MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-457L22
Chromosome	1 (Build37)
Map Location	157,799,734 - 157,800,002
singlet/doublet	singlet
Overlap gene	Cep350
Upstream gene	LOC671336, Ier5, Mr1, Stx6, EG667867, BC034090, Xpr1, EG433367, Acbd6, Lhx4, Qscn6
Downstream gene	LOC676894, Tor1aip1, Ifrg15, Tor1aip2, A230106N23Rik, Tdrd5, Nphs2, 9430070O13Rik, LOC100038991, Soat1, LOC100039026, Abl2, Tor3a, C530043G21Rik, LOC433368, Ralgps2, Angptl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC671336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Ier5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15939 MGI:1337072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15064 MGI:1195463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58244 MGI:1926235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667867 MGI:3647325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 10 Proteins pseudo : _no_value

name	BC034090 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207792 MGI:2672904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 1 Protein

name	Xpr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19775 MGI:97932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433367 MGI:3646828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Acbd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72482 MGI:1919732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lhx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16872 MGI:101776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qscn6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104009 MGI:1330818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cep350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74081 MGI:1921331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 127 ESTs, 1 Protein

name	LOC676894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tor1aip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208263 MGI:3582693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifrg15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64164 MGI:1929890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor1aip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240832 MGI:3582695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230106N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329274 MGI:3618859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdrd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214575 MGI:2684949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 2 Proteins

name	Nphs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170484 MGI:2157018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430070O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77352 MGI:1924602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 887 ESTs, 5 Proteins

name	Soat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20652 MGI:104665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039026 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 139 ESTs, 13 Proteins

name	Abl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11352 MGI:87860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30935 MGI:1353652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530043G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215015 MGI:2443990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433368 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433368
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs

name	Ralgps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78255 MGI:1925505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72713 MGI:1919963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671336 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234346 GeneID:671336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC671336 transcript_id : XM_001480362.1

name	Ier5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754283 GeneID:15939 MGI:1337072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 5 transcript_id : NM_010500.1

name	Mr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802507 GeneID:15064 MGI:1195463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major histocompatibility complex, class I-related transcript_id : NM_008209.3

name	Stx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517496 GeneID:58244 MGI:1926235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 6 transcript_id : NM_021433.3

name	BC034090 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364024 GeneID:207792 MGI:2672904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 1 Protein product : cDNA sequence BC034090, transcript variant 1 transcript_id : XM_148974.6

name	Xpr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067118 GeneID:19775 MGI:97932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xenotropic and polytropic retrovirus receptor 1 transcript_id : NM_011273.2

name	EG433367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234312 GeneID:433367 MGI:3646828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG433367 transcript_id : XM_994738.2

name	Acbd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387798 GeneID:72482 MGI:1919732
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 6 transcript_id : NM_028250.2

name	Lhx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110668 GeneID:16872 MGI:101776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 4 transcript_id : NM_010712.1

name	Qscn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68131558 GeneID:104009 MGI:1330818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : quiescin Q6 transcript_id : NM_023268.2

name	Qscn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68131561 GeneID:104009 MGI:1330818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : quiescin Q6 transcript_id : NM_001024945.1

name	Cep350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234348 GeneID:74081 MGI:1921331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 127 ESTs, 1 Protein product : centrosomal protein 350, transcript variant 1 transcript_id : XM_129509.9

name	LOC676894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234314 GeneID:676894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to Col5a2 protein transcript_id : XM_001479176.1

name	Tor1aip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450140 GeneID:208263 MGI:3582693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin A interacting protein 1 transcript_id : NM_144791.1

name	Ifrg15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803172 GeneID:64164 MGI:1929890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon alpha responsive gene transcript_id : NM_022329.3

name	Tor1aip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048323 GeneID:240832 MGI:3582695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin A interacting protein 2 transcript_id : NM_172843.2

name	A230106N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342884 GeneID:329274 MGI:3618859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230106N23 gene transcript_id : NM_177838.2

name	Tdrd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364454 GeneID:214575 MGI:2684949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 2 Proteins product : tudor domain containing 5 transcript_id : XM_129603.6

