MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-275N20
Chromosome	1 (Build37)
Map Location	108,586,971 - 108,762,789
singlet/doublet	doublet
Overlap gene	Bcl2, LOC100042085, Fvt1, Vps4b, Serpinb5
Upstream gene	2310035C23Rik, LOC100042023, Tnfrsf11a, EG635504, Zcchc2, EG435634, Phlpp, LOC626075
Downstream gene	LOC671141, Serpinb12, Serpinb13, LOC666394, Serpinb3a, Serpinb3d, LOC100041276, Serpinb3b, EG666401, Serpinb3c, LOC666414, Serpinb11, Serpinb7, Serpinb2, Serpinb10, Serpinb8
Link	Open Mouse BAC browser

Click to get alignment info.

name	2310035C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227446 MGI:1922832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042023 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 ESTs, 1 Protein

name	Tnfrsf11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21934 MGI:1314891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG635504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635504 MGI:3646078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs

name	Zcchc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227449 MGI:2444114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 74 ESTs, 3 Proteins

name	EG435634 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435634 MGI:3648813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Phlpp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98432 MGI:2138327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 115 ESTs, 8 Proteins

name	LOC626075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 9 Proteins pseudo : _no_value

name	Bcl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12043 MGI:88138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs

name	Fvt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70750 MGI:1918000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20479 MGI:1100499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20724 MGI:109579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	Serpinb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71869 MGI:1919119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241196 MGI:3042250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins pseudo : _no_value

name	Serpinb3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20248 MGI:3573933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:394252 MGI:2683295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041276 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Serpinb3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383548 MGI:2683293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666401 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666401 MGI:3645945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Serpinb3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381286 MGI:1277952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666414 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Serpinb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66957 MGI:1914207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116872 MGI:2151053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18788 MGI:97609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241197 MGI:2138648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20725 MGI:894657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310035C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368864 GeneID:227446 MGI:1922832
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310035C23 gene transcript_id : NM_173187.2

name	LOC100042023 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234245 GeneID:100042023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 ESTs, 1 Protein product : similar to PNAS-106 transcript_id : XM_001478111.1

name	Tnfrsf11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350008 GeneID:21934 MGI:1314891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 11a transcript_id : NM_009399.3

name	EG635504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363848 GeneID:635504 MGI:3646078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : predicted gene, EG635504 transcript_id : XM_983271.1

name	Zcchc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234247 GeneID:227449 MGI:2444114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 74 ESTs, 3 Proteins product : zinc finger, CCHC domain containing 2 transcript_id : XM_001478125.1

name	Phlpp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363843 GeneID:98432 MGI:2138327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 115 ESTs, 8 Proteins product : PH domain and leucine rich repeat protein phosphatase, transcript variant 1 transcript_id : XM_129968.4

name	Bcl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892546 GeneID:12043 MGI:88138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 transcript_id : NM_009741.3

name	Bcl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893253 GeneID:12043 MGI:88138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 transcript_id : NM_177410.2

name	LOC100042085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234250 GeneID:100042085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs product : hypothetical protein LOC100042085 transcript_id : XM_001478164.1

name	Fvt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625779 GeneID:70750 MGI:1918000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : follicular lymphoma variant translocation 1 transcript_id : NM_027534.1

name	Vps4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677980 GeneID:20479 MGI:1100499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 4b (yeast) transcript_id : NM_009190.1

name	Serpinb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130477 GeneID:20724 MGI:109579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 5 transcript_id : NM_009257.3

name	Serpinb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348136 GeneID:71869 MGI:1919119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 12 transcript_id : NM_027971.2

name	Serpinb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384003 GeneID:241196 MGI:3042250
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13 transcript_id : NM_172852.2

name	Serpinb3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092273 GeneID:20248 MGI:3573933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A transcript_id : NM_009126.2

name	Serpinb3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235786 GeneID:394252 MGI:2683295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D transcript_id : NM_201376.1

name	Serpinb3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354324 GeneID:383548 MGI:2683293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B transcript_id : NM_198680.2

name	Serpinb3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235742 GeneID:381286 MGI:1277952
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 3C transcript_id : NM_201363.1

name	Serpinb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349975 GeneID:66957 MGI:1914207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 11 transcript_id : NM_025867.2

