MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-515C21
Chromosome	1 (Build37)
Map Location	164,636,771 - 164,637,348
singlet/doublet	singlet
Overlap gene	Bat2d
Upstream gene	LOC100039623, LOC269134, Fasl, AI848100, EG665109, Pigc, Dnm3, LOC100039703, Dnm3os, 5630401D24Rik, Vamp4, LOC435651, Myoc
Downstream gene	Fmo4, Fmo1, Fmo2, Fmo6, Fmo3, 4921528O07Rik, Prrx1, LOC100039597, Scyl1bp1, LOC665237, Gm207
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 127 ESTs, 4 Proteins

name	LOC269134 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:269134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Fasl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14103 MGI:99255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI848100 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226551 MGI:2138346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 120 ESTs, 1 Protein

name	EG665109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665109 MGI:3643469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Pigc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67292 MGI:1914542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103967 MGI:1341299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dnm3os (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:474332 MGI:3052332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5630401D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71449 MGI:1918699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vamp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53330 MGI:1858730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 14 Proteins pseudo : _no_value

name	Myoc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17926 MGI:1202864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bat2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226562 MGI:1913754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226564 MGI:2429497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14261 MGI:1310002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55990 MGI:1916776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmo6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226565 MGI:2681841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Fmo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14262 MGI:1100496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921528O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78258 MGI:1925508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 1 Protein

name	Prrx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18933 MGI:97712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100039597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Scyl1bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98376 MGI:2138271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665237 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 1342 ESTs, 9 Proteins pseudo : _no_value

name	Gm207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240879 MGI:2685053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC100039623 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245274 GeneID:100039623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 127 ESTs, 4 Proteins product : similar to Aph1a protein transcript_id : XM_001473374.1

name	Fasl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130000 GeneID:14103 MGI:99255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas ligand (TNF superfamily, member 6) transcript_id : NM_010177.3

name	AI848100 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245255 GeneID:226551 MGI:2138346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 120 ESTs, 1 Protein product : expressed sequence AI848100 transcript_id : XM_975051.2

name	EG665109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364463 GeneID:665109 MGI:3643469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG665109 transcript_id : XM_975494.1

name	Pigc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794579 GeneID:67292 MGI:1914542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class C transcript_id : NM_026078.2

name	Pigc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794577 GeneID:67292 MGI:1914542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class C transcript_id : NM_001039045.1

name	Dnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490430 GeneID:103967 MGI:1341299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 3 transcript_id : NM_001038619.1

name	LOC100039703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149245278 GeneID:100039703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : similar to pORF2 transcript_id : XM_001473614.1

name	5630401D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21536261 GeneID:71449 MGI:1918699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5630401D24 gene transcript_id : NM_144877.1

name	Vamp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369735 GeneID:53330 MGI:1858730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 4 transcript_id : NM_016796.3

name	Myoc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560807 GeneID:17926 MGI:1202864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myocilin transcript_id : NM_010865.2

name	Bat2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486834 GeneID:226562 MGI:1913754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BAT2 domain containing 1 transcript_id : NM_001081290.1

name	Fmo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450116 GeneID:226564 MGI:2429497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flavin containing monooxygenase 4 transcript_id : NM_144878.1

name	Fmo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981773 GeneID:14261 MGI:1310002
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flavin containing monooxygenase 1 transcript_id : NM_010231.2

name	Fmo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130706 GeneID:55990 MGI:1916776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flavin containing monooxygenase 2 transcript_id : NM_018881.3

name	Fmo6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245262 GeneID:226565 MGI:2681841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : flavin containing monooxygenase 6, transcript variant 1 transcript_id : XM_136351.7

name	Fmo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679814 GeneID:14262 MGI:1100496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flavin containing monooxygenase 3 transcript_id : NM_008030.1

name	4921528O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94364485 GeneID:78258 MGI:1925508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 1 Protein product : RIKEN cDNA 4921528O07 gene transcript_id : XM_136353.5

