MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-446J09
Chromosome	1 (Build37)
Map Location	88,154,483 - 88,154,919
singlet/doublet	singlet
Overlap gene	Armc9
Upstream gene	LOC100040213, LOC100039794, EG665338, Sp110, Sp140, Sp100, A630001G21Rik, Cab39, Itm2c, 4933407L21Rik, Gpr55, Spata3, 2810459M11Rik, Psmd1, Htr2b
Downstream gene	B3gnt7, EG383538, Ncl, Snord82, Nmur1, 1700019O17Rik, LOC100040414, Ptma, Pde6d, Cops7b, Nppc, 4930429A22Rik, EG620213, LOC208256, Akp5, Alpi, Akp3, Ecel1, 1700027L20Rik, Chrnd, Chrng, Eif4e2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 4 Proteins

name	LOC100039794 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins

name	EG665338 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665338 MGI:3644077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Sp110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109032 MGI:1923364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sp140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434484 MGI:3702467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sp100 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20684 MGI:109561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630001G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319997 MGI:2443131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 2 Proteins

name	Cab39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12283 MGI:107438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itm2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64294 MGI:1927594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933407L21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71141 MGI:1918391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Gpr55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227326 MGI:2685064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70060 MGI:1917310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	2810459M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72792 MGI:1920042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs

name	Psmd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70247 MGI:1917497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htr2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15559 MGI:109323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78795 MGI:1926045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	B3gnt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227327 MGI:2384394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383538 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383538 MGI:3647794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Ncl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17975 MGI:97286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snord82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80828 MGI:1931502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nmur1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14767 MGI:1341898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019O17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71863 MGI:1919113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins

name	LOC100040414 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Ptma (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19231 MGI:97803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde6d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18582 MGI:1270843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cops7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26895 MGI:1349388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nppc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18159 MGI:97369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930429A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208718 MGI:2442555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620213 MGI:3646897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1749 ESTs, 8 Proteins

name	LOC208256 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:208256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Akp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11650 MGI:108009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76768 MGI:1924018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11648 MGI:87984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13599 MGI:1343461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027L20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69453 MGI:1916703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 25 Proteins

name	Chrnd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11447 MGI:87893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11449 MGI:87895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4e2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100040213 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234191 GeneID:100040213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 14 ESTs, 4 Proteins product : similar to putative G-protein coupled receptor, transcript variant 2 transcript_id : XM_001474245.1

name	LOC100040213 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234189 GeneID:100040213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 4 Proteins product : similar to putative G-protein coupled receptor, transcript variant 1 transcript_id : XM_001474231.1

name	LOC100039794 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234181 GeneID:100039794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins product : similar to SP140 nuclear body protein family member transcript_id : XM_001473524.1

name	EG665338 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234187 GeneID:665338 MGI:3644077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : predicted gene, EG665338, transcript variant 2 transcript_id : XM_979370.2

name	Sp110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893021 GeneID:109032 MGI:1923364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sp110 nuclear body protein transcript_id : NM_175397.4

name	Sp140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215540 GeneID:434484 MGI:3702467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sp140 nuclear body protein transcript_id : NM_001013817.2

name	Sp100 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803419 GeneID:20684 MGI:109561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear antigen Sp100 transcript_id : NM_013673.3

name	A630001G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363793 GeneID:319997 MGI:2443131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 2 Proteins product : RIKEN cDNA A630001G21 gene, transcript variant 3 transcript_id : XM_895419.2

name	A630001G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363794 GeneID:319997 MGI:2443131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 46 ESTs, 2 Proteins product : RIKEN cDNA A630001G21 gene, transcript variant 1 transcript_id : XM_484889.4

name	Cab39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982581 GeneID:12283 MGI:107438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 39 transcript_id : NM_133781.2

name	Itm2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386544 GeneID:64294 MGI:1927594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integral membrane protein 2C transcript_id : NM_022417.2

name	4933407L21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363800 GeneID:71141 MGI:1918391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA 4933407L21 gene transcript_id : XM_976810.1

name	Gpr55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185937 GeneID:227326 MGI:2685064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 55 transcript_id : NM_001033290.2

name	Spata3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208835 GeneID:70060 MGI:1917310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 3 transcript_id : NM_027029.1

name	Spata3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803477 GeneID:70060 MGI:1917310
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 3 transcript_id : NM_028647.2