name	Serpinb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802836 GeneID:116872 MGI:2151053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 7 transcript_id : NM_027548.2

name	Serpinb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51468082 GeneID:18788 MGI:97609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 2 transcript_id : NM_011111.3

name	Serpinb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38569435 GeneID:241197 MGI:2138648
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 transcript_id : NM_198028.2

name	Serpinb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802433 GeneID:20725 MGI:894657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptdiase inhibitor, clade B, member 8 transcript_id : NM_011459.3

name	2310035C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819659 CCDS:CCDS15206.1 GeneID:227446 MGI:1922832
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC227446 protein_id : NP_775279.1

name	LOC100042023 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234246 GeneID:100042023
definition	codon_start : 1 product : similar to PNAS-106 protein_id : XP_001478161.1

name	Tnfrsf11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350009 CCDS:CCDS15207.1 GeneID:21934 MGI:1314891
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IMP]; GO:0048535 - lymph node development [Evidence IMP]; GO:0001503 - ossification [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy note : receptor activator of NF-kappaB product : tumor necrosis factor receptor superfamily, member 11a protein_id : NP_033425.3

name	EG635504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363849 GeneID:635504 MGI:3646078
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988365.1

name	Zcchc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234248 GeneID:227449 MGI:2444114
definition	codon_start : 1 product : zinc finger, CCHC domain containing 2 protein_id : XP_001478175.1

name	Phlpp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82882260 GeneID:98432 MGI:2138327
definition	codon_start : 1 product : PH domain and leucine rich repeat protein phosphatase isoform 1 protein_id : XP_129968.3

name	Bcl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892547 CCDS:CCDS15209.1 GeneID:12043 MGI:88138
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006916 - anti-apoptosis [Evidence IGI] [Evidence IDA]; GO:0006915 - apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0001836 - release of cytochrome c from mitochondria [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : B-cell leukemia/lymphoma 2 isoform 1 protein_id : NP_033871.2

name	Bcl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133893254 GeneID:12043 MGI:88138
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006916 - anti-apoptosis [Evidence IGI] [Evidence IDA]; GO:0006915 - apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IDA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0001836 - release of cytochrome c from mitochondria [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : B-cell leukemia/lymphoma 2 isoform 2 protein_id : NP_803129.2

name	LOC100042085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234251 GeneID:100042085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478214.1

name	Fvt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625780 CCDS:CCDS15210.1 GeneID:70750 MGI:1918000
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047560 - 3-dehydrosphinganine reductase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : 3-ketodihydrosphingosine reductase product : follicular lymphoma variant translocation 1 protein_id : NP_081810.1

name	Vps4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677981 CCDS:CCDS15211.1 GeneID:20479 MGI:1100499
definition	GO_component : GO:0005768 - endosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence ISS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016197 - endosome transport [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : suppressor of K+ transport defect 1 product : vacuolar protein sorting 4b protein_id : NP_033216.1

name	Serpinb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678103 GeneID:20724 MGI:109579
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 7; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5 product : serine (or cysteine) proteinase inhibitor, clade B, member 5 protein_id : NP_033283.1

name	Serpinb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735461 CCDS:CCDS15212.1 GeneID:71869 MGI:1919119
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0030304 - trypsin inhibitor activity [Evidence ISS] GO_process : GO:0042177 - negative regulation of protein catabolism [Evidence ISS] codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12 protein_id : NP_082247.1

name	Serpinb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370288 CCDS:CCDS15213.1 GeneID:241196 MGI:3042250
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13 protein_id : NP_766440.1

name	Serpinb3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092274 CCDS:CCDS15214.1 GeneID:20248 MGI:3573933
definition	codon_start : 1 exception : mismatches in translation note : squamous cell carcinoma antigen 2 product : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3A protein_id : NP_033152.2

name	Serpinb3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235787 CCDS:CCDS15215.1 GeneID:394252 MGI:2683295
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine proteinase inhibitor B3-like 1; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3D product : serine (or cysteine) proteinase inhibitor, clade b, member 3d protein_id : NP_958764.1