name	Prrx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909350 GeneID:18933 MGI:97712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired related homeobox 1 transcript_id : NM_011127.2

name	Prrx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909355 GeneID:18933 MGI:97712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired related homeobox 1 transcript_id : NM_175686.3

name	Prrx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909353 GeneID:18933 MGI:97712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired related homeobox 1 transcript_id : NM_001025570.1

name	Scyl1bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372826 GeneID:98376 MGI:2138271
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SCY1-like 1 binding protein 1 transcript_id : NM_178883.4

name	Gm207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149245270 GeneID:240879 MGI:2685053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : gene model 207, (NCBI) transcript_id : XM_136356.8

name	LOC100039623 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245275 GeneID:100039623
definition	codon_start : 1 product : similar to Aph1a protein protein_id : XP_001473424.1

name	Fasl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753818 CCDS:CCDS15418.1 GeneID:14103 MGI:99255
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IGI]; GO:0006955 - immune response [Evidence IEA]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0046666 - retinal cell programmed cell death [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Fas antigen ligand; generalized lymphoproliferative disease; tumor necrosis factor (ligand) superfamily, member 6 product : Fas ligand (TNF superfamily, member 6) protein_id : NP_034307.1

name	AI848100 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364482 GeneID:226551 MGI:2138346
definition	codon_start : 1 product : membrane protein CH1 protein_id : XP_980145.1

name	EG665109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94364464 GeneID:665109 MGI:3643469
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980588.1

name	Pigc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794578 CCDS:CCDS15419.1 GeneID:67292 MGI:1914542
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : phosphatidylinositol glycan, classC protein_id : NP_001034134.1

name	Pigc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313016 CCDS:CCDS15419.1 GeneID:67292 MGI:1914542
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : phosphatidylinositol glycan, classC protein_id : NP_080354.1

name	Dnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490431 GeneID:103967 MGI:1341299
definition	EC_number : 3.6.5.5 GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : testicular dynamin; t-dynamin; Dyna III; Dynamin III product : dynamin 3 protein_id : NP_001033708.1

name	LOC100039703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149245279 GeneID:100039703
definition	codon_start : 1 product : similar to pORF2 protein_id : XP_001473664.1

name	5630401D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536262 CCDS:CCDS15420.1 GeneID:71449 MGI:1918699
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : RIKEN cDNA 5630401D24 protein_id : NP_659126.1

name	Vamp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543938 CCDS:CCDS15421.1 GeneID:53330 MGI:1858730
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : vesicle associated membrane protein 4 product : vesicle-associated membrane protein 4 protein_id : NP_058076.2

name	Myoc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560808 CCDS:CCDS15422.1 GeneID:17926 MGI:1202864
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : myocilin protein_id : NP_034995.2

name	Bat2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486835 GeneID:226562 MGI:1913754
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BAT2 domain containing 1 protein_id : NP_001074759.1

name	Fmo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450117 CCDS:CCDS15423.1 GeneID:226564 MGI:2429497
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0004499 - dimethylaniline monooxygenase (N-oxide-forming) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : flavin-containing monooxygenase 4 product : flavin containing monooxygenase 4 protein_id : NP_659127.1

name	Fmo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753890 CCDS:CCDS15424.1 GeneID:14261 MGI:1310002
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0031227 - intrinsic to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0004499 - dimethylaniline monooxygenase (N-oxide-forming) activity [Evidence IEA]; GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0050661 - NADP binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : flavin containing monooxygenase 1 protein_id : NP_034361.1

name	Fmo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542819 CCDS:CCDS15425.1 GeneID:55990 MGI:1916776
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006800 - oxygen and reactive oxygen species metabolism [Evidence IDA] codon_start : 1 product : flavin-containing monooxygenase 2 protein_id : NP_061369.2

name	Fmo6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245263 GeneID:226565 MGI:2681841
definition	codon_start : 1 product : flavin containing monooxygenase 6 isoform 1 protein_id : XP_136351.7