name	Spata3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801662 GeneID:70060 MGI:1917310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 3 transcript_id : NM_027300.2

name	2810459M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363804 GeneID:72792 MGI:1920042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs product : RIKEN cDNA 2810459M11 gene transcript_id : XM_484890.4

name	Psmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351621 GeneID:70247 MGI:1917497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 transcript_id : NM_027357.2

name	Htr2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130975 GeneID:15559 MGI:109323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-hydroxytryptamine (serotonin) receptor 2B transcript_id : NM_008311.2

name	Armc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637816 GeneID:78795 MGI:1926045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 9 transcript_id : NM_030184.2

name	Armc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637814 GeneID:78795 MGI:1926045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 9 transcript_id : NM_027456.1

name	B3gnt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644580 GeneID:227327 MGI:2384394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 transcript_id : NM_145222.1

name	EG383538 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363806 GeneID:383538 MGI:3647794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG383538 transcript_id : XM_357111.4

name	Ncl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875536 GeneID:17975 MGI:97286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolin transcript_id : NM_010880.3

name	Nmur1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110606 GeneID:14767 MGI:1341898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuromedin U receptor 1 transcript_id : NM_010341.1

name	1700019O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363802 GeneID:71863 MGI:1919113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins product : RIKEN cDNA 1700019O17 gene, transcript variant 1 transcript_id : XM_484891.3

name	1700019O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363803 GeneID:71863 MGI:1919113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : RIKEN cDNA 1700019O17 gene, transcript variant 2 transcript_id : XM_895919.2

name	LOC100040414 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234193 GeneID:100040414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to ribosomal protein L30 transcript_id : XM_001474704.1

name	Ptma (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130608 GeneID:19231 MGI:97803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prothymosin alpha transcript_id : NM_008972.2

name	Pde6d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982129 GeneID:18582 MGI:1270843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 6D, cGMP-specific, rod, delta transcript_id : NM_008801.2

name	Cops7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129901 GeneID:26895 MGI:1349388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 7b (Arabidopsis thaliana) transcript_id : NM_172974.2

name	Nppc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803342 GeneID:18159 MGI:97369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natriuretic peptide precursor type C transcript_id : NM_010933.3

name	4930429A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24233555 GeneID:208718 MGI:2442555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930429A22 gene transcript_id : NM_153530.1

name	EG620213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363805 GeneID:620213 MGI:3646897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1748 ESTs, 8 Proteins product : predicted gene, EG620213 transcript_id : XM_885296.2

name	Akp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244097 GeneID:11650 MGI:108009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 5 transcript_id : NM_007433.3

name	Alpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487322 GeneID:76768 MGI:1924018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase, intestinal transcript_id : NM_001081082.1

name	Akp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347478 GeneID:11648 MGI:87984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkaline phosphatase 3, intestine, not Mn requiring transcript_id : NM_007432.2

name	Ecel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254535 GeneID:13599 MGI:1343461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelin converting enzyme-like 1 transcript_id : NM_021306.2

name	1700027L20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234183 GeneID:69453 MGI:1916703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 25 Proteins product : RIKEN cDNA 1700027L20 gene transcript_id : XM_487606.5

name	Chrnd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225334 GeneID:11447 MGI:87893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, delta polypeptide transcript_id : NM_021600.2

name	Chrng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964695 GeneID:11449 MGI:87895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, gamma polypeptide transcript_id : NM_009604.3

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677505 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_023314.3

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677509 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_001039170.1

name	Eif4e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677507 GeneID:26987 MGI:1914440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E member 2 transcript_id : NM_001039169.1

name	LOC100040213 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234190 GeneID:100040213
definition	codon_start : 1 product : similar to putative G-protein coupled receptor isoform 1 protein_id : XP_001474281.1

name	LOC100040213 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234192 GeneID:100040213
definition	codon_start : 1 product : similar to putative G-protein coupled receptor isoform 2 protein_id : XP_001474295.1

name	LOC100039794 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234182 GeneID:100039794
definition	codon_start : 1 product : similar to SP140 nuclear body protein family member protein_id : XP_001473574.1

name	EG665338 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234188 GeneID:665338 MGI:3644077
definition	codon_start : 1 product : similar to HSR isoform 2 protein_id : XP_984464.2

