24 46 39 11 14 46 17 18 30 23 38 18 31 21 21 29 25 38 26 36 26 35 34 36 21 20 32 29 15 14 26 44 20 31 21 14 11 13 22 24 36 31 29 12 20 26 23 11 19 16 8 20 21 18 22 19 30 21 13 11 48 39 33 21 17 7 30 33 24 19 28 7 16 28 26 18 25 23 8 11 9 34 24 4 8 18 21 26 48 27 10 31 7 10 14 13 21 12 25 11 16 19 8 13 7 13 3 26 22 13 9 11 7 12 10 21 10 21 17 22 24 25 24 20 27 20 28 25 17 21 20 18 27 21 11 10 17 20 27 9 10 8 3 5 11 8 22 38 34 38 33 7 3 18 9 4 9 26 22 10 11 7 10 24 9 13 9 9 9 6 9 3 2 6 7 17 19 4 9 12 11 4 16 8 17 28 24 6 7 8 12 13 8 15 6 7 4 3 3 7 6 4 4 5 3 3 9 10 10 12 2 4 15 16 5 22 6 3 2 4 17 5 8 5 6 3 5 6 4 3 3 5 4 12 3 6 11 11 6 8 4 3 4 17 3 3 6 12 5 8 3 1 1 2 5 5 4 3 3 7 6 16 23 21 10 20 5	Open. Hide. 62 47 56 47 62 47 38 62 62 45 34 30 19 22 22 36 32 33 28 38 28 33 56 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 56 49 62 62 62 62 62 59 49 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 54 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 56 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 54 62 62 62 46 62 62 54 62 62 62 62 62 62 49 58 58 58 58 58 54 46 46 58 58 49 54 58 58 58 45 47 58 58 58 58 58 41 42 58 58 58 58 58 58 58 49 58 54 54 58 58 54 49 45 54 49 58 58 58 58 58 58 54 58 58 58 58 58 54 52 58 58 54 54 58 52 45 38 39 58 58 58 45 58 53 58 53 53 58 58 53 58 51 58 38 58 51 35 58 40 49 58 58 51 37 58 58 53 52 58 53 58 58 58 43 58 58 58 37 49 58 58 58 51 46 58 42 46 53 51 25 54 58 30 51 58 51 52 47 46 58 58 52 51 58 49 40 50 50 58 50 50 49 46 53 50 58 47 50 32 33 41 51 50 51 41 51 58 58 58 43 33 49 28 41 37 37 46 50 40 49 50 41 39 16 49 51 50 58 49 39 39 40 40 44 52 40 54 52 37 35 32 50 49 51 20 34 32 53 53 32 41 24 34 54 54 50 51 41 33 53 42 26 37 54 33 21 54 54 54 42 38 31 53 37 54 54 35 54 42 34 37 31 42 40 47 19 54 28 42 40 41 42 31 29 28 54 41 45 49 37 39 28 52 37 31 32 25 31 40 19 27 22 26 34 32 53 32 34 31 33 33 34 53 33 25 52 34 16 53 52 51 40 25 11 20 53 32 32 28 31 29 31 45 33 26 31 42 37 31 36 27 12 21 17 21 13 17 22 21 45 24 38 51 28 18 32 24 48 30 27 31 31 32 35 13 6 30 28 27 46 31 29 33 31 23 31 21 31 32 7 28 11 25 29 13 12 38 14 31 12 21 27 15 20 19 23 30 48 48 42 23 47 37 31 26 21 30 31 37 28 46 46 32 31 36 31 24 26 6 18 30 22 24 26 21 23 25 30 35 30 39 32 18 13 31 34 32 25 46 31 9 15 17 8 38 25 9 22 23 24 28 31 25 20 21 32 31 33 17 17 14 30 19 31 32 38 38 31 28 32 36 36 38 35 19 8 29 19 36 21 12 21 19 10 14 22 22 20 23 32 32 20 17 19 33 34 24 32 6 5 6 9 4 9 4 11 7 34 8 25 47 48 14 21 31 18 20 5 4 6 6 6 9 10 16 40 36 31 9 10 4 6 25 8 12 5 14 22 22 10 27 9 6 6 18 19 12 14 11 21 16 15 21 7 10 9 16 4 8 20 13 12 18 17 13 13 8 7 14 27 6 13 30 11 6 11 15 7 15 21 6 23 6 12 8 5 4 3 5 11 12 7 5 16 7 6 18 8 5 8 7 6 6 4 7 4 21 8 13 8 9 10 7 6 5 4 15 13 12 9 5 3 3 16 5 11 4 8 6 12 8 14 5 4 16 14 3 5 16 5 4 4 12 5 5 3 3 3 4 22 21 15 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_73976126_73977313
seq2: B6Ng01-263J09.b_46_1223