name	Fmo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679815 CCDS:CCDS15426.1 GeneID:14262 MGI:1100496
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0031227 - intrinsic to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0004499 - dimethylaniline monooxygenase (N-oxide-forming) activity [Evidence IEA]; GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0050661 - NADP binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : flavin containing monooxygenase 3 protein_id : NP_032056.1

name	4921528O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82883071 GeneID:78258 MGI:1925508
definition	codon_start : 1 product : hypothetical protein LOC78258 protein_id : XP_136353.4

name	Prrx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755116 CCDS:CCDS15427.1 GeneID:18933 MGI:97712
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; paired mesoderm homeobox 1 product : paired related homeobox 1 isoform a protein_id : NP_035257.1

name	Prrx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909356 CCDS:CCDS15428.1 GeneID:18933 MGI:97712
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; paired mesoderm homeobox 1 product : paired related homeobox 1 isoform b protein_id : NP_783617.2

name	Prrx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909354 GeneID:18933 MGI:97712
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; paired mesoderm homeobox 1 product : paired related homeobox 1 isoform c protein_id : NP_001020741.1

name	Scyl1bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559831 CCDS:CCDS15429.1 GeneID:98376 MGI:2138271
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : dynactin 1, isoform 1; dynactin 1 (p150, Glued (Drosophila) homolog); p150, Glued (Drosophila) homolog; 150 kDa dynein-associated polypeptide; p150-glued product : SCY1-like 1 binding protein 1 protein_id : NP_849214.2

name	Gm207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149245271 GeneID:240879 MGI:2685053
definition	codon_start : 1 product : hypothetical protein protein_id : XP_136356.8

name	LOC269134 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269134
definition	number : 1 pseudo : _no_value

name	LOC100039597 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039597
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:123114
definition	standard_name : 12.MMHAP33FLD3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:231303
definition	standard_name : MARC_7139-7140:992008251:1

name	(CDS detail)
type	STS
link
xref	UniSTS:207241
definition	standard_name : AU014768

name	(CDS detail)
type	STS
link
xref	UniSTS:233989
definition	standard_name : D1Ins1

name	(CDS detail)
type	STS
link
xref	UniSTS:143073
definition	standard_name : Tnfsf6

name	(CDS detail)
type	STS
link
xref	UniSTS:158872
definition	standard_name : U06948

name	(CDS detail)
type	STS
link
xref	UniSTS:125655
definition	standard_name : U06948

name	(CDS detail)
type	STS
link
xref	UniSTS:158871
definition	standard_name : AI848100

name	(CDS detail)
type	STS
link
xref	UniSTS:490683
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:180590
definition	standard_name : AI323415

name	(CDS detail)
type	STS
link
xref	UniSTS:207242
definition	standard_name : AI035346

name	(CDS detail)
type	STS
link
xref	UniSTS:178486
definition	standard_name : AW212108

name	(CDS detail)
type	STS
link
xref	UniSTS:211493
definition	standard_name : RH128185

name	(CDS detail)
type	STS
link
xref	UniSTS:265651
definition	standard_name : D1Pgn2

name	(CDS detail)
type	STS
link
xref	UniSTS:178487
definition	standard_name : AW061159

name	(CDS detail)
type	STS
link
xref	UniSTS:128874
definition	standard_name : D1Mit504

name	(CDS detail)
type	STS
link
xref	UniSTS:265654
definition	standard_name : D1Pgn5

name	(CDS detail)
type	STS
link
xref	UniSTS:128759
definition	standard_name : D1Mit398

name	(CDS detail)
type	STS
link
xref	UniSTS:128875
definition	standard_name : D1Mit505

name	(CDS detail)
type	STS
link
xref	UniSTS:158873
definition	standard_name : Z31360

name	(CDS detail)
type	STS
link
xref	UniSTS:472838
definition	standard_name : Dnm3os

name	(CDS detail)
type	STS
link
xref	UniSTS:128442
definition	standard_name : D1Mit106

name	(CDS detail)
type	STS
link
xref	UniSTS:128443
definition	standard_name : D1Mit107