name	Sp110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133893022 GeneID:109032 MGI:1923364
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0009617 - response to bacterium [Evidence IDA] codon_start : 1 note : interferon-induced protein 75; interferon-induced protein 75, 52kD; intracellular pathogen resistance 1 product : Sp110 nuclear body protein protein_id : NP_780606.3

name	Sp140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000674 GeneID:434484 MGI:3702467
definition	codon_start : 1 product : SP140 nuclear body protein family member protein_id : NP_001013839.1

name	Sp100 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249354 GeneID:20684 MGI:109561
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : nuclear antigen Sp100 protein_id : NP_038701.2

name	A630001G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63475945 GeneID:319997 MGI:2443131
definition	codon_start : 1 product : hypothetical protein LOC319997 isoform 1 protein_id : XP_484889.2

name	A630001G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880879 GeneID:319997 MGI:2443131
definition	codon_start : 1 product : hypothetical protein LOC319997 isoform 3 protein_id : XP_900512.1

name	Cab39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982582 CCDS:CCDS15112.1 GeneID:12283 MGI:107438
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence ISS] codon_start : 1 exception : mismatches in translation note : calcium binding protein, 39 kDa product : MO25 protein protein_id : NP_598542.2

name	Itm2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967943 GeneID:64294 MGI:1927594
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy function : expression of this gene product inhibits the growth of E. coli note : integral membrane protein 3 product : integral membrane protein 2C protein_id : NP_071862.1

name	4933407L21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363801 GeneID:71141 MGI:1918391
definition	codon_start : 1 product : hypothetical protein LOC71141 protein_id : XP_981904.1

name	Gpr55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185938 CCDS:CCDS15115.1 GeneID:227326 MGI:2685064
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 55 protein_id : NP_001028462.2

name	Spata3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312528 GeneID:70060 MGI:1917310
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; testis and spermatogenesis cell apoptosis related gene 1 product : testis and spermatogenesis cell apoptosis related protein 1 isoform 2 protein_id : NP_081576.1

name	Spata3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208842 CCDS:CCDS15116.1 GeneID:70060 MGI:1917310
definition	codon_start : 1 note : isoform 3 is encoded by transcript variant 3; testis and spermatogenesis cell apoptosis related gene 1 product : testis and spermatogenesis cell apoptosis related protein 1 isoform 3 protein_id : NP_082923.1

name	Spata3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208836 GeneID:70060 MGI:1917310
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis and spermatogenesis cell apoptosis related gene 1 product : testis and spermatogenesis cell apoptosis related protein 1 isoform 1 protein_id : NP_081305.1

name	2810459M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880946 GeneID:72792 MGI:1920042
definition	codon_start : 1 product : hypothetical protein LOC72792 protein_id : XP_484890.3

name	Psmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315975 CCDS:CCDS15117.1 GeneID:70247 MGI:1917497
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : proteasome 26S non-ATPase subunit 1 protein_id : NP_081633.1

name	Htr2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130976 GeneID:15559 MGI:109323
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004993 - serotonin receptor activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007208 - serotonin receptor, phospholipase C activating pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : 5-hydroxytryptamine (serotonin) receptor 2B protein_id : NP_032337.2

name	Armc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313490 CCDS:CCDS15118.1 GeneID:78795 MGI:1926045
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : armadillo repeat containing 9 isoform 1 protein_id : NP_084460.1

name	Armc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119637815 GeneID:78795 MGI:1926045
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : armadillo repeat containing 9 isoform 2 protein_id : NP_081732.1

name	B3gnt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644581 GeneID:227327 MGI:2384394
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008375 - acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 protein_id : NP_660257.1

name	EG383538 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363807 GeneID:383538 MGI:3647794
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357111.4

name	Ncl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875537 GeneID:17975 MGI:97286
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : nucleolin protein_id : NP_035010.3

name	Nmur1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110607 CCDS:CCDS15119.1 GeneID:14767 MGI:1341898
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008188 - neuropeptide receptor activity [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : alternative start codon product : G protein-coupled receptor 66 protein_id : NP_034471.1 transl_except : (pos:complement(88284714..88284716),aa:Met)

name	1700019O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51705178 GeneID:71863 MGI:1919113
definition	codon_start : 1 product : hypothetical protein LOC71863 isoform 1 protein_id : XP_484891.1

name	1700019O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880884 GeneID:71863 MGI:1919113
definition	codon_start : 1 product : hypothetical protein LOC71863 isoform 2 protein_id : XP_901012.1