seq1  GAATTCTCTTTAGGAAACAAGGTAGCAGGTGAATTGGTTGGTGGTCTGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTAGGAAACAAGGTAGCAGGTGAATTGGTTGGTGGTCTGCT  50

seq1  CTAGCTTGTCCCCTCAGCCCAGAGAAGGAGAGTAATTTGCTCAGGACACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCTTGTCCCCTCAGCCCAGAGAAGGAGAGTAATTTGCTCAGGACACA  100

seq1  AAACCAGCCTAGGGCTGTGCCTAGCACCATGTCTCCAACCTCACAATATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCAGCCTAGGGCTGTGCCTAGCACCATGTCTCCAACCTCACAATATA  150

seq1  GGTTCTGGCTGGCCTAAGGGAACCCACAGTCTCACAGGGACACCAACACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCTGGCTGGCCTAAGGGAACCCACAGTCTCACAGGGACACCAACACA  200

seq1  TGAGCCAGAGAAATGTCAGATCGACAGGATCACCCGTAGTGGCAAAAACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCCAGAGAAATGTCAGATCGACAGGATCACCCGTAGTGGCAAAAACA  250

seq1  GCCAAGAGTCAGTCATGTGAGGTTTGTAAGGTATGGAGAGCGTAAGTACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAAGAGTCAGTCATGTGAGGTTTGTAAGGTATGGAGAGCGTAAGTACC  300

seq1  CAGCCCGTATGGGGCAGAGGTGGCATAGGTACCCAGGCAAGACAGTCTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCCGTATGGGGCAGAGGTGGCATAGGTACCCAGGCAAGACAGTCTTC  350

seq1  CAGCCAGCTGTTACTCACAGGTCCTAAGACTACCCAAACTTGGGAAGCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCAGCTGTTACTCACAGGTCCTAAGACTACCCAAACTTGGGAAGCCA  400

seq1  GTGGCCTGTTCCTCCCCACGCCTGCCACTCCATCTGAACATTCCCAGGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCTGTTCCTCCCCACGCCTGCCACTCCATCTGAACATTCCCAGGCT  450

seq1  CCCCTAGGTGCTCAGCCCAGCTCCATTTGCTTCCCCGTGACACACAGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTAGGTGCTCAGCCCAGCTCCATTTGCTTCCCCGTGACACACAGCCA  500

seq1  TCCTCTCACCCAGAGAGCCCTGTAACCCACAGCCTCCACTTGCCTGGCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTCACCCAGAGAGCCCTGTAACCCACAGCCTCCACTTGCCTGGCAA  550

seq1  GGGCTCCGGCACTGGCCACAGCAGAGGACAAACCCAGAGTCACATGACCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTCCGGCACTGGCCACAGCAGAGGACAAACCCAGAGTCACATGACCC  600

seq1  TCCCTTCCAGCCCCACCCAGACATCACTTTGCCTAAGAAGTTAGACCCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTTCCAGCCCCACCCAGACATCACTTTGCCTAAGAAGTTAGACCCAA  650

seq1  TCCACGCACTCTGCTGTCTTTAAGCCTTGAAAAATCAGATTGAAACCTAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACGCACTCTGCTGTCTTTAAGCCTTGAAAAATCAGATTGAAACCTAC  700

seq1  ATTGACCATCTTTCCTACCCCTCTCCCACTCCACCCTTATCTGCACCCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGACCATCTTTCCTACCCCTCTCCCACTCCACCCTTATCTGCACCCCC  750