name	Serpinb3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38371730 CCDS:CCDS15216.1 GeneID:383548 MGI:2683293
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IDA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IDA] codon_start : 1 note : squamous cell carcinoma antigen 2 related protein 1; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3B product : serine (or cysteine) proteinase inhibitor, clade b, member 3b protein_id : NP_941373.1

name	Serpinb3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235743 GeneID:381286 MGI:1277952
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : ovalbumin product : serine (or cysteine) proteinase inhibitor, clade B, member 3C protein_id : NP_958751.1

name	Serpinb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385352 CCDS:CCDS15218.1 GeneID:66957 MGI:1914207
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11 protein_id : NP_080143.1

name	Serpinb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16506824 GeneID:116872 MGI:2151053
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030162 - regulation of proteolysis [Evidence ISS] codon_start : 1 note : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7 product : serine (or cysteine) proteinase inhibitor, clade B, member 7 protein_id : NP_081824.1

name	Serpinb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755098 CCDS:CCDS15219.1 GeneID:18788 MGI:97609
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008243 - plasminogen activator activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : plasminogen activator inhibitor, type II; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 product : serine (or cysteine) proteinase inhibitor, clade b, member 2 protein_id : NP_035241.1

name	Serpinb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38569436 GeneID:241197 MGI:2138648
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10 protein_id : NP_932145.2

name	Serpinb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15826848 CCDS:CCDS15220.1 GeneID:20725 MGI:894657
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 8 product : serine (or cysteine) proteinase inhibitor, clade B, member 8 protein_id : NP_035589.1

name	EG435634 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435634
definition	number : 1 pseudo : _no_value

name	EG435634 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435634
definition	number : 2 pseudo : _no_value

name	LOC671141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671141
definition	number : 2 pseudo : _no_value

name	LOC671141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671141
definition	number : 1 pseudo : _no_value

name	LOC100041276 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041276
definition	number : 2 pseudo : _no_value

name	LOC100041276 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041276
definition	number : 1 pseudo : _no_value

name	EG666401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666401
definition	number : 5 pseudo : _no_value

name	EG666401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666401
definition	number : 4 pseudo : _no_value

name	EG666401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666401
definition	number : 3 pseudo : _no_value

name	EG666401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666401
definition	number : 2 pseudo : _no_value

name	EG666401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666401
definition	number : 1 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 7 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 6 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 5 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 4 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 3 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 2 pseudo : _no_value

name	LOC666414 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666414
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:25822
definition	standard_name : WI-21772

name	(CDS detail)
type	STS
link
xref	UniSTS:162835
definition	standard_name : RH126123

name	(CDS detail)
type	STS
link
xref	UniSTS:158793
definition	standard_name : AA793007

name	(CDS detail)
type	STS
link
xref	UniSTS:180747
definition	standard_name : AW536850

name	(CDS detail)
type	STS
link
xref	UniSTS:158840
definition	standard_name : AF019046

name	(CDS detail)
type	STS
link
xref	UniSTS:122970
definition	standard_name : 09.MMHAP29FLC3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234185
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234188
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178450
definition	standard_name : AW212015

name	(CDS detail)
type	STS
link
xref	UniSTS:125453
definition	standard_name : MHAa97b3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123295
definition	standard_name : 16.MMHAP16FRF7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:178449
definition	standard_name : AI836256

name	(CDS detail)
type	STS
link
xref	UniSTS:124598
definition	standard_name : 45.MMHAP93FRG12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234186
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128885
definition	standard_name : D1Mit515

name	(CDS detail)
type	STS
link
xref	UniSTS:141164
definition	standard_name : Bcl2

name	(CDS detail)
type	STS
link
xref	UniSTS:128502
definition	standard_name : D1Mit163

name	(CDS detail)
type	STS
link
xref	UniSTS:141163
definition	standard_name : Bcl2

name	(CDS detail)
type	STS
link
xref	UniSTS:265515
definition	standard_name : Bcl2

name	(CDS detail)
type	STS
link
xref	UniSTS:271602
definition	standard_name : PMC16825P1

name	(CDS detail)
type	STS
link
xref	UniSTS:270102
definition	standard_name : PMC104155P1

name	(CDS detail)
type	STS
link
xref	UniSTS:270490
definition	standard_name : PMC125347P1

name	(CDS detail)
type	STS
link
xref	UniSTS:461954
definition	standard_name : Bcl2