name	LOC100040414 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234194 GeneID:100040414
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_001474754.1

name	Ptma (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110705 GeneID:19231 MGI:97803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : prothymosin alpha protein_id : NP_032998.1

name	Pde6d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679245 CCDS:CCDS15121.1 GeneID:18582 MGI:1270843
definition	GO_function : GO:0047555 - 3',5'-cyclic-GMP phosphodiesterase activity [Evidence TAS]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007602 - phototransduction [Evidence TAS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : phosphodiesterase 6D, cGMP-specific, rod, delta protein_id : NP_032827.1

name	Cops7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27764886 CCDS:CCDS15122.1 GeneID:26895 MGI:1349388
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : COP9 complex S7b product : COP9 (constitutive photomorphogenic) homolog, subunit 7b protein_id : NP_766562.1

name	Nppc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754880 CCDS:CCDS15123.1 GeneID:18159 MGI:97369
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence TAS]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IDA]; GO:0050880 - regulation of blood vessel size [Evidence IEA] codon_start : 1 note : natriuretic peptide precursor C product : natriuretic peptide precursor type C protein_id : NP_035063.1

name	4930429A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24233556 CCDS:CCDS15124.1 GeneID:208718 MGI:2442555
definition	GO_function : GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208718 protein_id : NP_705758.1

name	EG620213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82880886 GeneID:620213 MGI:3646897
definition	codon_start : 1 product : similar to ribosomal protein L6 protein_id : XP_890389.1

name	Akp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244098 CCDS:CCDS15126.1 GeneID:11650 MGI:108009
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase 5 protein_id : NP_031459.3

name	Alpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487323 GeneID:76768 MGI:1924018
definition	GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase, intestinal protein_id : NP_001074551.1

name	Akp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347479 CCDS:CCDS15127.1 GeneID:11648 MGI:87984
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004035 - alkaline phosphatase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : alkaline phosphatase 3, intestine, not Mn requiring protein_id : NP_031458.2

name	Ecel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254536 CCDS:CCDS15128.1 GeneID:13599 MGI:1343461
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IDA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : damage-induced neuronal endopeptidase protein_id : NP_067281.2

name	1700027L20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363810 GeneID:69453 MGI:1916703
definition	codon_start : 1 product : hypothetical protein LOC69453 protein_id : XP_487606.4

name	Chrnd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225335 CCDS:CCDS15129.1 GeneID:11447 MGI:87893
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor delta product : cholinergic receptor, nicotinic, delta polypeptide protein_id : NP_067611.2

name	Chrng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964696 GeneID:11449 MGI:87895
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor gamma product : cholinergic receptor, nicotinic, gamma polypeptide protein_id : NP_033734.3

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677506 CCDS:CCDS15130.1 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 3 protein_id : NP_075803.2

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677510 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 1 protein_id : NP_001034259.1

name	Eif4e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677508 CCDS:CCDS15131.1 GeneID:26987 MGI:1914440
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; eukaryotic translation initiation factor 4E like 3 product : eukaryotic translation initiation factor 4E member 2 isoform 2 protein_id : NP_001034258.1

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 1 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 2 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 3 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 4 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 5 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 6 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 7 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 8 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 9 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 10 pseudo : _no_value

name	LOC208256 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:208256
definition	number : 11 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:128693
definition	standard_name : D1Mit335

name	(CDS detail)
type	STS
link
xref	UniSTS:207185
definition	standard_name : BB236200

name	(CDS detail)
type	STS
link
xref	UniSTS:207183
definition	standard_name : BE688095

name	(CDS detail)
type	STS
link
xref	UniSTS:207182
definition	standard_name : AW822418

name	(CDS detail)
type	STS
link
xref	UniSTS:207186
definition	standard_name : BB230852

name	(CDS detail)
type	STS
link
xref	UniSTS:207184
definition	standard_name : BE692148

name	(CDS detail)
type	STS
link
xref	UniSTS:225139
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:128939
definition	standard_name : D1Mit81

name	(CDS detail)
type	STS
link
xref	UniSTS:210259
definition	standard_name : RH136266

name	(CDS detail)
type	STS
link
xref	UniSTS:165085
definition	standard_name : C78372

name	(CDS detail)
type	STS
link
xref	UniSTS:161592
definition	standard_name : RH124770

