MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-491F17
Chromosome	1 (Build37)
Map Location	136,366,184 - 136,366,834
singlet/doublet	singlet
Overlap gene	Klhl12
Upstream gene	LOC667371, Snrpe, Zc3h11a, LOC667118, Lax1, Atp2b4, Optc, Prelp, LOC100042352, LOC100042358, Fmod, Btg2, EG667414, Chit1, Chi3l1, Mybph, Adora1, Myog, Ppfia4, LOC100042382, Tmem183a, 4933406M09Rik, Cyb5r1, Adipor1
Downstream gene	Rabif, 4931440L10Rik, Jarid1b, LOC100042418, Syt2, Ppp1r12b, Ube2t, Lgr6, Ptprv, LOC100042432, Ptpn7, Arl8a, Gpr37l1, LOC100043064, Elf3, Rnpep, Timm17a, Lmod1, Tmem58, Ipo9, Nav1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Snrpe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20643 MGI:98346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70579 MGI:1917829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 1 Protein

name	Lax1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240754 MGI:2443362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381290 MGI:88111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Optc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269120 MGI:2151113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prelp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116847 MGI:2151110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Fmod (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14264 MGI:1328364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12227 MGI:108384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667414 MGI:3647540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 760 ESTs, 6 Proteins

name	Chit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71884 MGI:1919134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chi3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12654 MGI:1340899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53311 MGI:1858196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adora1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11539 MGI:99401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Myog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17928 MGI:97276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppfia4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68507 MGI:1915757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein

name	LOC100042382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs

name	Tmem183a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57439 MGI:1914729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933406M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240755 MGI:3045320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72017 MGI:1919267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adipor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72674 MGI:1919924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240756 MGI:2385619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98710 MGI:2138605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931440L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71001 MGI:1918251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Jarid1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75605 MGI:1922855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Syt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20980 MGI:99666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329251 MGI:1916417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2t (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67196 MGI:1914446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329252 MGI:2441805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13924 MGI:108027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Ptpn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320139 MGI:2156893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68724 MGI:1915974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr37l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171469 MGI:1928503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043064 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 233 ESTs, 15 Proteins pseudo : _no_value

name	Elf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13710 MGI:1101781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnpep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215615 MGI:2384902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm17a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21854 MGI:1343131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93689 MGI:2135671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77552 MGI:1924802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ipo9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226432 MGI:1918944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nav1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215690 MGI:2183683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801910 GeneID:20643 MGI:98346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein E transcript_id : NM_009227.2

name	Zc3h11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378001 GeneID:70579 MGI:1917829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 11A transcript_id : NM_144530.5

name	Lax1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982125 GeneID:240754 MGI:2443362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte transmembrane adaptor 1 transcript_id : NM_172842.2

name	Atp2b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54261792 GeneID:381290 MGI:88111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 4 transcript_id : NM_213616.1

name	Optc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905106 GeneID:269120 MGI:2151113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opticin transcript_id : NM_054076.1

name	Prelp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387274 GeneID:116847 MGI:2151110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline arginine-rich end leucine-rich repeat transcript_id : NM_054077.3

name	LOC100042352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234260 GeneID:100042352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042352 transcript_id : XM_001478016.1

name	Fmod (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348716 GeneID:14264 MGI:1328364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibromodulin transcript_id : NM_021355.3

name	Btg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875511 GeneID:12227 MGI:108384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell translocation gene 2, anti-proliferative transcript_id : NM_007570.2

name	EG667414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149234317 GeneID:667414 MGI:3647540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 760 ESTs, 6 Proteins product : predicted gene, EG667414 transcript_id : XM_990438.2

name	Chit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037264 GeneID:71884 MGI:1919134
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chitinase 1 (chitotriosidase) transcript_id : NM_027979.1

name	Chi3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347793 GeneID:12654 MGI:1340899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chitinase 3-like 1 transcript_id : NM_007695.2

name	Mybph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56676317 GeneID:53311 MGI:1858196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein H transcript_id : NM_016749.2

name	Adora1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239993 GeneID:11539 MGI:99401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine A1 receptor transcript_id : NM_001039510.1

name	Adora1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239997 GeneID:11539 MGI:99401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine A1 receptor transcript_id : NM_001008533.2

name	Myog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13654246 GeneID:17928 MGI:97276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myogenin transcript_id : NM_031189.1

name	Ppfia4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94363970 GeneID:68507 MGI:1915757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein product : protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4, transcript variant 1 transcript_id : XM_129443.7

name	LOC100042382 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234264 GeneID:100042382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs product : hypothetical protein LOC100042382 transcript_id : XM_001478086.1

name	Tmem183a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809744 GeneID:57439 MGI:1914729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 183A transcript_id : NM_001042485.1

name	Tmem183a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809748 GeneID:57439 MGI:1914729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 183A transcript_id : NM_020588.2

name	4933406M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362476 GeneID:240755 MGI:3045320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933406M09 gene transcript_id : NM_173771.3

name	Cyb5r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802562 GeneID:72017 MGI:1919267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 reductase 1 transcript_id : NM_028057.2

name	Adipor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853586 GeneID:72674 MGI:1919924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adiponectin receptor 1 transcript_id : NM_028320.3

name	Klhl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130142 GeneID:240756 MGI:2385619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 12 (Drosophila) transcript_id : NM_153128.2