name	(CDS detail)
type	STS
link
xref	UniSTS:271073
definition	standard_name : PMC150726P1

name	(CDS detail)
type	STS
link
xref	UniSTS:272988
definition	standard_name : PMC316415P3

name	(CDS detail)
type	STS
link
xref	UniSTS:185449
definition	standard_name : AW986256

name	(CDS detail)
type	STS
link
xref	UniSTS:207196
definition	standard_name : BE136439

name	(CDS detail)
type	STS
link
xref	UniSTS:178448
definition	standard_name : AI462524

name	(CDS detail)
type	STS
link
xref	UniSTS:178451
definition	standard_name : AI646751

name	(CDS detail)
type	STS
link
xref	UniSTS:128605
definition	standard_name : D1Mit259.2

name	(CDS detail)
type	STS
link
xref	UniSTS:128604
definition	standard_name : MT1854

name	(CDS detail)
type	STS
link
xref	UniSTS:128472
definition	standard_name : D1Mit137

name	(CDS detail)
type	STS
link
xref	UniSTS:207198
definition	standard_name : AU015399

name	(CDS detail)
type	STS
link
xref	UniSTS:271196
definition	standard_name : PMC15197P2

name	(CDS detail)
type	STS
link
xref	UniSTS:271195
definition	standard_name : PMC15197P1

name	(CDS detail)
type	STS
link
xref	UniSTS:125232
definition	standard_name : MHAa59d11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:185450
definition	standard_name : BB233602

name	(CDS detail)
type	STS
link
xref	UniSTS:128781
definition	standard_name : D1Mit417

name	(CDS detail)
type	STS
link
xref	UniSTS:128749
definition	standard_name : D1Mit388

name	(CDS detail)
type	STS
link
xref	UniSTS:207197
definition	standard_name : BE311274

name	(CDS detail)
type	STS
link
xref	UniSTS:128603
definition	standard_name : D1Mit258

name	(CDS detail)
type	STS
link
xref	UniSTS:122995
definition	standard_name : 09.MMHAP82FLC3.seq

name	LOC626075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234249 GeneID:626075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 9 Proteins product : similar to high mobility group nucleosomal binding domain 2 pseudo : _no_value transcript_id : XR_033564.1

name	LOC666394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234254 GeneID:666394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins product : similar to squamous cell carcinoma antigen 2 pseudo : _no_value transcript_id : XR_033625.1