name	(CDS detail)
type	STS
link
xref	UniSTS:162566
definition	standard_name : RH125821

name	(CDS detail)
type	STS
link
xref	UniSTS:211834
definition	standard_name : RH128526

name	(CDS detail)
type	STS
link
xref	UniSTS:158821
definition	standard_name : AA960512

name	(CDS detail)
type	STS
link
xref	UniSTS:234167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158820
definition	standard_name : AU041202

name	(CDS detail)
type	STS
link
xref	UniSTS:162073
definition	standard_name : RH125251

name	(CDS detail)
type	STS
link
xref	UniSTS:152977
definition	standard_name : D11S3747

name	(CDS detail)
type	STS
link
xref	UniSTS:178426
definition	standard_name : AV377389

name	(CDS detail)
type	STS
link
xref	UniSTS:163256
definition	standard_name : AJ012488

name	(CDS detail)
type	STS
link
xref	UniSTS:143423
definition	standard_name : Htr2b

name	(CDS detail)
type	STS
link
xref	UniSTS:495966
definition	standard_name : Htr2b

name	(CDS detail)
type	STS
link
xref	UniSTS:128941
definition	standard_name : D1Mit83

name	(CDS detail)
type	STS
link
xref	UniSTS:185445
definition	standard_name : AA986695

name	(CDS detail)
type	STS
link
xref	UniSTS:257487
definition	standard_name : px-26e2

name	(CDS detail)
type	STS
link
xref	UniSTS:142252
definition	standard_name : D1Mit516

name	(CDS detail)
type	STS
link
xref	UniSTS:143994
definition	standard_name : Ncl

name	(CDS detail)
type	STS
link
xref	UniSTS:128779
definition	standard_name : D1Mit415

name	(CDS detail)
type	STS
link
xref	UniSTS:492179
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165087
definition	standard_name : AI841218

name	(CDS detail)
type	STS
link
xref	UniSTS:142285
definition	standard_name : RH125887

name	(CDS detail)
type	STS
link
xref	UniSTS:144060
definition	standard_name : Nppc

name	(CDS detail)
type	STS
link
xref	UniSTS:144061
definition	standard_name : Nppc

name	(CDS detail)
type	STS
link
xref	UniSTS:167298
definition	standard_name : D1Ertd816e

name	(CDS detail)
type	STS
link
xref	UniSTS:210453
definition	standard_name : RH136468

name	(CDS detail)
type	STS
link
xref	UniSTS:178430
definition	standard_name : C77216

name	(CDS detail)
type	STS
link
xref	UniSTS:207187
definition	standard_name : BE199888

name	(CDS detail)
type	STS
link
xref	UniSTS:271950
definition	standard_name : PMC207564P2

name	(CDS detail)
type	STS
link
xref	UniSTS:271949
definition	standard_name : PMC207564P1

name	(CDS detail)
type	STS
link
xref	UniSTS:246003
definition	standard_name : AW527169

name	(CDS detail)
type	STS
link
xref	UniSTS:158824
definition	standard_name : L10076

name	(CDS detail)
type	STS
link
xref	UniSTS:141010
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:128857
definition	standard_name : D1Mit49

name	(CDS detail)
type	STS
link
xref	UniSTS:128880
definition	standard_name : D1Mit51.1

name	(CDS detail)
type	STS
link
xref	UniSTS:128879
definition	standard_name : D1Mit51

name	(CDS detail)
type	STS
link
xref	UniSTS:141009
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:238129
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:141011
definition	standard_name : Chrng

name	(CDS detail)
type	STS
link
xref	UniSTS:178431
definition	standard_name : AV129531

name	(CDS detail)
type	STS
link
xref	UniSTS:163257
definition	standard_name : AI036339

name	Snord82 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872143 GeneID:80828 MGI:1931502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, C/D box 82 transcript_id : NR_002851.1