name	Rabif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704003 GeneID:98710 MGI:2138605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB interacting factor transcript_id : NM_145510.1

name	Jarid1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23097247 GeneID:75605 MGI:1922855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji, AT rich interactive domain 1B (Rbp2 like) transcript_id : NM_152895.1

name	LOC100042418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234267 GeneID:100042418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042418 transcript_id : XM_001478154.1

name	Syt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801663 GeneID:20980 MGI:99666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin II transcript_id : NM_009307.3

name	Ppp1r12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486802 GeneID:329251 MGI:1916417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 12B transcript_id : NM_001081307.1

name	Ube2t (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803208 GeneID:67196 MGI:1914446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2T (putative) transcript_id : NM_026024.2

name	Lgr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369014 GeneID:329252 MGI:2441805
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeat-containing G protein-coupled receptor 6 transcript_id : NM_001033409.2

name	Ptprv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328114 GeneID:13924 MGI:108027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, V transcript_id : NM_007955.2

name	LOC100042432 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149234269 GeneID:100042432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100042432 transcript_id : XM_001478190.1

name	Ptpn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130340 GeneID:320139 MGI:2156893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 7 transcript_id : NM_177081.3

name	Arl8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130256 GeneID:68724 MGI:1915974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 8A transcript_id : NM_026823.2

name	Gpr37l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794241 GeneID:171469 MGI:1928503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 37-like 1 transcript_id : NM_134438.1

name	Elf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892374 GeneID:13710 MGI:1101781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E74-like factor 3 transcript_id : NM_007921.2

name	Rnpep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353777 GeneID:215615 MGI:2384902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginyl aminopeptidase (aminopeptidase B) transcript_id : NM_145417.2

name	Timm17a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345310 GeneID:21854 MGI:1343131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 17a transcript_id : NM_011590.2

name	Lmod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948540 GeneID:93689 MGI:2135671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leiomodin 1 (smooth muscle) transcript_id : NM_053106.2

name	Tmem58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129842 GeneID:77552 MGI:1924802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 58 transcript_id : NM_175259.4

name	Ipo9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734860 GeneID:226432 MGI:1918944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : importin 9 transcript_id : NM_153774.1

name	Nav1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077104 GeneID:215690 MGI:2183683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron navigator 1 transcript_id : NM_173437.1

name	Snrpe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883844 GeneID:20643 MGI:98346
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein E protein_id : NP_033253.1

name	Zc3h11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270986 CCDS:CCDS15297.1 GeneID:70579 MGI:1917829
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger CCCH type containing 11A protein_id : NP_653113.4

name	Lax1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982126 GeneID:240754 MGI:2443362
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0050851 - antigen receptor-mediated signaling pathway [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0048305 - immunoglobulin secretion [Evidence IMP]; GO:0046649 - lymphocyte activation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : lymphocyte transmembrane adaptor 1 protein_id : NP_766430.2

name	Atp2b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261793 CCDS:CCDS15298.1 GeneID:381290 MGI:88111
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence TAS] [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : plasma membrane calcium ATPase 4 protein_id : NP_998781.1

name	Optc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905107 CCDS:CCDS15299.1 GeneID:269120 MGI:2151113
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : opticin protein_id : NP_473417.1

name	Prelp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543506 CCDS:CCDS15300.1 GeneID:116847 MGI:2151110
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proline arginine-rich end leucine-rich repeat protein_id : NP_473418.2

name	LOC100042352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234261 GeneID:100042352
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478066.1

name	Fmod (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946680 CCDS:CCDS15301.1 GeneID:14264 MGI:1328364
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : fibromodulin protein_id : NP_067330.1

name	Btg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680814 CCDS:CCDS15302.1 GeneID:12227 MGI:108384
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0030182 - neuron differentiation [Evidence ISS]; GO:0006479 - protein amino acid methylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : B-cell translocation gene 2, anti-proliferative protein_id : NP_031596.1

name	EG667414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363969 GeneID:667414 MGI:3647540
definition	codon_start : 1 product : similar to yeast ribosomal protein S28 homologue protein_id : XP_995532.1

name	Chit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037265 CCDS:CCDS15304.1 GeneID:71884 MGI:1919134
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0043169 - cation binding [Evidence IEA]; GO:0008061 - chitin binding [Evidence IEA]; GO:0004568 - chitinase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA]; GO:0045735 - nutrient reservoir activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006032 - chitin catabolism [Evidence IEA]; GO:0006030 - chitin metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0000272 - polysaccharide catabolism [Evidence IEA] codon_start : 1 product : chitinase 1 (chitotriosidase) protein_id : NP_082255.1

name	Chi3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468847 GeneID:12654 MGI:1340899
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0004568 - chitinase activity [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006032 - chitin catabolism [Evidence IEA] codon_start : 1 product : chitinase 3-like 1 protein_id : NP_031721.1

name	Mybph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56676318 GeneID:53311 MGI:1858196
definition	GO_component : GO:0005863 - striated muscle thick filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006941 - striated muscle contraction [Evidence IEA] codon_start : 1 note : myosin-binding protein H product : myosin binding protein H protein_id : NP_058029.2

name	Adora1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699444 CCDS:CCDS15305.1 GeneID:11539 MGI:99401
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adenosine A1 receptor protein_id : NP_001008533.1