name	Nphs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131068 GeneID:170484 MGI:2157018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nephrosis 2 homolog, podocin (human) transcript_id : NM_130456.3

name	9430070O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353474 GeneID:77352 MGI:1924602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430070O13 gene transcript_id : NM_001033180.2

name	LOC100038991 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245215 GeneID:100038991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 887 ESTs, 5 Proteins product : similar to ribosomal protein L35 transcript_id : XM_001471982.1

name	Soat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363102 GeneID:20652 MGI:104665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterol O-acyltransferase 1 transcript_id : NM_009230.3

name	LOC100039026 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245219 GeneID:100039026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 139 ESTs, 13 Proteins product : similar to Casein kinase 2, alpha 1 polypeptide transcript_id : XM_001472047.1

name	Abl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116875855 GeneID:11352 MGI:87860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) transcript_id : NM_009595.2

name	Tor3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963524 GeneID:30935 MGI:1353652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 3, member A transcript_id : NM_023141.1

name	C530043G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802861 GeneID:215015 MGI:2443990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530043G21 gene transcript_id : NM_145413.4

name	LOC433368 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245223 GeneID:433368
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs product : hypothetical LOC433368 transcript_id : XM_001472239.1

name	Ralgps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359081 GeneID:78255 MGI:1925505
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ral GEF with PH domain and SH3 binding motif 2 transcript_id : NM_023884.3

name	Angptl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792795 GeneID:72713 MGI:1919963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 1 transcript_id : NM_028333.2

name	LOC671336 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234347 GeneID:671336
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480412.1

name	Ier5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754284 CCDS:CCDS15382.1 GeneID:15939 MGI:1337072
definition	codon_start : 1 product : immediate early response 5 protein_id : NP_034630.1

name	Mr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680157 CCDS:CCDS15383.1 GeneID:15064 MGI:1195463
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : histocompatibility-2 complex class 1-like sequence; MCH class I product : histocompatibility-2 complex class 1-like protein_id : NP_032235.1

name	Stx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946800 GeneID:58244 MGI:1926235
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : syntaxin 6 protein_id : NP_067408.1

name	BC034090 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364025 GeneID:207792 MGI:2672904
definition	codon_start : 1 product : similar to mKIAA1614 protein isoform 1 protein_id : XP_148974.3

name	Xpr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755330 CCDS:CCDS15384.1 GeneID:19775 MGI:97932
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : suppressor of yeast G deletion; susceptibility to xenotropic virus; receptor for MCF virus 1; xenotropic and polytropic murine leukemia virus receptor product : xenotropic and polytropic retrovirus receptor 1 protein_id : NP_035403.1

name	EG433367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234313 GeneID:433367 MGI:3646828
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999832.2

name	Acbd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312284 CCDS:CCDS15385.1 GeneID:72482 MGI:1919732
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : acyl-Coenzyme A binding domain containing 6 protein_id : NP_082526.1

name	Lhx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110669 GeneID:16872 MGI:101776
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : transcription regulation note : LIM homeo box protein 4 product : LIM homeobox protein 4 protein_id : NP_034842.1

name	Qscn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963609 GeneID:104009 MGI:1330818
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016971 - flavin-linked sulfhydryl oxidase activity [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0016972 - thiol oxidase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : quiescin Q6 sulfhydryl oxidase 1 isoform b protein_id : NP_075757.1

name	Qscn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68131562 CCDS:CCDS15386.1 GeneID:104009 MGI:1330818
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016971 - flavin-linked sulfhydryl oxidase activity [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0016972 - thiol oxidase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : quiescin Q6 sulfhydryl oxidase 1 isoform a protein_id : NP_001020116.1

name	Cep350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149234349 GeneID:74081 MGI:1921331
definition	codon_start : 1 product : centrosome-associated protein 350 isoform 1 protein_id : XP_129509.7

name	LOC676894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234315 GeneID:676894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479226.1

name	Tor1aip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450141 CCDS:CCDS15387.1 GeneID:208263 MGI:3582693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005521 - lamin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : lamina-associated polypeptide 1B protein_id : NP_659040.1