clone name	MSMg01-145K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-288M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522O12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-446M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-329H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-406F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-331G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-304K02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-143K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-479N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145H02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-099H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-327I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-397G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433B13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-066E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134O24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-085I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443K13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068L19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-446M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-204K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-069O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-446J09.T7 (MSMg01no446_j09.b1)	MSMg01-446J09.TJ (MSMg01no446_j09.g1)
ACC	AG535245	AG535246
length	752	739
length of high quality (start - end)	---	438 (68 - 505)
definition	CHROMAT_FILE: MSMg01no446_j09.b1 PHD_FILE: MSMg01no446_j09.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:15:09 2005	CHROMAT_FILE: MSMg01no446_j09.g1 PHD_FILE: MSMg01no446_j09.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:15:10 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TTGCGCCGCAAACGACTACTATATGCCGACTGCCCNGNATTCTCTCCTCT ACATCACACGACCACTCATCCACTCTCTCACTCCTCTCCTCCTCTTTCAC CTAAACGCGGTCATTTAACAAGACTGCCGGCGTCTAATGGGGGGGGGAAC AAGCAACCAAAAAGAGGAAAACCGGAGGAAGCGAAAGAGAAAGGGGAAAG AAAAAAAAGTTTTTTAAAGAGGGAGAAAGGGGGGAGACACGAGGAAGTAG CCCAAACACAAAACAGTTTTGTATTTAAACCCAAAACCGGCAGGAAAACG GGGTGTTGTTCACCCCCCAAGAAAGAACAAAGATACAACAGAAAAAAGAG AAGATGGGCATACCGGGTCGGTTTAATCTATCAATACTTAATTGTAGAAG AAGACCGAGGTACAAAACAGCGAGCATTAGGAAGGTAAACAGCTAAAAAT ATGAGGGGACAGGAGTTAAGTAGAAAAAACAGCACTCGACTAATACATGC AGTACGGACGATGACGATATTCGGAAAGGGAGAAGTGGGAGAAAAACCAA AAACTCGCACATTAAAATGGACGAAAACAAATAAGAGTTAGAGCGCAAAA TATCGTATAGAGCGGTGCATATGGCCCTGTATAAGCGGGCGGTAAACGAC AAGAAGTGATTTATTTTTGGGAGGATAAACGAAAAAGTGAGTAGCGTACA GAGGGAAGAAACATATGCATAAAATACAATTAAACACACAACCAGGTTGA AN	TGTCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXAGTCCCCGTGCGCTTTACCAAGTGAACTATCTC CACAGCCCCTGGAGCTAGGTACTTTATTTAGTTCACAGTTTAGGAATCAG GAAATCTAAGACCCAGTGGTCCCATTACTTCAACCACTAGTGAGGGCCGC TTGGCCCTCATGCTGTGTCATGGCATGGTAAATGGCGCCACGTACATTCA AGTGATCCAGAGCAAGTCAAGAAGCCAGCAGCCAGGGAGGGCCAGGCTTG CTCTTTGAGTTTATGTTTTTTCCTTTTTGAGGGAACCATGAGATTCCCAC AATAACTACATCAACACCTTCCCCTAGGAGGTGACACCTCGTTGACCTAA TCACCTTGCCCTAGACCCCACCTCTACAGGTCTCACCACCTCCACACTGC CAAACAAACCCTAGGGGGACATTCCCTACCTTATCTCAACCAGCCCAATA TAGGTCTGTGACCAAGTTTCAGTATCTCAGAGTCTCATGCTGATAGTTCG GCTGTGTGTTACAAGGTTCAGTGACCTCATAATGTGTATTGTTTTCCTCA ATCAGCCCTGATGTCAATATGTGCTTTGACGCATCCCAGTCGCGGGCTTT TTATTCCGAATCCGGTTGTGGCATTAACTTTATCTTTCTTAGCTATCGCT TGGTATATCTATATCCTTTTGTAAACTTTACCTCTTTAT