name	(CDS detail)
type	STS
link
xref	UniSTS:224462
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234251
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162812
definition	standard_name : RH126100

name	(CDS detail)
type	STS
link
xref	UniSTS:178488
definition	standard_name : C77099

name	(CDS detail)
type	STS
link
xref	UniSTS:128760
definition	standard_name : D1Mit399

name	(CDS detail)
type	STS
link
xref	UniSTS:237022
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143975
definition	standard_name : Myoc

name	(CDS detail)
type	STS
link
xref	UniSTS:273316
definition	standard_name : PMC48141P7

name	(CDS detail)
type	STS
link
xref	UniSTS:273318
definition	standard_name : PMC48141P9

name	(CDS detail)
type	STS
link
xref	UniSTS:273317
definition	standard_name : PMC48141P8

name	(CDS detail)
type	STS
link
xref	UniSTS:273310
definition	standard_name : PMC48141P1

name	(CDS detail)
type	STS
link
xref	UniSTS:273707
definition	standard_name : PMC99941P1

name	(CDS detail)
type	STS
link
xref	UniSTS:273311
definition	standard_name : PMC48141P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273312
definition	standard_name : PMC48141P3

name	(CDS detail)
type	STS
link
xref	UniSTS:273313
definition	standard_name : PMC48141P4

name	(CDS detail)
type	STS
link
xref	UniSTS:273315
definition	standard_name : PMC48141P6

name	(CDS detail)
type	STS
link
xref	UniSTS:273314
definition	standard_name : PMC48141P5

name	(CDS detail)
type	STS
link
xref	UniSTS:158874
definition	standard_name : AF039869

name	(CDS detail)
type	STS
link
xref	UniSTS:178489
definition	standard_name : AI957332

name	(CDS detail)
type	STS
link
xref	UniSTS:207252
definition	standard_name : BE627934

name	(CDS detail)
type	STS
link
xref	UniSTS:224489
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:234253
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:218413
definition	standard_name : RH135136

name	(CDS detail)
type	STS
link
xref	UniSTS:234252
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167285
definition	standard_name : AU015216

name	(CDS detail)
type	STS
link
xref	UniSTS:245624
definition	standard_name : BI293319

name	(CDS detail)
type	STS
link
xref	UniSTS:167278
definition	standard_name : AU022372

name	(CDS detail)
type	STS
link
xref	UniSTS:224435
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:178490
definition	standard_name : AW107733

name	(CDS detail)
type	STS
link
xref	UniSTS:502659
definition	standard_name : Fmo2

name	(CDS detail)
type	STS
link
xref	UniSTS:178491
definition	standard_name : AW111792

name	(CDS detail)
type	STS
link
xref	UniSTS:128673
definition	standard_name : D1Mit314

name	(CDS detail)
type	STS
link
xref	UniSTS:128823
definition	standard_name : D1Mit452

name	(CDS detail)
type	STS
link
xref	UniSTS:178492
definition	standard_name : AA755424

name	(CDS detail)
type	STS
link
xref	UniSTS:477294
definition	standard_name : Prrx1

name	(CDS detail)
type	STS
link
xref	UniSTS:178495
definition	standard_name : AI843499

name	(CDS detail)
type	STS
link
xref	UniSTS:128876
definition	standard_name : D1Mit506

name	(CDS detail)
type	STS
link
xref	UniSTS:165113
definition	standard_name : AI385634

name	(CDS detail)
type	STS
link
xref	UniSTS:234254
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165114
definition	standard_name : AI467484

name	(CDS detail)
type	STS
link
xref	UniSTS:128480
definition	standard_name : D1Mit143

name	Dnm3os (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872167 GeneID:474332 MGI:3052332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 3, opposite strand transcript_id : NR_002870.1

name	LOC435651 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245282 GeneID:435651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 14 Proteins product : similar to oocyte-specific eukaryotic translation initiation factor 4E-like pseudo : _no_value transcript_id : XR_031375.1