name	Adora1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239994 CCDS:CCDS15305.1 GeneID:11539 MGI:99401
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adenosine A1 receptor protein_id : NP_001034599.1

name	Myog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654247 CCDS:CCDS15306.1 GeneID:17928 MGI:97276
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007517 - muscle development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007519 - striated muscle development [Evidence TAS] [Evidence IDA] codon_start : 1 product : myogenin protein_id : NP_112466.1

name	Ppfia4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94363971 GeneID:68507 MGI:1915757
definition	codon_start : 1 product : similar to mKIAA0897 protein isoform 1 protein_id : XP_129443.7

name	LOC100042382 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234265 GeneID:100042382
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478136.1

name	Tmem183a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809745 GeneID:57439 MGI:1914729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; clone MNCb-2755 product : hypothetical protein LOC57439 isoform b protein_id : NP_001035950.1

name	Tmem183a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181212 GeneID:57439 MGI:1914729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; clone MNCb-2755 product : hypothetical protein LOC57439 isoform a protein_id : NP_065613.1

name	4933406M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424635 CCDS:CCDS15307.1 GeneID:240755 MGI:3045320
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240755 protein_id : NP_776132.1

name	Cyb5r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312524 CCDS:CCDS15308.1 GeneID:72017 MGI:1919267
definition	GO_function : GO:0004128 - cytochrome-b5 reductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA] codon_start : 1 note : NAD(P)H:quinone oxidoreductase type 3, polypeptide A2 product : cytochrome b5 reductase 1 (B5R.1) protein_id : NP_082333.1

name	Adipor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259186 CCDS:CCDS15309.1 GeneID:72674 MGI:1919924
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042562 - hormone binding [Evidence ISS]; GO:0042802 - identical protein binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0019395 - fatty acid oxidation [Evidence ISS] [Evidence IDA]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : progestin and adipoQ receptor family member I product : adiponectin receptor 1 protein_id : NP_082596.2

name	Klhl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346565 GeneID:240756 MGI:2385619
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : kelch-like protein C3IP1 product : kelch-like 12 protein_id : NP_694768.1

name	Rabif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704004 CCDS:CCDS15310.1 GeneID:98710 MGI:2138605
definition	GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB-interacting factor protein_id : NP_663485.1

name	Jarid1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23097248 GeneID:75605 MGI:1922855
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative DNA/chromatin binding motif 1 product : PLU1 protein_id : NP_690855.1

name	LOC100042418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234268 GeneID:100042418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478204.1

name	Syt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543797 CCDS:CCDS15312.1 GeneID:20980 MGI:99666
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA]; GO:0042598 - vesicular fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : synaptotagmin 2 protein_id : NP_033333.2

name	Ppp1r12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486803 GeneID:329251 MGI:1916417
definition	codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 12B protein_id : NP_001074776.1

name	Ube2t (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385530 CCDS:CCDS15313.1 GeneID:67196 MGI:1914446
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2T (putative) protein_id : NP_080300.1

name	Lgr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781785 CCDS:CCDS15314.1 GeneID:329252 MGI:2441805
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016500 - protein-hormone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : leucine-rich repeat-containing G protein-coupled receptor 6 protein_id : NP_001028581.1

name	Ptprv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328115 GeneID:13924 MGI:108027
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006977 - DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest [Evidence IGI]; GO:0031571 - G1 DNA damage checkpoint [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IGI]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP] [Evidence IGI]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : embryonic stem cell phosphatase; tyrosine phosphatase product : protein tyrosine phosphatase, receptor type, V protein_id : NP_031981.2

name	LOC100042432 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149234270 GeneID:100042432
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478240.1

name	Ptpn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892997 CCDS:CCDS15315.1 GeneID:320139 MGI:2156893
definition	GO_function : GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IMP] [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase, non-receptor type 7 protein_id : NP_796055.1

name	Arl8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956194 CCDS:CCDS15316.1 GeneID:68724 MGI:1915974
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : small G protein indispensable for equal chromosome segregation 2 product : ADP-ribosylation factor-like 10B protein_id : NP_081099.1

name	Gpr37l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794242 GeneID:171469 MGI:1928503
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 37-lke 1; endothelin B receptor-like protein-2; orphan Gpr37-like protein 1 product : G protein-coupled receptor 37-like 1 protein_id : NP_602320.1

name	Elf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679629 GeneID:13710 MGI:1101781
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IMP] GO_process : GO:0009790 - embryonic development [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0009653 - morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E74-like factor 3 protein_id : NP_031947.1

name	Rnpep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703832 CCDS:CCDS15317.1 GeneID:215615 MGI:2384902
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0030601 - aminopeptidase B activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0016485 - protein processing [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : arginyl aminopeptidase (aminopeptidase B) protein_id : NP_663392.1

name	Timm17a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468943 CCDS:CCDS15318.1 GeneID:21854 MGI:1343131
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : translocator of inner mitochondrial membrane 17 kDa, a; translocator of inner mitochondrial membrane a product : translocator of inner mitochondrial membrane 17a protein_id : NP_035720.1

name	Lmod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948541 GeneID:93689 MGI:2135671
definition	codon_start : 1 product : leiomodin 1 (smooth muscle) protein_id : NP_444336.2

name	Tmem58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424906 CCDS:CCDS15319.1 GeneID:77552 MGI:1924802
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 58 protein_id : NP_780468.1