name	Ifrg15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612513 CCDS:CCDS15388.1 GeneID:64164 MGI:1929890
definition	codon_start : 1 note : interferon alpha responsive protein (15 kDa); interferon alpha responsive gene, 15 kDa product : interferon alpha responsive protein_id : NP_071724.1

name	Tor1aip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048324 CCDS:CCDS15389.1 GeneID:240832 MGI:3582695
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : lumenal domain like LAP1 product : torsin A interacting protein 2 protein_id : NP_766431.2

name	A230106N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244410 CCDS:CCDS15390.1 GeneID:329274 MGI:3618859
definition	codon_start : 1 product : RIKEN cDNA A230106N23 protein_id : NP_808506.1

name	Tdrd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364455 GeneID:214575 MGI:2684949
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to Tudor domain-containing protein 5 protein_id : XP_129603.6 transl_except : (pos:complement(158232535..158232537),aa:OTHER) transl_except : (pos:complement(158231973..158231975),aa:OTHER) transl_except : (pos:complement(158231871..158231873),aa:OTHER) transl_except : (pos:complement(158231829..158231831),aa:OTHER) transl_except : (pos:complement(158231823..158231825),aa:OTHER) transl_except : (pos:complement(158231754..158231756),aa:OTHER) transl_except : (pos:complement(158230917..158230919),aa:OTHER) transl_except : (pos:complement(158230896..158230898),aa:OTHER) transl_except : (pos:complement(158230773..158230775),aa:OTHER) transl_except : (pos:complement(158230740..158230742),aa:OTHER) transl_except : (pos:complement(158224593..158224595),aa:OTHER) transl_except : (pos:complement(158224587..158224589),aa:OTHER) transl_except : (pos:complement(158223503..158223505),aa:OTHER) transl_except : (pos:complement(158223476..158223478),aa:OTHER) transl_except : (pos:complement(158223458..158223460),aa:OTHER) transl_except : (pos:complement(158218501..158218503),aa:OTHER) transl_except : (pos:complement(158218438..158218440),aa:OTHER) transl_except : (pos:complement(158218435..158218437),aa:OTHER) transl_except : (pos:complement(158218420..158218422),aa:OTHER) transl_except : (pos:complement(158218411..158218413),aa:OTHER) transl_except : (pos:complement(158218384..158218386),aa:OTHER) transl_except : (pos:complement(158218378..158218380),aa:OTHER) transl_except : (pos:complement(158215661..158215663),aa:OTHER) transl_except : (pos:complement(158215610..158215612),aa:OTHER) transl_except : (pos:complement(158215541..158215543),aa:OTHER) transl_except : (pos:complement(158214464..158214466),aa:OTHER) transl_except : (pos:complement(158214416..158214418),aa:OTHER) transl_except : (pos:complement(158214401..158214403),aa:OTHER) transl_except : (pos:complement(158207611..158207613),aa:OTHER) transl_except : (pos:complement(158207548..158207550),aa:OTHER) transl_except : (pos:complement(158201453..158201455),aa:OTHER) transl_except : (pos:complement(158201432..158201434),aa:OTHER) transl_except : (pos:complement(158201417..158201419),aa:OTHER) transl_except : (pos:complement(158201402..158201404),aa:OTHER) transl_except : (pos:complement(158200793..158200795),aa:OTHER) transl_except : (pos:complement(158200724..158200726),aa:OTHER) transl_except : (pos:complement(158197491..158197493),aa:OTHER) transl_except : (pos:complement(158197488..158197490),aa:OTHER) transl_except : (pos:complement(158197464..158197466),aa:OTHER) transl_except : (pos:complement(158197431..158197433),aa:OTHER) transl_except : (pos:complement(158197407..158197409),aa:OTHER) transl_except : (pos:complement(158197398..158197400),aa:OTHER) transl_except : (pos:complement(158197344..158197346),aa:OTHER) transl_except : (pos:complement(158193714..158193716),aa:OTHER) transl_except : (pos:complement(158193669..158193671),aa:OTHER) transl_except : (pos:complement(158193654..158193656),aa:OTHER) transl_except : (pos:complement(158193080..158193082),aa:OTHER) transl_except : (pos:complement(158193065..158193067),aa:OTHER) transl_except : (pos:complement(158193035..158193037),aa:OTHER) transl_except : (pos:complement(158189959..158189961),aa:OTHER) transl_except : (pos:complement(158189887..158189889),aa:OTHER) transl_except : (pos:complement(158185933..158185935),aa:OTHER) transl_except : (pos:complement(158185930..158185932),aa:OTHER) transl_except : (pos:complement(158185921..158185923),aa:OTHER) transl_except : (pos:complement(158185729..158185731),aa:OTHER)