name	LOC665237 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149245296 GeneID:665237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 1342 ESTs, 9 Proteins product : similar to hCG31107 pseudo : _no_value transcript_id : XR_031476.1

clone name	MSMg01-399D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-217D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275P12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135H15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-515C21.T7 (MSMg01no515_c21.b1)	MSMg01-515C21.TJ (MSMg01no515_c21.g1)
ACC	AG587482	AG587483
length	1,492	782
length of high quality (start - end)	---	578 (82 - 659)
definition	CHROMAT_FILE: MSMg01no515_c21.b1 PHD_FILE: MSMg01no515_c21.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:46:23 2005	CHROMAT_FILE: MSMg01no515_c21.g1 PHD_FILE: MSMg01no515_c21.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:46:23 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GGAGACGCGAGATTGAGATANTTGTGTNTACTCTGCGATCTTCTCTCTCT TTCCTTTATTACAATACAAAAGACGTGGTGTGCGTAGACTACTGGCCCTC TCTTTCCACCCCCATAGAAAGCGTGTAGGGTGGTTGAGGTNGCGCCGCCA TAACTCGTCTCGCGCGTACTACTCACTGCTCTCACGGTCCGTCGTTGCGA GACAAGTGAACTGAGGCGCAAATCTGATACGTTATACAGTTTGCTCGTCT CACGACTGCGATAGTTGCTGCCGCGCGTTTGCGCATCGTTAGTCGTCCTC TCTCCTCTCGAGTAGAAAGATGTGAATTGAACGTGACAGAGATCGAATAG TACGATACTGCTCTCCACTGTTCCCGATTCTTCTACGTGCTTCTGCACCT ACCTTCTACATTTAATAGAGACAGAGGTAAGAAAGCGAGTCGAACGGAAT AAAGTGGTAACTCATTATTATTAGAGGATCTAATAATCGAAGTCTACTGC ACCATAGAGCCACCATACGGACTAGAGCGGAATGCGAATGGTTCTACGAT TGTCGCGATCTGCTACCGCGTCTGTGTGCGCTACAGTGACGTCTATCTAT TCCCTTAGCCTTTCGTAGAGTCGAGCTGTCGTGAACGCTCTAATAACGCG CGNTGTGTTGATTCACGAGTCGCAGTCTCGTATTCAACATCGGACGAGCT CTGTCCGACGAGCATTTGTACGAGCGATGTACACAGTAAGTGTCAGTTAC TCAATCAGGTAATNCATATACGCACACGCTGTCATGTCGGCGTAGTTTCA CGCCGGATGGCACGTAATACACTGTACAGATATCGACGGTATCAGCTTAT TCTCAATATATATCAACATCGGCGACCGCATCAGCTACGTACACACACTC GCCGNCGTCGATCGTGCACCTCCAGTGTACGACCGCCTCGTCAATTATGT TCGTTGCCGTGGCTTGACGTGATCCCAGCGTGGCATAGTTGTCCTCCGCC GCGTGCGGTGATGTNCTCGTGACATATCTGGATTGACTTATATCTATTGC ACATGATCGGTACGCTTCGCGTTCTNTACGCTCGTCGGCTTAATGCTTCA CTGATCCAGGATATGGCGCCGTATGTTATGTCACTGCTGCATTAGAAAGA TTAAGAAGCGGGAGAGCGATTAGACAGACACGTGATCGACATGCTGCATC