clone name	MSMg01-391O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236N16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-136B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-109H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-454J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-332P15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-419K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-275N20.b	B6Ng01-275N20.g
ACC	GA076791	GA076792
length	911	1,049
definition	B6Ng01-275N20.b	B6Ng01-275N20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(108,761,883 - 108,762,789)	(108,586,971 - 108,588,021)
sequence	gaattcatttctcctggctcccagcccgggctccccacacctcctcacct tctttcttcataattggactttggccagcatttgatatttctgtagcctc tcaagttcccaaactcccatatcctaaatgatctccttcaaagatcccaa gataccgtctgtgttggggaggaatattgcttttgtttggattttgcggt gtttgtttagttggttggttttaatgacacaggacttttcccttagggtt ttcctacctgaaggagctctggttctcctttctgcctctggtatttcaat tctttcattagttctataaggcgtggacacctaactcaagccaggcagaa gtaggcattaggaatcccaaggcgagggctggagagatggctcagtgact aaaagccctggctgatcttccagaggaaccgggtttgactcccaacaccc acataatggttcacgaccatctgtaactccagcctgagaggatttaatgg cctctgtagacactgtgtgcatgtggtgcacagacatacatgcgggcaaa acacccatacatataaaataaacataaatcaaaacaattggaaaaaataa aatccaagacgcacacatagtaacttctgtctccaccaagctatcagcta gtggcctaagagtgtatactagagtgtattagttaccacggggattctcg tcaacaccacagccctagaggaaatctcagggaattttctgggaagcact gacatccaagtgagtcatatgaaaggataaggttcttagtctgacaaata tggggggcaaggagagaataccaaacaaatgtgtgggtgtaaggataagg tttagaattatagtaaggaattatgctggcctatcacacatagtgattga agattcttcac	gaattctttaggaccacccttcctgggtgaaaagagattgaagagatggc cacaaagcaaaggtattacacaaggcggtggatacatgactgcaatgcac tgaatgtacactcgcaaaagaacaacggactctggagaagagcaacataa agatcatcgaacaccctggacatttagtggatatgtttgtccggggggca tggaacaagcatacagagaggaacagcagaggcaatttttcctctaatac acattctaacataaaagggaaggggatcaaatgatagtgggcaacttgaa atcttatttcatacttgaaattgcatttccaaatggaatatgctttaatt agacttatggaaatttctagaaacacttcctcaccctacttctgatcttt ccaggttccaatcatgaaatagttcatttttaggtccttttaaagagcta actggctcccagagaacttcactttggtacatttcatttatttatttctt tttctgaactctggcttctgcattccctgtgaagcattgtttacagagac ggcaaagcaaacacctgtcattcttaaaacacgaggagtataattcagca ccttttctgtgatcacagaatgcaattaatcctctggctgccttggtatg tagaccaaaccttctgccacagtgttttgggatgctgccgtctagggtgg ctctgccaatctcttcattccaacagaaagcctgccaggcttctccgtgc taagcaaagaataatgaggcagaagagggtgactagggcctcgcagaggg gatgcgcccctgagactcactttccacaacacaaagctaccttactattc aagtacttttgttgccctgaacataggaaactcaattaaattaaattcct ctaagaagaaatactgcctcatctctagctgagaaatgtttaatctgtag aagttatagcgtagatggaatagtggagaaaataattagactcagaaaat gttaggagatcagggttagctcaaaaaaaccagcagagaaccatgcttt
quality values	Open. Hide. 58 33 35 29 54 39 25 45 58 62 62 62 62 62 62 62 54 62 62 62 62 42 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 54 49 62 47 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 56 56 62 56 62 62 56 56 62 62 54 62 62 62 62 62 62 62 51 49 51 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 56 56 62 62 62 62 54 38 54 54 62 47 22 62 62 62 62 54 62 47 41 62 62 62 62 62 62 62 42 62 52 50 47 52 62 54 62 62 62 54 52 58 58 54 58 58 50 58 54 58 52 49 46 54 52 52 54 52 54 52 58 