name	Ipo9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734861 GeneID:226432 MGI:1918944
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0042393 - histone binding [Evidence IDA]; GO:0008565 - protein transporter activity [Evidence ISS]; GO:0008536 - Ran GTPase binding [Evidence TAS] GO_process : GO:0006606 - protein import into nucleus [Evidence IDA]; GO:0050821 - protein stabilization [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006610 - ribosomal protein import into nucleus [Evidence ISS]; GO:0042254 - ribosome biogenesis and assembly [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Ran binding protein 9 product : importin 9 protein_id : NP_722469.1

name	Nav1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077105 GeneID:215690 MGI:2183683
definition	GO_component : GO:0015630 - microtubule cytoskeleton [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0001578 - microtubule bundle formation [Evidence IDA]; GO:0001764 - neuron migration [Evidence IMP] codon_start : 1 exception : mismatches in translation product : neuron navigator 1 protein_id : NP_775613.1

name	LOC667371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667371
definition	number : 1 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 1 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 2 pseudo : _no_value

name	LOC100042358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042358
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:128503
definition	standard_name : D1Mit164

name	(CDS detail)
type	STS
link
xref	UniSTS:165104
definition	standard_name : C76690

name	(CDS detail)
type	STS
link
xref	UniSTS:219382
definition	standard_name : RH137294

name	(CDS detail)
type	STS
link
xref	UniSTS:207216
definition	standard_name : BB238747

name	(CDS detail)
type	STS
link
xref	UniSTS:224842
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224209
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:160918
definition	standard_name : RH118245

name	(CDS detail)
type	STS
link
xref	UniSTS:270674
definition	standard_name : PMC133870P1

name	(CDS detail)
type	STS
link
xref	UniSTS:234211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:158854
definition	standard_name : AI131919

name	(CDS detail)
type	STS
link
xref	UniSTS:158853
definition	standard_name : AA959598

name	(CDS detail)
type	STS
link
xref	UniSTS:207207
definition	standard_name : AW822012

name	(CDS detail)
type	STS
link
xref	UniSTS:141196
definition	standard_name : Btg2

name	(CDS detail)
type	STS
link
xref	UniSTS:224482
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270445
definition	standard_name : PMC123230P1

name	(CDS detail)
type	STS
link
xref	UniSTS:261837
definition	standard_name : AA819837

name	(CDS detail)
type	STS
link
xref	UniSTS:271371
definition	standard_name : PMC156147P12

name	(CDS detail)
type	STS
link
xref	UniSTS:178467
definition	standard_name : AW208766

name	(CDS detail)
type	STS
link
xref	UniSTS:165102
definition	standard_name : AI848715

name	(CDS detail)
type	STS
link
xref	UniSTS:178466
definition	standard_name : AI385643

name	(CDS detail)
type	STS
link
xref	UniSTS:185452
definition	standard_name : BB176431

name	(CDS detail)
type	STS
link
xref	UniSTS:141040
definition	standard_name : Adora1

name	(CDS detail)
type	STS
link
xref	UniSTS:118308
definition	standard_name : D13Rat23

name	(CDS detail)
type	STS
link
xref	UniSTS:240089
definition	standard_name : D13Mco10

name	(CDS detail)
type	STS
link
xref	UniSTS:128477
definition	standard_name : D1Mit140

name	(CDS detail)
type	STS
link
xref	UniSTS:271960
definition	standard_name : PMC207566P7

name	(CDS detail)
type	STS
link
xref	UniSTS:143982
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:234220
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270678
definition	standard_name : PMC133893P1

name	(CDS detail)
type	STS
link
xref	UniSTS:205458
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:143983
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:463953
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:143980
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:265671
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:270709
definition	standard_name : PMC133998P4

name	(CDS detail)
type	STS
link
xref	UniSTS:271152
definition	standard_name : PMC151607P2

name	(CDS detail)
type	STS
link
xref	UniSTS:143981
definition	standard_name : Myog

name	(CDS detail)
type	STS
link
xref	UniSTS:165103
definition	standard_name : AI852265

name	(CDS detail)
type	STS
link
xref	UniSTS:158855
definition	standard_name : AI448359

name	(CDS detail)
type	STS
link
xref	UniSTS:207211
definition	standard_name : RH127096

name	(CDS detail)
type	STS
link
xref	UniSTS:247778
definition	standard_name : BF405092

name	(CDS detail)
type	STS
link
xref	UniSTS:186056
definition	standard_name : BB013868

name	(CDS detail)
type	STS
link
xref	UniSTS:207206
definition	standard_name : RH126815

name	(CDS detail)
type	STS
link
xref	UniSTS:46496
definition	standard_name : RH16184

name	(CDS detail)
type	STS
link
xref	UniSTS:495948
definition	standard_name : Adipor1

name	(CDS detail)
type	STS
link
xref	UniSTS:178468
definition	standard_name : AW549708

name	(CDS detail)
type	STS
link
xref	UniSTS:164129
definition	standard_name : AI842864

name	(CDS detail)
type	STS
link
xref	UniSTS:185453
definition	standard_name : AW556288

name	(CDS detail)
type	STS
link
xref	UniSTS:163174
definition	standard_name : RH126466

name	(CDS detail)
type	STS
link
xref	UniSTS:123710
definition	standard_name : 25.mHAa9h1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:208812
definition	standard_name : BB351896