GGCTGCCGCGTAGCGCGCACATGTGCAGTGGCGACTCGACACTCGTCGCT TACGAATAATGATATCTCGTCGAGGCGATGACTGACACGGCTTGCACCTC TGCTANTCNCGCGCATGATTGCACGGAGAGACATGCGTCGTATAAGTACT ACGTGTCACGCGCCGTGTACGCGTGTCAGTCTCGTACTCGANGACGTCGC GAACACGACATATTCTCTGCGTTGGATGGAGTGCCGGGAGAAGTGGNCGA NGAAGTTCTGGTCTCGACGCTAGTGCAGCAGTACATCGTATN	TTTTTCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAAAGGTATTACCAACATAA CAACCTTACCCATGTGTACATATACCCCTTCACTGCAGCATTACCCCTAC AACCCCACCCCTGAATACAAAATAATGAATCCTAAGTATAAAGAGCATTG ACATTCCCCAATTAAAAATATCTTAACAAAGAGAAGAACACAGAGTATCT ATATCATTGAGTGAATGAAGAAATTATGACGATGTTACTCAGGGAAAATA AGAAAAGATAACTGTGAAACACTAATGCAGATAAGAGTTTTGCTGGTAGC AAGGGCACCAATTGTATCAGGGTACAAATATAACAACCAACCTCATTCAA GCAGAATATAGAATGAAGATTACTAGAGGGCTTAGGGCAGTCAGAAACAT GGAGATGCTGTTATAAATGATGGGGTAAACTTTCAGTCACACACTATGAA GCTCTGTATCTGTAACTGCAGATAGTAATATGGACTTGTATACTGAAGTT CTAATACACCAATTAGTTAGTATAACTAATATACTAGAGCAAGTCTATCA ATTTGCCAATCACAAATAACTATACAACATAATCACTAAAATACATCCCC ATAAAAGAAACACTAGCCATCTGGCTATCGATGAGAGTTTACACCACTGC CCATTATAAACTATCACTTTGCTTTAAAGTGTGGTTACATAGTTTCTCTA AANGATGAAGTATCATTTCTCATCACTACTAA
quality values	Open. Hide. 9 9 9 9 9 9 9 8 8 8 8 8 6 8 6 6 6 6 10 3 0 3 10 8 10 12 3 0 3 8 6 10 6 6 8 8 8 8 10 8 8 8 10 10 8 8 8 8 6 6 8 6 6 8 8 8 8 9 9 6 6 6 7 6 6 6 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 8 6 6 6 6 8 8 8 8 8 8 8 8 6 6 6 9 8 8 8 8 8 7 6 6 6 6 8 9 8 8 8 8 8 9 9 9 9 8 6 8 6 6 6 6 6 8 8 8 8 8 7 9 7 8 8 8 3 0 3 10 9 9 8 6 6 6 6 8 8 6 6 8 8 8 8 7 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 6 6 8 8 8 6 6 6 8 10 10 9 8 10 8 8 10 12 12 9 9 8 8 8 8 6 6 6 6 8 6 8 9 8 8 8 6 8 10 8 6 6 6 8 6 8 8 9 9 9 8 8 6 6 8 6 6 8 8 6 6 6 6 8 8 8 8 8 8 8 6 6 8 10 8 8 8 8 8 8 8 8 11 8 7 8 9 11 12 12 12 9 9 9 9 10 8 8 8 8 6 9 9 10 10 10 13 9 8 8 6 6 6 6 8 8 8 8 8 8 6 6 6 8 10 8 8 8 8 8 8 8 10 10 8 7 7 8 7 8 8 8 8 8 10 10 10 10 10 8 8 10 10 8 8 6 6 6 6 8 8 6 6 6 6 6 6 6 10 10 8 9 8 8 8 8 11 10 11 11 9 10 10 12 12 19 10 10 10 10 8 8 8 8 8 8 8 8 10 13 14 8 8 10 10 10 10 13 13 12 15 15 22 19 13 11 10 10 9 9 9 9 9 10 10 8 8 6 8 6 6 8 6 6 6 6 8 8 9 9 9 9 8 8 8 8 6 6 6 6 6 8 8 8 8 8 8 10 10 10 10 10 10 10 8 8 8 8 6 6 6 6 6 8 8 10 8 8 8 10 8 8 8 8 8 8 8 8 10 8 8 8 8 6 6 6 8 10 8 8 6 6 8 8 10 12 12 8 8 8 8 8 8 8 8 8 10 9 9 10 10 8 8 6 9 