name	Nphs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485514 CCDS:CCDS15391.1 GeneID:170484 MGI:2157018
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : nephrosis 2 homolog, podocin protein_id : NP_569723.1

name	9430070O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701604 CCDS:CCDS15392.1 GeneID:77352 MGI:1924602
definition	codon_start : 1 product : hypothetical protein LOC77352 protein_id : NP_001028352.1

name	LOC100038991 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245216 GeneID:100038991
definition	codon_start : 1 product : similar to ribosomal protein L35 protein_id : XP_001472032.1

name	Soat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84619697 GeneID:20652 MGI:104665
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004772 - sterol O-acyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IDA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : adrenocortical lipid depletion product : sterol O-acyltransferase 1 protein_id : NP_033256.2

name	LOC100039026 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245220 GeneID:100039026
definition	codon_start : 1 product : similar to Casein kinase 2, alpha 1 polypeptide protein_id : XP_001472097.1

name	Abl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116875856 CCDS:CCDS15393.1 GeneID:11352 MGI:87860
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence TAS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0007015 - actin filament organization [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : v-abl Abelson murine leukemia viral oncogene 2 protein_id : NP_033725.2

name	Tor3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963525 CCDS:CCDS15394.1 GeneID:30935 MGI:1353652
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : ATP-dependent interferon response protein note : ATP-dependant interferon responsive product : torsin family 3, member A protein_id : NP_075630.1

name	C530043G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703824 CCDS:CCDS15395.1 GeneID:215015 MGI:2443990
definition	codon_start : 1 product : hypothetical protein LOC215015 protein_id : NP_663388.1

name	LOC433368 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245224 GeneID:433368
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472289.1

name	Ralgps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560036 CCDS:CCDS15396.1 GeneID:78255 MGI:1925505
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Ral-A exchange factor RalGPS2 protein_id : NP_076373.2

name	Angptl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792796 CCDS:CCDS15397.1 GeneID:72713 MGI:1919963
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005102 - receptor binding [Evidence IPI] GO_process : GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IPI] codon_start : 1 product : angiopoietin-like 1 protein_id : NP_082609.2

name	(CDS detail)
type	STS
link
xref	UniSTS:26567
definition	standard_name : D11S4178

name	(CDS detail)
type	STS
link
xref	UniSTS:496740
definition	standard_name : Ier5

name	(CDS detail)
type	STS
link
xref	UniSTS:163266
definition	standard_name : AF010448

name	(CDS detail)
type	STS
link
xref	UniSTS:128914
definition	standard_name : D1Mit55

name	(CDS detail)
type	STS
link
xref	UniSTS:220978
definition	standard_name : RH138891

name	(CDS detail)
type	STS
link
xref	UniSTS:234237
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234236
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164133
definition	standard_name : AI845861

name	(CDS detail)
type	STS
link
xref	UniSTS:178484
definition	standard_name : AI415714

name	(CDS detail)
type	STS
link
xref	UniSTS:207231
definition	standard_name : BB254250

name	(CDS detail)
type	STS
link
xref	UniSTS:207232
definition	standard_name : AW060922

name	(CDS detail)
type	STS
link
xref	UniSTS:234242
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207230
definition	standard_name : AU022804

name	(CDS detail)
type	STS
link
xref	UniSTS:128697
definition	standard_name : D1Mit34