58 54 54 58 58 58 52 49 58 58 54 54 41 54 54 54 47 54 58 54 58 46 58 40 58 58 58 58 58 58 58 54 47 58 39 58 58 58 54 52 52 54 52 52 48 49 54 58 58 41 54 58 58 49 58 54 46 42 41 58 58 54 54 41 46 46 54 51 47 50 51 47 50 52 51 32 58 54 50 52 51 50 50 49 58 50 52 58 49 32 53 50 58 32 51 48 46 51 50 49 35 40 49 52 46 25 47 47 41 37 50 53 39 35 50 40 50 39 24 51 24 47 51 30 40 39 32 48 48 51 39 58 50 52 58 46 40 42 50 50 19 49 53 33 37 40 32 42 37 50 58 58 22 14 24 41 52 39 53 31 35 37 41 37 22 37 52 33 50 39 33 39 44 32 25 35 28 53 23 50 50 58 35 42 35 47 32 41 10 49 22 49 37 31 58 58 42 38 34 52 54 54 35 33 31 38 39 32 40 35 21 25 22 41 17 30 13 33 39 45 27 28 19 42 39 31 37 39 37 37 39 44 38 13 54 37 26 53 53 13 16 8 10 10 19 16 45 13 30 34 33 37 30 15 18 37 33 36 13 15 35 54 44 54 54 44 13 25 15 13 39 34 14 42 25 35 34 28 20 13 16 52 52 15 20 18 36 33 32 32 20 51 13 13 9 6 12 41 12 11 42 8 25 17 18 6 25 10 27 12 32 30 26 13 14 17 6 9 32 32 28 17 27 32 19 10 13 33 31 10 31 21 22 29 23 15 23 9 9 22 13 13 11 22 15 9 6 10 6 11 13 6 5 15 24 16 9 5 6 6 8 12 18 45 21 31 31 10 10 8	Open. Hide. 62 47 39 42 62 62 62 62 47 62 47 62 47 47 47 42 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 46 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 48 62 62 62 62 62 62 62 53 62 62 62 62 62 62 62 62 62 62 49 52 62 48 49 58 58 58 58 58 49 58 58 58 54 49 49 54 58 54 52 58 58 58 58 53 58 58 54 54 54 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 52 58 54 54 58 58 58 54 58 58 54 41 47 54 58 54 58 58 54 48 58 46 46 58 58 51 58 58 50 51 49 58 58 53 46 49 48 58 50 50 58 58 52 58 50 58 49 49 49 49 54 58 58 48 48 52 51 58 49 51 43 50 58 58 54 50 51 49 51 46 39 58 58 31 49 47 47 51 50 47 58 53 47 40 54 50 27 43 54 54 58 40 50 49 46 40 53 39 36 40 40 52 32 50 58 38 32 51 37 32 41 39 42 50 53 49 54 53 53 53 40 54 51 32 50 44 28 50 51 31 46 44 40 50 41 58 34 53 39 41 34 40 32 54 40 42 42 41 52 45 40 47 42 53 39 40 41 39 39 51 18 54 54 41 50 54 53 41 31 45 42 42 39 41 51 37 40 45 39 34 41 54 46 37 51 35 26 41 34 45 37 49 36 12 36 45 40 52 52 39 52 31 26 47 41 30 28 19 33 45 29 28 51 54 46 29 18 51 32 37 20 27 24 45 53 31 32 40 40 45 34 53 31 23 41 34 34 30 31 31 36 32 47 42 29 53 32 36 31 29 35 51 43 34 33 29 36 25 52 42 26 51 24 51 31 28 43 34 19 30 21 31 51 51 29 31 31 31 24 31 34 27 36 10 51 51 31 30 18 30 30 24 40 41 41 37 31 33 38 21 27 29 34 31 31 30 38 48 35 24 31 21 26 13 31 30 26 23 24 46 36 38 32 38 23 27 31 43 22 29 31 34 34 30 30 25 8 36 37 31 18 29 33 47 47 31 31 25 21 25 16 46 32 29 31 25 33 24 25 27 25 14 21 31 47 20 23 43 31 34 34 42 31 31 48 31 30 20 16 43 28 15 25 34 33 37 38 27 22 26 16 37 30 27 35 44 13 26 29 34 25 35 27 23 31 38 31 32 27 25 25 21 31 32 32 32 27 31 9 31 48 18 12 24 19 43 15 8 19 27 32 27 33 19 22 14 24 38 10 22 9 11 7 19 15 30 19 27 32 10 21 21 22 29 30 8 12 31 22 12 14 7 13 6 6 43 43 17 31 9 26 11 24 22 21 33 12 14 6 5 5 13 34 28 22 15 28 17 28 21 8 21 9 13 26 20 20 14 16 47 31 8 6 27 11 27 27 27 24 32 21 16 21 23 14 6 6 22 9 8 13 7 23 9 28 28 15 25 11 17 20 21 17 34 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr1_108761883_108762789
seq2: B6Ng01-275N20.b_46_956 (reverse)