name	(CDS detail)
type	STS
link
xref	UniSTS:125036
definition	standard_name : MDB0795

name	(CDS detail)
type	STS
link
xref	UniSTS:161908
definition	standard_name : RH125086

name	(CDS detail)
type	STS
link
xref	UniSTS:158856
definition	standard_name : AI132431

name	(CDS detail)
type	STS
link
xref	UniSTS:207220
definition	standard_name : RH126950

name	(CDS detail)
type	STS
link
xref	UniSTS:261287
definition	standard_name : BQ204841

name	(CDS detail)
type	STS
link
xref	UniSTS:207217
definition	standard_name : BB222481

name	(CDS detail)
type	STS
link
xref	UniSTS:207218
definition	standard_name : RH126629

name	(CDS detail)
type	STS
link
xref	UniSTS:124408
definition	standard_name : 41.MMHAP33FRF11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:234221
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178469
definition	standard_name : AW047233

name	(CDS detail)
type	STS
link
xref	UniSTS:128815
definition	standard_name : D1Mit445.2

name	(CDS detail)
type	STS
link
xref	UniSTS:128814
definition	standard_name : D1Mit445

name	(CDS detail)
type	STS
link
xref	UniSTS:210482
definition	standard_name : RH136499

name	(CDS detail)
type	STS
link
xref	UniSTS:240992
definition	standard_name : D4Mon28

name	(CDS detail)
type	STS
link
xref	UniSTS:165107
definition	standard_name : AI845704

name	(CDS detail)
type	STS
link
xref	UniSTS:163062
definition	standard_name : RH126354

name	(CDS detail)
type	STS
link
xref	UniSTS:186243
definition	standard_name : M-04311

name	(CDS detail)
type	STS
link
xref	UniSTS:234222
definition

name	LOC667118 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234316 GeneID:667118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 1 Protein product : similar to Zinc finger BED domain containing protein 4 transcript_id : XR_035411.1

name	4931440L10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149234266 GeneID:71001 MGI:1918251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : RIKEN cDNA 4931440L10 gene transcript_id : XR_033559.1

name	LOC100043064 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149234318 GeneID:100043064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 233 ESTs, 15 Proteins product : similar to nucleosome assembly protein 1-like 1 pseudo : _no_value transcript_id : XR_034434.1