name	(CDS detail)
type	STS
link
xref	UniSTS:478941
definition	standard_name : D1Dcr5

name	(CDS detail)
type	STS
link
xref	UniSTS:224263
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207234
definition	standard_name : AW227612

name	(CDS detail)
type	STS
link
xref	UniSTS:162279
definition	standard_name : RH125460

name	(CDS detail)
type	STS
link
xref	UniSTS:128822
definition	standard_name : D1Mit451

name	(CDS detail)
type	STS
link
xref	UniSTS:178481
definition	standard_name : AW060462

name	(CDS detail)
type	STS
link
xref	UniSTS:234244
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234243
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162940
definition	standard_name : RH126232

name	(CDS detail)
type	STS
link
xref	UniSTS:234245
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207236
definition	standard_name : AW742543

name	(CDS detail)
type	STS
link
xref	UniSTS:128616
definition	standard_name : D1Mit267

name	(CDS detail)
type	STS
link
xref	UniSTS:466073
definition	standard_name : Tdrd5

name	(CDS detail)
type	STS
link
xref	UniSTS:207238
definition	standard_name : BB203080

name	(CDS detail)
type	STS
link
xref	UniSTS:165111
definition	standard_name : AV209277

name	(CDS detail)
type	STS
link
xref	UniSTS:273192
definition	standard_name : PMC343810P1

name	(CDS detail)
type	STS
link
xref	UniSTS:165112
definition	standard_name : AI790225

name	(CDS detail)
type	STS
link
xref	UniSTS:128672
definition	standard_name : D1Mit313

name	(CDS detail)
type	STS
link
xref	UniSTS:178480
definition	standard_name : AW550831

name	(CDS detail)
type	STS
link
xref	UniSTS:125766
definition	standard_name : U51866

name	(CDS detail)
type	STS
link
xref	UniSTS:207235
definition	standard_name : BB283609

name	(CDS detail)
type	STS
link
xref	UniSTS:128791
definition	standard_name : D1Mit425

name	(CDS detail)
type	STS
link
xref	UniSTS:234240
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161321
definition	standard_name : RH124499

name	(CDS detail)
type	STS
link
xref	UniSTS:248586
definition	standard_name : AA925877

name	(CDS detail)
type	STS
link
xref	UniSTS:123624
definition	standard_name : 24.MHAa58b12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:128476
definition	standard_name : D1Mit14

name	(CDS detail)
type	STS
link
xref	UniSTS:158869
definition	standard_name : AU043409

name	(CDS detail)
type	STS
link
xref	UniSTS:164134
definition	standard_name : AW046161

name	EG667867 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94364001 GeneID:667867 MGI:3647325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 10 Proteins product : predicted gene, EG667867 pseudo : _no_value transcript_id : XR_002254.1