seq1  GTGGCCATATTCTACCTGCTTCTCCCCAGGCCTCTTCCTCTATGACTCCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCATATTCTACCTGCTTCTCCCCAGGCCTCTTCCTCTATGACTCCA  800

seq1  GATGGCTTTGGCCTTTGGCTGGATTGGTTGAGTCCTTACTGGCAGGGAGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGCTTTGGCCTTTGGCTGGATTGGTTGAGTCCTTACTGGCAGGGAGA  850

seq1  CTGGGAGGGAGAAGATGAGTTGTAGCCCATCCTCTATTTATCTCCAGCAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGAGGGAGAAGATGAGTTGTAGCCCATCCTCTATTTATCTCCAGCAG  900

seq1  TACTGGCTCCTGGGTGGGCAGAGACAGCTCCCACCCTGCTAGGGAGCTCA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGGCTCCTGGGTGGGCAGAGACAGCTCCCACCCTGCTAGGGAGCTCA  950

seq1  CCCTCTCTTGTTCATCTGCGCTTTTCAGTCACCTACTGGAACAAACCACG  1000
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTCTTG-TCATCTGCGCTTTTCAGTCACCTACTGGAACAAACCACG  999

seq1  GGCTTCTGCCAAGATCTCAACCCACA-CATTAGGTAAGCACCGCACTCTA  1049
      |||||||||| ||||||| ||||||| |||||||||||||||||||||||
seq2  GGCTTCTGCC-AGATCTC-ACCCACACCATTAGGTAAGCACCGCACTCTA  1047

seq1  CGCTAAATTCTCTTTTTTAAAAGCCCATA-TTCTGCCAACAGGAAGCTAA  1098
      ||||||  |||||||||| |||||||||| ||||  | ||||| |||| |
seq2  CGCTAA--TCTCTTTTTT-AAAGCCCATATTTCTTGCCACAGG-AGCT-A  1092

seq1  GAGAAAGCCCACAGTCGGAAGAGTCACGCCCAATCAACCAAGGTAGTGAA  1148
      |||||||||   |||| ||||||||||| |||||||| | ||||| ||||
seq2  GAGAAAGCCACAAGTC-GAAGAGTCACG-CCAATCAAAC-AGGTA-TGAA  1138

seq1  TCTGTCCCTGCTGAGTGCCTACTGGGCTCTG-CTTCCCTGT  1188
      ||||| ||||||||   ||  |||| ||||| |||||||||
seq2  TCTGT-CCTGCTGAAGTCCATCTGGACTCTGCCTTCCCTGT  1178

seq1: chr1_74101566_74102702
seq2: B6Ng01-263J09.g_68_1207 (reverse)

seq1  CATTTCTG--ATGTCTATCCCTCTCCTATACCTCTAACCACTCAAAGCCT  48
      ||||||||   |||||||||||   ||||||||||||||||   |||| |
seq2  CATTTCTGGTGTGTCTATCCCTTCTCTATACCTCTAACCACCTCAAGCTT  50

seq1  -CAGTCTC-CTCTTACATGAAAGGCCACTGGCCCACAGTAAGGTAGCAAG  96
       ||||||| |||||||||||| |||||||| ||  |||||||||||| ||
seq2  CCAGTCTCTCTCTTACATGAAGGGCCACTGCCCACCAGTAAGGTAGC-AG  99

seq1  ATGCTGTTACTATTTGATGTGTAATGTCCCCACAAGCTCGGTGTTTTGGC  146
      |||||||||||  ||||||||| ||||||||   ||||||||||||||| 
seq2  ATGCTGTTACTTATTGATGTGT-ATGTCCCCCACAGCTCGGTGTTTTGGG  148

seq1  CTTGTTC-TCAGCTTGTGAGGTTGTTGGGAGCGGGGGTGGGGATTCTCAT  195
      | ||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTTCTTCAGCTTGTGAGGTTGTTGGGAGCGGGGGTGGGGATTCTCAT  198

seq1  GCTGGTGAGGCAAGGTGGGAGAGTGGGTCACTAGGAGTGTGGCTTTTAAG  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGTGAGGCAAGGTGGGAGAGTGGGTCACTAGGAGTGTGGCTTTTAAG  248