quality values	Open. Hide. 16 16 16 16 14 10 10 10 10 10 15 15 15 15 15 11 11 10 13 10 7 8 6 6 6 6 6 6 6 6 6 6 6 6 3 0 3 0 3 11 13 34 36 59 59 59 32 26 16 12 7 7 7 7 8 8 9 9 9 8 8 10 10 12 9 19 15 9 9 10 8 9 9 10 10 10 12 10 10 10 10 19 14 19 19 17 22 20 10 10 10 8 8 8 10 10 12 9 8 8 8 8 8 8 12 11 11 11 12 8 8 6 6 8 8 10 11 11 11 8 10 10 8 8 8 8 8 8 8 8 8 6 6 8 8 10 8 8 8 8 17 18 23 18 12 10 6 8 6 7 8 10 9 8 8 6 6 8 8 9 9 9 9 9 9 10 10 11 8 10 10 8 8 8 10 10 10 10 10 11 12 10 8 10 10 6 6 8 6 6 8 8 9 8 8 8 12 10 8 8 8 8 8 8 8 11 9 9 9 9 8 10 8 8 8 8 8 9 9 9 9 10 10 9 9 9 9 9 18 13 13 13 11 8 10 8 8 9 9 8 8 8 8 8 8 8 7 7 8 8 9 8 8 10 10 10 10 10 10 11 11 11 8 8 8 8 8 8 9 8 10 11 11 8 9 7 8 8 10 11 9 9 9 10 10 8 8 6 6 8 8 8 8 9 9 10 8 8 8 8 10 8 8 8 9 8 8 8 8 8 8 8 8 8 10 8 8 6 6 8 6 8 10 10 15 15 13 13 11 11 9 10 10 8 8 8 10 10 8 8 8 8 8 10 8 9 9 11 11 12 8 8 8 8 8 8 10 10 8 8 8 8 10 6 6 8 8 8 8 10 16 15 15 9 8 8 10 8 8 8 9 8 8 8 8 8 8 8 8 12 11 11 10 10 10 10 9 9 12 8 8 8 8 6 6 8 6 6 8 8 8 8 9 9 9 9 10 15 10 8 8 8 6 8 6 6 8 8 8 8 6 6 8 8 10 10 10 10 8 8 6 6 8 8 10 8 8 9 9 12 10 6 6 6 6 8 8 8 8 8 8 8 9 10 8 8 6 6 8 10 10 10 7 7 8 8 8 8 6 6 8 6 6 6 6 8 8 8 8 8 9 8 8 8 8 8 8 8 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 7 8 8 9 8 8 8 8 8 8 8 10 6 6 6 6 6 6 8 8 8 8 8 6 6 8 8 8 8 8 8 8 22 12 13 9 8 8 8 8 6 6 8 8 18 11 13 14 10 8 8 8 8 8 8 9 10 8 10 8 8 8 10 8 9 9 9 10 11 11 11 8 8 6 7 8 6 8 8 8 10 10 10 10 8 9 9 10 10 10 11 10 9 9 9 9 9 9 9 9 8 8 8 8 8 8 9 8 8 8 8 8 8 10 8 11 11 11 11 8 8 8 8 8 8 10 12 15 16 6 6 6 7 8 10 9 9 9 6 8 6 6 6 6 8 9 12 12 11 11 11 11 8 8 6 6 8 8 10 10 8 8 8 8 8 10 15 13 8 8 7 7 7 9 6 8 6 7 8 8 8 8 6 6 6 8 9 9 8 8 8 8 8 8 10 10 8 8 9 10 8 6 6 6 8 8 8 11 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 10 10 11 10 10 10 8 6 6 3 0	Open. Hide. 6 8 6 6 6 8 9 11 16 34 32 37 32 32 32 32 39 39 39 44 41 24 19 10 6 6 6 7 6 3 0 3 10 10 13 12 12 12 23 21 27 30 33 33 33 33 37 37 37 23 23 11 9 9 9 9 7 7 7 7 7 10 10 18 23 25 22 22 22 30 37 48 48 48 48 48 57 59 59 59 59 53 53 50 50 50 50 50 50 59 57 57 68 68 68 68 68 68 42 42 42 42 47 50 50 50 59 34 34 19 12 12 12 21 34 44 59 57 54 59 57 68 68 68 68 68 68 68 57 57 47 47 47 57 57 68 68 68 68 59 59 59 59 37 42 42 50 42 37 43 44 50 50 50 50 50 50 43 35 43 35 43 43 52 52 57 52 52 52 59 59 59 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 52 57 57 54 54 59 59 68 68 59 59 57 59 59 59 59 59 59 57 57 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 54 54 57 59 59 59 59 35 35 35 35 32 44 23 25 25 36 40 57 57 57 42 42 35 35 35 47 44 42 35 30 36 30 30 37 43 43 46 43 48 48 48 48 48 48 48 48 59 48 48 42 42 40 40 28 25 25 34 40 43 43 43 40 47 43 59 59 59 59 59 59 59 59 59 41 41 25 25 11 11 11 17 14 22 28 32 32 41 46 46 47 48 43 43 43 59 59 57 57 57 57 57 50 57 57 53 53 50 53 53 53 57 57 57 57 42 40 40 28 32 32 37 36 30 30 37 37 43 43 43 43 43 59 59 68 68 68 68 59 59 44 43 43 44 47 44 48 48 57 48 48 54 59 57 47 37 37 37 44 37 47 39 44 42 43 43 50 50 54 57 59 59 59 59 68 44 44 23 23 23 44 44 44 43 29 29 29 44 44 57 52 52 52 52 57 57 57 57 57 52 52 52 52 52 43 43 43 24 24 23 24 27 43 32 32 32 20 20 32 32 43 35 37 42 50 44 44 42 27 21 21 14 17 17 26 31 37 46 57 57 57 47 47 47 42 43 42 43 37 36 29 23 21 21 13 13 13 19 26 37 39 41 41 42 36 36 14 14 10 10 10 19 19 16 18 11 18 12 19 19 17 19 26 23 12 9 14 14 21 26 33 24 27 15 21 12 15 15 28 28 25 23 23 23 23 8 8 6 6 8 8 9 19 21 25 18 19 17 13 9 10 11 22 18 11 11 10 10 11 17 24 30 30 21 16 16 16 11 13 12 11 8 8 8 8 8 8 13 13 13 10 10 10 8 8 7 7 10 8 8 10 8 9 11 9 8 8 8 8 10 11 26 26 28 21 13 10 8 7 6 6 8 10 10 10 8 8 8 8 10 12 14 16 14 10 9 9 9 9 12 9 8 8 8 8 8 6 6 6 6 6 10 13 18 23 14 17 10 8 8 8 9 9 8 8 8 8 8 10 10 13 14 10 10 10 14 9 9 9 9 9 10 11 8 8 8 8 8 8 9 10 13 9 8 10 8 9 8 8 8 10 8 8 9 8 8 6 7 6 6 8 6 6 8 8 8 8 8 8 8 8 10 14 11 8 9 9 9 9 9 11 16 8 8 8 8 8 8 10 10 8 8 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no446_j09.g1 MSMg01no446_j09.g1 CHROMAT_FILE:
MSMg01no446_j09.g1 PHD_FILE: MSMg01no446_j09.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:15:10 2005
         (438 letters)