clone name	MSMg01-379K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274A22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-457L22.T7 (MSMg01no457_l22.b1)	MSMg01-457L22.TJ (MSMg01no457_l22.g1)
ACC	AG543738	AG543739
length	825	785
length of high quality (start - end)	271 (55 - 325)	323 (80 - 402)
definition	CHROMAT_FILE: MSMg01no457_l22.b1 PHD_FILE: MSMg01no457_l22.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:30:04 2005	CHROMAT_FILE: MSMg01no457_l22.g1 PHD_FILE: MSMg01no457_l22.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:30:04 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NNNNAATCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX GCGCGGAATTCCAAACAATTTCCTTTTGGTTGTCAGAATATGGTACTAAA CCTATTTCCTATTTTGTAGGCTCAACCTCTAAGAATTCCTAAGAAGCTGA GCAGAGTGGCTCAAGCCTGTCTGTCACCACAGATTGCTTTGAGTTTGAGA CCAGTCTTAGATATAGATAAACCCTCTTGCAAAAAGAGAGGAGGAGAGGA GGGTGGCAGTATTAGGAAGAGGTAAGATCCTCTAAAGAGATTTGTTAAAA TTTCTTATTCTGGTCTAATTCCAGCATTTTTTTTTCAGAGGCAGACCGAT CTCTGAGAGGTCCATGCTCTGCCTGTTTCTAGAGTGAATGCCGGGCCATT CACGGCCACTCTGTTAGTGTCTTGTGCCCCCCCCCCCCCTGGTTATCTTT CTCTCGTATCTTACTCTCCCGTTTTTCCCTTACTCATTTCTGCGATTCTG TCTTCTGCTCTCTTGTCCTCTTTTTCTATACGGCTTTTCACATTTTTTTT CTCTCTTTTCTTTTCTTTTACTTTCTTCTCCTTTCATTTCCTCTTTCCTT TCCACTTTTTCTCATTATTGCCCTTGTCTTTTCTTTCTCTTTCTTGTTGT TTGTGCATCTTTGCGTTTGCTCTTCCTCGTCCTAGTTCTCCTCTCTTTTT TTTCTTCTTATTTTTTGTTCCTTTTGTCTCTCGACTTAACCTTTCTCCTT TTTTTATGTTTGTTCCTCCTCCCTTCTTGCTCTATTTTTCCTTTTTCCCG TTAATCCTTACTCCTCTATATTTCN	NNCCCCGATGCTGTGNGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGAGGCAGTTTTACCAGGAGA GTTTTACAGAGATAGGTTGGAGAAAGAACAAGCTAGACACAGGTGAAGAC AGAATGGGCCAGAGAATGAGAACAGATTGCTAGAGTTAGTTTGAGGCCAA GCATGACAATTTGGTGAGAAGTGGAAAGAAGCCAGTTTGAATCAATCAGC TTGGAGAAGAGTTTGAGCCAGAGCAGCTGAGATGAACCAGGCAGCTCGGA ACTAGAAAGGGTGAGCTGATTCAGTAAGTCTCATATTCGGAATACGTTCT AGGCCTAGGTTAGATTGTGTGGAGGTTAGAAGCTTCCAGAACCAGGCCTA GGCTAGCAGACAGAGGCAGTACTCCCCCCCACACGACCATTACTTTCGGA AAATAAGTATACTTTTACCATTTTCCCTCTGTATATCTGGCTTGTTCCTT CCATGCTCCGGGTCCTCCCTCCTGTTGGCCCCCTAAAATCTAAGGGGAAG GCTTTTTATTTTTTCTCTTCCTTTTTTCCACTCTTTTCTTTCTTCTCTTT TCTTTTTTCTCTCCCTTTTTTTTTTTTTTTGTCCTTTTTCTTCTCCTTTC TTTTTTTCTCTTCTTCCTCTCCTCTATTCTCTTTTTTTCTTTCTTTTTCC TCCTTCTTTTTCCTCTTCTCTTCTTCCCCATCCTCTCTCCCTTTTCCTCT TCTTCCTTTTTTTCTTTTTCATTCCGTTTTTTCCC
quality values	Open. Hide. 0 0 0 0 3 6 6 8 8 8 9 9 11 12 26 32 37 37 32 29 31 37 41 37 37 37 41 37 37 44 48 28 24 20 20 20 21 25 11 9 9 9 9 9 9 23 12 10 10 8 8 8 10 15 26 25 28 28 28 31 31 31 31 28 27 21 13 12 6 6 6 6 9 9 41 37 34 34 34 28 30 30 32 32 43 39 47 50 53 53 53 53 53 53 53 53 50 48 48 48 48 57 59 59 59 59 57 57 57 57 59 68 68 68 68 68 68 68 68 57 50 42 42 30 30 30 41 44 47 57 47 46 46 54 57 57 57 57 57 59 59 57 57 57 59 57 68 57 57 54 54 54 57 57 57 68 68 68 57 57 50 57 48 48 50 57 57 59 59 68 68 57 57 54 54 54 59 52 52 52 52 52 57 57 57 57 68 68 68 68 57 57 57 57 59 59 59 68 68 68 68 57 57 57 54 54 57 57 57 57 68 68 68 68 68 68 68 57 57 57 59 54 57 59 59 59 68 57 57 57 52 52 43 47 43 47 50 57 57 48 44 44 43 43 44 44 48 57 47 42 42 35 31 28 35 32 24 19 10 10 8 12 14 14 12 12 36 36 44 36 24 19 16 19 10 15 20 27 27 31 29 28 21 18 18 31 41 44 42 42 42 42 36 32 28 25 19 17 18 23 28 30 35 35 39 37 40 32 35 30 36 31 17 16 11 15 11 23 23 37 37 25 19 19 12 12 15 18 15 22 23 24 13 12 12 11 11 12 16 10 10 10 10 10 8 8 8 8 12 12 11 11 12 12 12 11 12 11 9 9 9 12 10 10 10 