seq1  GCTAAACCCCTGGTTTCTGCCTTGCTCTCCGCTTCTTTGCCTACTATAAT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAAACCCCTGGTTTCTGCCTTGCTCTCCGCTTCTTTGCCTACTATAAT  298

seq1  GTGAATAGCCTTCTGCCGCACAACACTACTGGCAAAAACTAATTTGTTCC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAATAGCCTTCTGCCGCACAACACTACTGGCAAAAACTAATTTGTTCC  348

seq1  AACTAATTTGTTACACCTTCCCAGTCATAATGTATTGAAACCCTCTAAAA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTAATTTGTTACACCTTCCCAGTCATAATGTATTGAAACCCTCTAAAA  398

seq1  ACCATGAGCCAAAATGGAATGTTCTTGCTTTGTGTTATTTCACTCAGGTG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATGAGCCAAAATGGAATGTTCTTGCTTTGTGTTATTTCACTCAGGTG  448

seq1  CTGTGGCCCCAGCAACATGAAAGTAACCAATACAGAAATCAAAGTCCTAT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGCCCCAGCAACATGAAAGTAACCAATACAGAAATCAAAGTCCTAT  498

seq1  GGGAGGGGTGATTAGATATATTTAAAGTTCTTCCCTTACATAGCACAGCG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGGGTGATTAGATATATTTAAAGTTCTTCCCTTACATAGCACAGCG  548

seq1  TCTCTTTCTCCCAAGTTCCCATGGTACCATTCTAGCCTTTGGGAAAATCA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTTCTCCCAAGTTCCCATGGTACCATTCTAGCCTTTGGGAAAATCA  598

seq1  GGCCCCTGAAGAACTGCAGGGAGCTCTGTCCAGTCAGAAGGGCAGCTGGC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCCTGAAGAACTGCAGGGAGCTCTGTCCAGTCAGAAGGGCAGCTGGC  648

seq1  TCTCCCACTAGTTCACACCCCAGAAGGTCCCTCTGGTTCTCTAGGTCACA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCACTAGTTCACACCCCAGAAGGTCCCTCTGGTTCTCTAGGTCACA  698

seq1  TCCACCACCACCTCAGCGTCTTCCTCAAGTTACACTTACATATCCACACA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACCACCACCTCAGCGTCTTCCTCAAGTTACACTTACATATCCACACA  748

seq1  GTCACCTGCCACATGACCACAATTCCTGCCGGGGATCCGTGGTAAACCAC  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACCTGCCACATGACCACAATTCCTGCCGGGGATCCGTGGTAAACCAC  798

seq1  CTCGGTCTCTCTGCTTGGTCTCTCTGGTCCCAAGCTGATCAGACCAGAAA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGGTCTCTCTGCTTGGTCTCTCTGGTCCCAAGCTGATCAGACCAGAAA  848

seq1  GAGGAACTGACAGACTACTTCAGCCCTCATGGGAAAGAAGGGCAGTATAG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAACTGACAGACTACTTCAGCCCTCATGGGAAAGAAGGGCAGTATAG  898

seq1  CTGTGTCCCCAGAAAGAAAGACAGTTATTCCAACTTGGGGTTGTCCCTTC  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGTCCCCAGAAAGAAAGACAGTTATTCCAACTTGGGGTTGTCCCTTC  948

seq1  CCAAAGCTGGAAGCAGCTGAAAATCTACCCTGTGAGGGGACACTGTCACT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGCTGGAAGCAGCTGAAAATCTACCCTGTGAGGGGACACTGTCACT  998

seq1  CCCCTTCAAACATGGCCATGAAAATCCCGCTGACTCCACACATGCCAATT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTCAAACATGGCCATGAAAATCCCGCTGACTCCACACATGCCAATT  1048

seq1  ATCAGCAGGATTTCTCACATTCTAGGGATGAAAGGAAGGACTGGCTATGC  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCAGGATTTCTCACATTCTAGGGATGAAAGGAAGGACTGGCTATGC  1098

seq1  CCAGATCCCATCTAGAAGCCTAGGCACACTAGACCTGAATTC  1137
      ||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGATCCCATCTAGAAGCCTAGGCACACTAGACCTGAATTC  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information