clone name	MSMg01-521H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-491F17.T7 (MSMg01no491_f17.b1)	MSMg01-491F17.TJ (MSMg01no491_f17.g1)
ACC	AG569370	AG569371
length	745	1,618
length of high quality (start - end)	655 (40 - 694)	---
definition	CHROMAT_FILE: MSMg01no491_f17.b1 PHD_FILE: MSMg01no491_f17.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:15:15 2005	CHROMAT_FILE: MSMg01no491_f17.g1 PHD_FILE: MSMg01no491_f17.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:15:15 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CGGCCGCTATACGACTCCTATAGGTCGAGGATCCGCGGAATTCACTCTGT ATGTCCCGGCTGGCCTCGACCTCAGAAATCCACCTGCCTCTGCCTCCTGA GTACTGGGATTAAAGGCGTGCACCAACACACTGGCTGAGTTTGGAATTGT TAAGTCTTGGGCATGGTAGGCAAGTACTGTGTCACTGAACCACCCTGGAC TCAGCTCTACAGTATCTGTTCTGTGGCATTGACCTCATTTGATCCTCACA TCCTGCAGTTATCAGAAACTGTGGCTCAGAGGTAAACCCTCACACCATTG TAGGTAGTAAGTAATATAGCCAGGATTCCGATCCAGGCAAGCAGCTAGAT GCGATACCACACATCTGGATTCCAGCATACAGGAGCCAGAGCTATGAAGT TCAAAGCCATCCTATAGAAGAAACCTTGACTCAAAAAACCAACAAAAAAA GGTAAAGGAAAAATTTAAAAGCTGAGTATACTAGCTTATACCTGTATTTC CATCACATAGGCAGTATATTCAGTTTAAAACCTTCCTCTGCTACATATTG AGTACCAGACTAGCTTGGGCTGTATGAAACTCTTTCTCCAAACAACAACA ACAAAAAGAAGAAGAAGAAGAAATACTCAGAAACAAATCAGGCCATGAAT TCCCAAGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCAGAAA TCCACCTGCCTCTGCCTCCCAAGAGCTGGGATTAAGGCGTGTGCC	TGTGGGTGGGGTCTTCTGGTTNNGTGATTCTCCTGTTTCCGTGTCGNCTC TGTCTCTCACCNCNAGATACGACAGGTGGCCGGGATGCGGCAGAGNGAGG CAGAGCGGCGGCTTGTCTCCCCTCACGCGACAGACACCACACTNAGAGCG TTGAAGTGGTCTCGTAGCGCAGCGCGCTGTCGTGTGGGTGACTATGGTCG GAGTGATCGTGCGNCGGCATGCGTGCCGNCGNTNGCGCCGTGACGTGTAA CTACCGCTCGCGATCACGAGTGATGTGTTGAAGATATGTTAATAGACATG TCTAGTCATGCGCACAGTGCGAGAGACACAATAGGATTTGTCGTGTGGTA GTATGTGAGTGTATCATACTGTGAGACGCTGCATGCGAACATGCATGACG CGANGACCACCGACGANAGTACGCGCGTAACGCCTCACTCTGTCGCGCAC GCAGCCCGCACTCTACTCACACCGACCGATCGCGCAGCCTCCTCGCCCGA CGCTCCCTCTTCTCAACATACCATCATACGCGCCCGTGCATCCACACAAC ATAGTCGATCATACTGCCCACCCACACCCCTCCGCCGCCTGCCTGCTCAC CGCAGCCCACTCACCGCATACCGTCCACGACAACCACGACGTTGCGTTGA GATGGAATGATAAATCAAAAGACGGCGGAATGGCAGAAATAACCGTGAGT GGAACATGAGGTGCACCTAGCGTANGAAATGTCTGCGAGCGCCGGGAGCA GGACTAGGGAGGAACTACTAGCNGACTACCGTGCCACCGCCACCGGAGCA AGTCGCGACTGACATGACTGCGCAGACGAGCACGCAACGACGCATACCTC CGCCAGTACGACTATAGCACANTGCGACTCTTATACTCAACGCTGATACA ATCACGATCTATATACTCTTACACTCCCATTTCGTACGTTGACGTGACGA ATTCTTACTGCAGCCACGCGCCTGCGCGTCAGCCTCCCTTCGGTAGTCAC TCCTCGATCATCGCGTATGTTGACGTCCGCTCCACATGTATACTCGCTGT GCGCCTCAATATAACCTTACCGTGAGGTGTCTCGATATGGCAGCCTCATG TATGGTCTGGCCTNCTCTGCATCGTACATAATCACATATATATCACTCAG AGTGGACGCGACGCTCATCATACTCACAATTGCACTGCATATCTANCCAA CACTCATGTCACTGCTCTNCTGCATATATTTACAATAGATCGCACAGGAT GAGATGAGACGCAGCACGTTGCAGTACGCCGTCGAGAACACGCGGCAATA TCAACGAACGCTTGCTTCGATCATCCCACGACAGTCGATGAGACTGGAGT CTGCTGTCTGNCTGATAGTCTGCACTGAGGCTAGAGGCCTCGTGTACAGC AATACTATCTCGTNTGTANNGTTATAGCNATGATGACACACATCACATCG CNCGTATGCGTACGTATATCGAGTGAGTGCATGTAGGACTNCGTATGACA GTGAGNAGATAGATCGTGCACTAGCGCGCATATGATATATTATGTAGAGT AGCCGCTAGAGACTACGTAGACAAGATACANCATCNTGACATACGCTACC GCACGGTCTCTCATGCTC
quality values	Open. Hide. 14 14 21 15 14 21 16 18 18 16 16 26 34 27 21 10 11 11 24 19 12 9 9 9 9 9 9 9 10 10 10 13 16 20 20 24 20 22 19 18 28 28 29 33 33 33 59 33 28 10 10 7 7 7 7 9 9 9 9 17 19 34 28 30 32 37 35 43 43 57 36 36 36 36 37 43 44 43 50 50 50 50 50 50 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 54 48 48 41 41 57 57 57 57 57 59 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 50 50 68 68 68 68 68 68 68 68 57 57 57 57 57 57 52 52 52 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 52 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 52 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 44 43 39 27 39 23 14 14 14 14 29 39 43 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 62 62 62 68 68 68 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 62 62 57 57 57 57 59 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 57 57 59 68 59 59 57 57 59 59 59 59 68 68 59 68 59 59 57 59 59 59 59 68 68 68 68 59 59 59 59 59 59 59 57 57 54 54 54 57 57 57 57 57 52 52 52 59 59 57 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 54 57 57 59 59 68 59 59 57 57 57 57 57 57 57 57 59 57 57 48 59 59 43 42 42 28 28 23 36 36 40 44 57 59 59 54 54 54 54 54 54 54 54 57 57 57 59 54 54 54 54 54 59 57 57 42 42 36 36 36 44 43 48 48 48 43 43 43 43 43 41 41 41 43 43 