8 8 10 10 8 8 10 8 12 10 10 10 8 10 10 10 11 12 12 12 11 9 9 10 9 8 10 7 9 9 9 8 11 9 10 9 9 9 9 10 9 8 8 8 8 8 8 9 9 9 9 8 8 8 8 8 12 8 9 6 6 9 10 10 11 12 8 8 8 15 15 16 12 12 10 8 7 7 10 10 13 14 14 18 18 19 15 12 8 8 8 12 8 8 8 8 8 6 6 8 8 13 13 9 9 9 12 10 10 10 10 8 8 8 8 8 8 8 6 6 8 8 9 9 12 8 8 8 10 10 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 6 6 10 8 8 10 11 10 14 12 25 10 11 9 9 9 8 8 8 13 15 9 9 9 9 9 10 10 10 10 10 12 16 15 12 10 10 15 12 6 6 8 8 8 8 8 8 8 7 6 6 6 6 8 8 8 6 8 8 10 10 8 8 8 10 10 10 12 8 8 8 8 12 13 11 11 12 10 14 16 13 10 14 13 19 8 12 6 6 8 12 12 8 8 9 9 9 9 9 9 9 9 9 9 12 12 13 12 8 8 6 6 8 8 15 12 8 8 8 8 6 8 8 10 10 9 9 10 8 8 8 8 7 9 6 8 8 8 8 8 8 8 8 16 11 10 11 12 17 21 16 17 8 8 8 8 8 8 10 15 15 13 8 8 8 8 8 8 8 10 8 10 8 8 8 8 12 8 8 7 9 13 9 9 11 8 9 9 9 8 8 8 8 8 8 10 8 11 11 13 6 6 6 6 6 8 8 9 9 8 10 8 12 12 13 10 9 8 8 9 9 9 9 10 9 9 9 10 8 8 10 8 8 8 8 8 11 10 11 6 6 8 8 8 9 10 10 10 10 10 9 9 10 10 10 8 8 8 10 10 10 11 8 8 8 8 10 9 10 10 18 12 13 9 8 8 8 8 10 16 12 11 11 11 8 8 8 8 8 8 8 8 9 11 11 13 13 11 12 13 13 10 8 8 6 6 8 8 3 0	Open. Hide. 0 0 3 3 3 6 6 8 15 9 9 9 9 9 3 0 3 9 19 14 39 39 44 39 39 39 39 39 39 39 41 41 37 37 23 23 9 9 8 8 8 8 8 8 8 22 21 41 41 41 48 41 36 36 36 36 50 50 59 57 57 57 57 57 42 21 21 8 8 8 8 10 16 13 28 29 41 41 41 41 41 50 57 68 68 68 68 68 68 68 68 68 68 68 50 50 50 57 50 48 57 57 57 57 50 50 46 46 46 50 50 68 68 68 68 68 68 68 68 68 68 68 57 59 59 57 57 57 47 47 47 57 59 59 68 57 57 54 54 54 57 57 50 57 68 68 50 50 68 68 68 50 50 50 50 50 50 57 59 57 57 57 57 50 50 51 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 59 59 59 68 68 68 68 68 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 43 50 50 59 59 68 68 68 68 68 68 68 68 68 68 68 43 43 37 42 37 35 32 37 42 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 48 59 48 48 48 54 54 54 54 68 59 59 59 57 57 57 57 57 57 59 59 57 57 57 57 57 57 53 53 50 59 59 59 41 27 18 8 8 8 8 8 10 11 10 11 15 25 30 37 37 50 50 50 53 53 59 59 57 57 57 57 46 48 48 43 59 39 36 36 44 44 57 59 34 28 14 14 13 21 18 19 22 15 20 20 32 32 46 46 47 41 37 37 37 31 31 31 31 41 37 34 34 28 34 22 22 19 15 15 18 21 25 16 16 17 19 19 23 34 28 39 22 17 10 9 8 8 8 8 9 9 11 11 11 8 11 9 9 8 8 8 8 8 8 10 16 10 10 9 8 8 8 8 8 9 8 8 8 6 6 8 8 8 8 9 16 16 32 32 29 19 14 12 12 12 12 13 8 8 7 7 15 19 17 15 10 8 8 8 8 8 13 13 8 13 9 14 10 12 10 10 9 9 9 9 9 9 8 8 11 13 9 9 10 10 10 8 8 8 8 8 8 8 8 6 6 8 8 10 11 11 11 12 21 15 22 19 24 12 10 9 8 8 8 8 8 6 8 8 7 8 8 8 8 6 8 6 6 8 12 11 14 10 10 8 8 8 8 8 8 8 8 12 11 10 17 17 15 15 8 8 8 7 6 8 8 8 8 10 9 11 11 12 12 10 10 6 6 8 8 10 10 10 13 13 10 10 9 8 10 8 8 6 6 6 6 10 10 10 9 10 16 19 15 13 10 10 11 11 10 10 13 12 10 8 8 8 8 8 8 13 13 9 8 8 8 10 7 6 8 8 9 12 10 13 11 11 11 11 10 8 8 8 8 8 8 8 8 10 10 11 10 10 10 8 8 8 8 8 6 6 8 8 10 9 8 8 8 13 20 16 20 10 10 10 15 14 11 8 10 10 12 8 12 8 9 12 10 12 9 8 8 11 13 15 12 12 18 15 8 8 8 8 6 6 8 8 13 13 17 18 9 8 8 8 10 11 7 6 8 10 9 9 12 9 9 10 11 11 12 10 10 12 15 13 11 11 15 21 18 9 9 9 9 12 10 12 11 21 16 20 13 10 9 8 8 8 8 10 8 8 8 9 9 17 19 12 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no457_l22.b1 MSMg01no457_l22.b1 CHROMAT_FILE:
MSMg01no457_l22.b1 PHD_FILE: MSMg01no457_l22.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:30:04 2005
         (271 letters)