>mm_chr1_88154283_88155120
          Length = 838

 Score =  806 bits (417), Expect = 0.0
 Identities = 432/441 (97%), Gaps = 8/441 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   agtccccgtgcgctttaccaagtgaactatctccacagcccctggagctaggtactttat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agtccccgtgcgctttaccaagtgaactatctccacagcccctggagctaggtactttat 260

                                                                       
Query: 61  ttagttcacagtttaggaatcaggaaatctaagacccagtggtcccattacttcaaccac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 ttagttcacagtttaggaatcaggaaatctaagacccagtggtcccattacttcaaccac 320

                                                                       
Query: 121 tagtgagggccgcttggccctcatgctgtgtcatggcatggtaaatggcgccacgtacat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tagtgagggccgcttggccctcatgctgtgtcatggcatggtaaatggcgccacgtacat 380

                                                                       
Query: 181 tcaagtgatccagagcaagtcaagaagccagcagccagggagggccaggcttgctctttg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tcaagtgatccagagcaagtcaagaagccagcagccagggagggccaggcttgctctttg 440

                                                                       
Query: 241 agtttatg----ttttttcctttttgagggaaccatgagattcccacaataactacatca 296
           ||||||||    ||    ||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 441 agtttatggcaatt----cctttttgagggaacaatgagattcccacaataactacatca 496

                                                                       
Query: 297 acaccttcccctaggaggtgacacctcgttgacctaatcaccttgccctagaccccacct 356
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 497 acaccttcccctaggaggtgacacctcgttgacctaatcaccttgccctagaccccacct 556

                                                                       
Query: 357 ctacaggtctcaccacctccacactgccaaacaaaccctagggggacattccctacctta 416
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 557 ctacaggtctcaccacctccacactgccaaacaaaccctagggggacattccctacctta 616

                                
Query: 417 tctcaaccagcccaatatagg 437
           |||||||||||||||||||||
Sbjct: 617 tctcaaccagcccaatatagg 637


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 18
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 438
Length of database: 838
Length adjustment: 9
Effective length of query: 429
Effective length of database: 829
Effective search space:   355641
Effective search space used:   355641
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information