seq1  GTGAAGAATCTACTATCACTATGT-TGATAGGCCAGCATAATTCCTTACT  49
      ||||||||||| | |||||||||| |||||||||||||||||||||||||
seq2  GTGAAGAATCTTCAATCACTATGTGTGATAGGCCAGCATAATTCCTTACT  50

seq1  AT-ATTCTAAACCTTATCCTTACACCCACACATTTGTTT-GTATTCTCTC  97
      || |||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ATAATTCTAAACCTTATCCTTACACCCACACATTTGTTTGGTATTCTCTC  100

seq1  CTTGCCCCCCATATTTGTCAGACTAAG-ACCTTATCCTTTCATATGACTC  146
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  CTTGCCCCCCATATTTGTCAGACTAAGAACCTTATCCTTTCATATGACTC  150

seq1  ACTTGGATGTCAGTGCTTCCCAGAAAATTCCCTGAGATTTCCTCTAGGGC  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGATGTCAGTGCTTCCCAGAAAATTCCCTGAGATTTCCTCTAGGGC  200

seq1  TGTGGTGTTGACGAGAATCCCCGTGGTAACTAATACACTCTAGTATACAC  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTGTTGACGAGAATCCCCGTGGTAACTAATACACTCTAGTATACAC  250

seq1  TCTTAGGCCACTAGCTGATAGCTTGGTGGAGACAGAAGTTACTATGTGTG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGGCCACTAGCTGATAGCTTGGTGGAGACAGAAGTTACTATGTGTG  300

seq1  CGTCTTGGATTTTATTTTTTCCAATTGTTTTGATTTATGTTTATTTTATA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTCTTGGATTTTATTTTTTCCAATTGTTTTGATTTATGTTTATTTTATA  350

seq1  TGTATGGGTGTTTTGCCCGCATGTATGTCTGTGCACCACATGCACACAGT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATGGGTGTTTTGCCCGCATGTATGTCTGTGCACCACATGCACACAGT  400

seq1  GTCTACAGAGGCCATTAAATCCTCTCAGGCTGGAGTTACAGATGGTCGTG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTACAGAGGCCATTAAATCCTCTCAGGCTGGAGTTACAGATGGTCGTG  450

seq1  AACCATTATGTGGGTGTTGGGAGTCAAACCCGGTTCCTCTGGAAGATCAG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCATTATGTGGGTGTTGGGAGTCAAACCCGGTTCCTCTGGAAGATCAG  500

seq1  CCAGGGCTTTTAGTCACTGAGCCATCTCTCCAGCCCTCGCCTTGGGATTC  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGGCTTTTAGTCACTGAGCCATCTCTCCAGCCCTCGCCTTGGGATTC  550

seq1  CTAATGCCTACTTCTGCCTGGCTTGAGTTAGGTGTCCACGCCTTATAGAA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATGCCTACTTCTGCCTGGCTTGAGTTAGGTGTCCACGCCTTATAGAA  600

seq1  CTAATGAAAGAATTGAAATACCAGAGGCAGAAAGGAGAACCAGAGCTCCT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATGAAAGAATTGAAATACCAGAGGCAGAAAGGAGAACCAGAGCTCCT  650

seq1  TCAGGTAGGAAAACCCTAAGGGAAAAGTCCTGTGTCATTAAAACCAACCA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGTAGGAAAACCCTAAGGGAAAAGTCCTGTGTCATTAAAACCAACCA  700

seq1  ACTAAACAAACACCGCAAAATCCAAACAAAAGCAATATTCCTCCCCAACA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAACAAACACCGCAAAATCCAAACAAAAGCAATATTCCTCCCCAACA  750

seq1  CAGACGGTATCTTGGGATCTTTGAAGGAGATCATTTAGGATATGGGAGTT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACGGTATCTTGGGATCTTTGAAGGAGATCATTTAGGATATGGGAGTT  800

seq1  TGGGAACTTGAGAGGCTACAGAAATATCAAATGCTGGCCAAAGTCCAATT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAACTTGAGAGGCTACAGAAATATCAAATGCTGGCCAAAGTCCAATT  850

seq1  ATGAAGAAAGAAGGTGAGGAGGTGTGGGGAGCCCGGGCTGGGAGCCAGGA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGAAAGAAGGTGAGGAGGTGTGGGGAGCCCGGGCTGGGAGCCAGGA  900

seq1  GAAATGAATTC  907
      |||||||||||
seq2  GAAATGAATTC  911

seq1: chr1_108586971_108588021
seq2: B6Ng01-275N20.g_66_1114

seq1  GAATTCTTTAGGACCACCCTTCCTGGGTGAAAAGAGATTGAAGAGATGGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTAGGACCACCCTTCCTGGGTGAAAAGAGATTGAAGAGATGGC  50

seq1  CACAAAGCAAAGGTATTACACAAGGCGGTGGATACATGACTGCAATGCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAAGCAAAGGTATTACACAAGGCGGTGGATACATGACTGCAATGCAC  100

seq1  TGAATGTACACTCGCAAAAGAACAACGGACTCTGGAGAAGAGCAACATAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGTACACTCGCAAAAGAACAACGGACTCTGGAGAAGAGCAACATAA  150

seq1  AGATCATCGAACACCCTGGACATTTAGTGGATATGTTTGTCCGGGGGGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCATCGAACACCCTGGACATTTAGTGGATATGTTTGTCCGGGGGGCA  200