>mm_chr1_157799533_157800202
          Length = 670

 Score =  485 bits (251), Expect = e-142
 Identities = 266/271 (98%), Gaps = 3/271 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   gaattccaaacaat-ttccttttggttgtcagaatatggtactaaacctatttcctattt 60
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 gaattccaaacaatatt-cttttggttgtcagaatatggtactaaacctatttcctattt 260

                                                                       
Query: 61  tgtaggctcaacctctaagaattcctaagaagctgagcagagtggctcaagcctgtctgt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tgtaggctcaacctctaagaattcctaagaagctgagcagagtggctcaagcctgtctgt 320

                                                                       
Query: 121 caccacagattgctttgagtttgagaccagtcttagatatagataaaccctcttgcaaaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 caccacagattgctttgagtttgagaccagtcttagatatagataaaccctcttgcaaaa 380

                                                                       
Query: 181 agagaggaggagaggagggtggcagtattaggaagaggtaagatcctctaaagagatttg 240
           ||||||||||||||||||||||||| |  |||||||||||||||||||||||||||||||
Sbjct: 381 agagaggaggagaggagggtggcaggag-aggaagaggtaagatcctctaaagagatttg 439

                                          
Query: 241 ttaaaatttcttattctggtctaattccagc 271
           |||||||||||||||||||||||||||||||
Sbjct: 440 ttaaaatttcttattctggtctaattccagc 470


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 271
Length of database: 670
Length adjustment: 9
Effective length of query: 262
Effective length of database: 661
Effective search space:   173182
Effective search space used:   173182
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information