48 42 42 42 41 34 34 25 22 20 34 32 37 41 31 30 37 37 37 29 32 18 18 20 28 29 37 37 37 37 33 30 22 14 14 15 17 19 32 37 33 33 33 33 37 34 34 33 27 28 31 24 28 20 24 24 28 25 32 31 31 31 31 36 37 37 39 41 39 34 34 18 18 14 14 12 17 17 16 17 19 30 37 22 17 15 15 17 26 18 18 15 17 12 16 14 14 28 22 24 32 23 16 16 21 22 22 14 14 14 24 20 25 31 24 20 23 20 16 13 13 10 10 10 11 15 12 17 14 14 12 23 19 24 19 20 20 22 22	Open. Hide. 9 10 9 9 9 9 9 9 9 9 12 8 8 8 15 15 16 8 6 7 3 0 0 3 10 8 8 8 21 8 10 11 9 6 6 10 7 6 6 8 6 6 8 6 8 3 0 3 6 6 6 6 6 8 8 8 8 9 9 9 3 0 3 0 3 8 6 6 6 6 6 6 6 8 6 6 6 6 6 6 6 6 6 8 8 8 8 8 8 11 10 11 8 8 3 0 3 8 8 8 9 13 10 12 8 6 6 6 6 8 6 6 8 8 11 10 12 12 18 14 18 10 9 10 10 10 10 8 8 8 6 6 6 6 6 8 8 8 8 8 8 6 3 0 3 6 6 6 6 6 9 9 7 8 6 6 6 6 6 6 8 8 9 6 6 6 6 8 8 8 6 6 6 6 6 6 8 8 10 11 11 12 10 9 9 9 8 8 8 8 8 8 9 10 11 11 8 8 8 8 8 8 8 9 9 6 6 6 6 8 8 10 3 0 3 8 8 9 9 8 10 10 10 8 6 8 6 3 0 3 3 0 3 0 3 9 10 9 10 9 10 9 8 10 8 8 8 6 6 6 6 6 6 10 11 13 11 11 11 10 8 8 6 6 6 6 6 6 8 8 8 9 10 8 10 11 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 7 6 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 6 6 11 7 7 7 7 8 8 8 8 8 8 8 10 8 8 10 9 10 9 8 10 8 8 8 8 9 9 10 12 10 10 8 8 6 6 8 8 8 6 6 6 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 8 6 6 6 8 8 6 6 8 8 9 9 10 10 16 10 9 7 6 6 8 8 10 8 8 8 8 8 6 6 6 6 6 8 8 3 0 3 9 8 8 6 6 6 6 8 6 10 3 0 3 11 10 10 8 8 8 8 11 10 6 6 6 6 8 8 10 10 9 10 10 10 10 10 9 8 7 8 8 8 8 8 8 8 6 6 6 6 8 8 8 6 6 6 8 8 10 11 6 6 6 6 8 8 6 8 6 6 8 8 8 6 6 6 8 12 13 8 6 6 8 10 10 12 12 12 13 11 12 10 6 6 6 6 6 6 6 6 10 8 10 9 9 10 9 8 6 6 6 6 8 8 9 6 8 6 8 8 8 10 10 10 12 10 15 6 10 6 6 6 6 9 8 8 8 8 8 8 8 8 8 8 8 13 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 13 9 9 9 9 10 10 20 12 11 10 9 8 8 8 6 6 6 6 6 6 9 9 9 9 9 8 10 8 8 8 8 11 8 8 8 8 8 8 10 8 8 6 6 6 6 9 9 8 8 8 8 8 8 8 8 8 8 8 8 11 8 8 6 6 8 6 8 10 8 8 6 6 6 6 8 6 6 10 8 11 11 8 8 8 8 8 7 8 6 6 8 8 8 6 8 6 6 10 10 8 6 6 8 8 8 8 8 8 8 10 15 13 10 8 8 6 7 8 6 7 6 6 6 8 8 6 6 6 6 6 6 8 6 10 8 8 8 8 8 8 8 14 8 8 8 8 6 6 6 9 11 11 11 3 0 3 6 6 6 8 8 8 8 10 8 8 8 8 9 9 10 13 16 14 10 8 8 8 8 8 8 8 6 8 6 6 8 6 6 6 8 6 9 9 9 9 7 7 7 7 8 3 0 3 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 10 10 8 8 8 8 8 8 6 6 6 6 8 8 10 10 10 8 8 6 8 13 10 8 6 6 8 8 8 8 6 6 8 8 7 7 10 10 9 6 8 6 6 8 6 6 8 8 8 6 6 8 6 6 6 6 6 8 9 8 8 6 6 6 6 8 3 0 3 6 6 6 6 6 6 6 6 6 6 8 6 6 6 6 8 6 6 6 6 6 6 6 10 10 10 10 10 10 11 11 10 8 8 8 13 13 10 8 8 8 7 6 8 8 10 9 6 6 8 6 6 6 6 6 6 8 10 12 6 6 6 6 8 8 10 8 6 6 6 6 8 8 6 6 6 8 6 9 9 10 12 10 6 6 6 6 8 8 6 6 6 6 8 8 10 12 8 6 6 6 6 8 8 9 8 8 8 8 7 12 7 9 10 8 8 8 6 6 6 6 7 7 11 8 8 8 8 8 8 8 6 8 6 6 8 8 8 15 12 11 10 8 8 8 8 8 8 8 8 10 8 9 9 9 9 9 7 6 6 6 6 8 8 12 12 10 10 6 6 8 8 8 8 8 8 6 6 8 8 10 10 10 9 10 9 9 9 8 8 10 8 8 8 10 6 6 7 7 10 10 10 10 10 10 9 10 10 8 8 6 6 8 6 6 6 6 6 6 11 8 8 8 10 10 10 9 9 9 9 9 9 8 8 6 6 6 7 8 3 0 3 11 10 8 8 8 8 8 8 8 11 10 8 8 6 8 6 6 8 8 10 9 9 9 10 10 8 8 8 8 10 10 8 6 6 8 6 7 7 7 8 8 8 8 8 8 8 8 8 9 8 8 6 6 6 8 8 10 11 10 10 13 8 8 6 6 6 6 6 8 8 9 6 6 6 6 7 6 8 8 3 0 3 8 9 12 10 7 6 7 8 8 8 8 8 7 7 10 6 8 7 7 9 3 0 3 6 6 7 8 6 6 8 6 6 8 6 6 8 11 9 9 9 6 6 6 6 8 6 9 8 8 8 6 6 6 6 10 10 10 8 6 6 6 6 8 8 10 10 9 8 6 6 6 6 6 6 6 6 6 10 10 10 13 10 10 8 8 8 6 6 6 6 6 6 9 10 10 9 7 10 6 6 8 6 6 6 6 8 6 6 6 8 10 8 8 8 8 8 9 11 12 8 9 9 9 8 8 8 8 8 8 8 8 10 8 8 8 8 8 10 8 6 6 6 6 10 10 8 8 6 6 7 7 8 6 6 7 8 8 10 8 8 8 8 3 0 3 8 6 6 6 6 8 8 8 8 8 11 6 6 6 6 6 6 9 10 10 10 10 10 8 8 9 8 8 8 10 7 7 8 6 6 6 6 8 6 6 6 8 6 6 6 6 6 6 9 8 3 0 3 8 8 3 0 0 3 8 8 8 8 8 8 3 0 3 8 7 6 6 6 9 8 8 8 8 8 8 8 8 10 8 8 8 6 8 3 0 3 8 10 8 8 8 8 8 8 8 8 7 7 7 6 13 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 9 10 10 10 3 0 3 12 12 10 10 9 10 10 9 9 9 9 9 3 0 3 10 10 10 8 6 6 8 6 7 9 8 6 6 6 6 6 6 11 11 9 9 9 8 8 8 8 8 8 9 11 11 8 8 8 8 8 8 8 8 10 8 8 6 6 8 10 8 10 10 10 10 6 6 6 8 6 6 9 9 6 6 6 6 7 6 8 8 8 8 8 6 6 3 0 3 7 7 3 0 3 6 6 6 6 12 8 8 8 9 10 11 8 8 8 8 10 8 8 8 10 10 9 8 6 6 6 6 6 6 8 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no491_f17.b1 MSMg01no491_f17.b1 CHROMAT_FILE:
MSMg01no491_f17.b1 PHD_FILE: MSMg01no491_f17.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:15:15 2005
         (655 letters)