seq1  TGGAACAAGCATACAGAGAGGAACAGCAGAGGCAATTTTTCCTCTAATAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAACAAGCATACAGAGAGGAACAGCAGAGGCAATTTTTCCTCTAATAC  250

seq1  ACATTCTAACATAAAAGGGAAGGGGATCAAATGATAGTGGGCAACTTGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTCTAACATAAAAGGGAAGGGGATCAAATGATAGTGGGCAACTTGAA  300

seq1  ATCTTATTTCATACTTGAAATTGCATTTCCAAATGGAATATGCTTTAATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTATTTCATACTTGAAATTGCATTTCCAAATGGAATATGCTTTAATT  350

seq1  AGACTTATGGAAATTTCTAGAAACACTTCCTCACCCTACTTCTGATCTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTTATGGAAATTTCTAGAAACACTTCCTCACCCTACTTCTGATCTTT  400

seq1  CCAGGTTCCAATCATGAAATAGTTCATTTTTAGGTCCTTTTAAAGAGCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTTCCAATCATGAAATAGTTCATTTTTAGGTCCTTTTAAAGAGCTA  450

seq1  ACTGGCTCCCAGAGAACTTCACTTTGGTACATTTCATTTATTTATTTCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGCTCCCAGAGAACTTCACTTTGGTACATTTCATTTATTTATTTCTT  500

seq1  TTTCTGAACTCTGGCTTCTGCATTCCCTGTGAAGCATTGTTTACAGAGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGAACTCTGGCTTCTGCATTCCCTGTGAAGCATTGTTTACAGAGAC  550

seq1  GGCAAAGCAAACACCTGTCATTCTTAAAACACGAGGAGTATAATTCAGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAAGCAAACACCTGTCATTCTTAAAACACGAGGAGTATAATTCAGCA  600

seq1  CCTTTTCTGTGATCACAGAATGCAATTAATCCTCTGGCTGCCTTGGTATG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTTCTGTGATCACAGAATGCAATTAATCCTCTGGCTGCCTTGGTATG  650

seq1  TAGACCAAACCTTCTGCCACAGTGTTTTGGGATGCTGCCGTCTAGGGTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACCAAACCTTCTGCCACAGTGTTTTGGGATGCTGCCGTCTAGGGTGG  700

seq1  CTCTGCCAATCTCTTCATTCCAACAGAAAGCCTGCCAGGCTTCTCCGTGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCCAATCTCTTCATTCCAACAGAAAGCCTGCCAGGCTTCTCCGTGC  750

seq1  TAAGCAAAGAATAATGAGGCAGAAGAGGGTGACTAGGGCCTCGCAGAGGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCAAAGAATAATGAGGCAGAAGAGGGTGACTAGGGCCTCGCAGAGGG  800

seq1  GATGCGCCCCTGAGACTCACTTTCCACAACACAAAGCTACCTTACTATTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCGCCCCTGAGACTCACTTTCCACAACACAAAGCTACCTTACTATTC  850

seq1  AAGTACTTTTGTTGCCCTGAACATAGGAAACTCAATTAAATTAAAATTCC  900
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AAGTACTTTTGTTGCCCTGAACATAGGAAACTCAATTAAATT-AAATTCC  899

seq1  TCTAAGAAGAAATACTGCCTCATCTCTAGCTGAGAAATGTTTTAATCTGT  950
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  TCTAAGAAGAAATACTGCCTCATCTCTAGCTGAGAAATG-TTTAATCTGT  948

seq1  AGAAG-TATAGCGTAGATGGAATAGTGGGAGAAATAATTAGAACTCAGAA  999
      ||||| ||||||||||||||||||||||   |||||||||| ||||||||
seq2  AGAAGTTATAGCGTAGATGGAATAGTGGAGAAAATAATTAG-ACTCAGAA  997

seq1  AATGTTAGGAGATCAGGGTAAGCTCAAAAAAACAAGCAGAGAACCATGCT  1049
      ||||||||||||||||||| ||||||||||||| ||||||||||||||||
seq2  AATGTTAGGAGATCAGGGTTAGCTCAAAAAAACCAGCAGAGAACCATGCT  1047

seq1  TT  1051
      ||
seq2  TT  1049

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information