>mm_chr1_136365983_136367037
          Length = 1055

 Score = 1220 bits (631), Expect = 0.0
 Identities = 648/655 (98%), Gaps = 4/655 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   attcactctgtatgtcccggctggcctcgacctcagaaatccacctgcctctgcctcctg 60
           |||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 attcactctgta-gaccaggctggcctcgacctcagaaatccacctgcctctgcctcctg 260

                                                                       
Query: 61  agtactgggattaaaggcgtgcaccaacacactggctgagtttggaattgttaagtcttg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 agtactgggattaaaggcgtgcaccaacacactggctgagtttggaattgttaagtcttg 320

                                                                       
Query: 121 ggcatggtaggcaagtactgtgtcactgaaccaccctggactcagctctacagtatctgt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 ggcatggtaggcaagtactgtgtcactgaaccaccctggactcagctctacagtatctgt 380

                                                                       
Query: 181 tctgtggcattgacctcatttgatcctcacatcctgcagttatcagaaactgtggctcag 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tctgtggcattgacctcatttgatcctcacatcctgcagttatcagaaactgtggctcag 440

                                                                       
Query: 241 aggtaaaccctcacaccattgtaggtagtaagtaatatagccaggattccgatccaggca 300
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 441 aggtaaaccctcacaccattgtaggtagtaagtaatagagccaggattccgatccaggca 500

                                                                       
Query: 301 agcagctagatgcgataccacacatctggattccagcatacaggagccagagctatgaag 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 agcagctagatgcgataccacacatctggattccagcatacaggagccagagctatgaag 560

                                                                       
Query: 361 ttcaaagccatcctatagaagaaaccttgactcaaaaaaccaacaaaaaaaggtaaagga 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ttcaaagccatcctatagaagaaaccttgactcaaaaaaccaacaaaaaaaggtaaagga 620

                                                                       
Query: 421 aaaatttaaaagctgagtatactagcttatacctgtatttccatcacataggcagtatat 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 aaaatttaaaagctgagtatactagcttatacctgtatttccatcacataggcagtatat 680

                                                                       
Query: 481 tcagtttaaaaccttcctctgctacatattgagtaccagactagcttgggctgtatgaaa 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 tcagtttaaaaccttcctctgctacatattgagtaccagactagcttgggctgtatgaaa 740

                                                                       
Query: 541 ctctttctccaaacaacaacaacaaaaagaagaagaagaagaaatactcagaaacaaatc 600
           ||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||
Sbjct: 741 ctctttctccaaacaacaacaacaaaaagaagaagaagaa---atactcagaaacaaatc 797

                                                                  
Query: 601 aggccatgaattcccaaggctgtcctggaactcactttgtagaccaggctggcct 655
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 aggccatgaattcccaaggctgtcctggaactcactttgtagaccaggctggcct 852



 Score = 72.3 bits (37), Expect = 1e-16
 Identities = 48/53 (90%), Gaps = 4/53 (7%)
 Strand = Plus / Plus

                                                                
Query: 31  cctcagaaatccacctgcctctgcctcct--gagtactgggattaaaggcgtg 81
           ||||||||||||||||||||||||||||   |||  |||||||||||||||||
Sbjct: 850 cctcagaaatccacctgcctctgcctcccaagag--ctgggattaaaggcgtg 900


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 37
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 2
Number of HSP's successfully gapped: 2
Length of query: 655
Length of database: 1055
Length adjustment: 10
Effective length of query: 645
Effective length of database: 1045
Effective search space:   674025
Effective search space used:   674025
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information