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 6 8 6 6 8 8 8 8 8 13 8 8 10 13 19 10 10 10 13 10 10 10 10 9 8 8 8 8 7 8 6 8 6 6 8 6 8 8 8 8 8 8 8 8 8 8 8 11 11 9 8 8 8 10 10 10 10 10 8 8 9 8 12 8 6 6 6 6 6 8 8 8 8 10 8 8 8 10 12 8 8 6 8 6 6 8 6 8 8 8 10 10 9 8 6 6 6 6 8 6 6 6 6 10 12 10 10 10 10 10 6 6 6 6 8 6 6 6 6 6 6 6 6 6 8 8 10 10 3 0 3 8 6 6 8 6 6 6 6 8 6 7 7 7 6 8 8 10 10 6 8 6 6 6 8 9 9 9 9 9 10 9 9 9 8 6 8 6 6 6 8 8 6 6 8 8 6 7 6 6 8 6 6 6 6 8 6 7 6 6 6 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 6 6 6 8 8 9 8 7 7 6 6 8 8 10 11 9 9 9 3 0 3 10 11 10 8 6 6 6 8 8 18 15 10 8 9 7 8 8 6 6 6 8 8 6 6 6 6 8 6 8 9 9 9 9 10 9 9 8 6 6 6 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 10 10 10 8 8 6 6 6 6 6 6 6 7 8 7 9 10 10 8 8 6 6 8 6 10 8 8 8 8 8 8 8 6 6 6 6 8 8 11 11 6 8 6 6 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 11 12 10 8 6 6 6 7 8 8 8 10 10 3 0 3 9 10 8 8 6 6 8 10 10 9 8 8 8 8 10 9 9 10 11 11 11 11 11 11 12 9 9 9 9 10 10 12 11 7 7 6 6 6 6 9 9 9 9 8 9 9 8 8 8 8 8 8 8 8 6 6 6 6 8 6 6 8 6 6 8 6 6 6 6 6 6 8 8 8 8 8 7 7 8 8 6 6 8 8 11 13 11 9 6 6 6 6 6 8 10 9 12 13 8 8 8 8 8 8 8 11 8 3 0 3 11 11 11 8 8 6 6 6 6 8 8 8 11 11 9 10 10 10 10 13 8 8 8 6 8 6 6 6 6 8 6 8 8 8 11 12 9 6 8 6 6 8 8 6 6 8 6 8 8 8 10 13 13 9 11 10 7 7 3 0 3 10 10 9 9 10 10 10 8 6 6 6 6 8 8 8 8 8 6 8 8 6 6 8 8 8 10 7 6 6 6 8 8 8 8 11 10 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8 8 8 9 10 8 8 8 8 6 6 6 6 8 8 6 6 6 7 6 8 8 8 8 6 6 6 6 8 8 10 11 11 11 11 11 12 12 12 11 11 10 9 8 8 8 6 6 6 6 8 8 8 6 6 8 8 10 10 8 6 6 6 8 8 10 8 6 6 6 6 6 8 8 8 8 8 8 8 8 7 8 7 9 10 12 9 9 9 9 9 7 7 7 7 8 8 8 6 6 8 8 10 8 8 6 6 8 8 7 7 9 7 12 10 8 8 8 8 8 8 13 12 18 17 11 13 10 8 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 8 10 10 10 11 12 8 11 6 6 6 6 9 7 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 10 8 3 0 3 3 0 3 9 10 9 6 7 6 6 8 8 8 8 8 8 8 13 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 15 15 8 6 6 6 6 6 10 10 10 8 9 9 10 8 8 8 8 7 7 6 6 8 6 6 8 8 6 6 6 8 7 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 3 0 3 10 10 8 6 6 6 8 8 8 8 8 6 6 6 6 8 6 6 6 8 8 8 8 8 10 13 9 9 9 10 10 6 6 6 7 11 8 6 6 8 6 8 8 8 6 8 6 6 6 6 6 6 3 0 3 8 3 0 3 7 7 7 8 8 8 8 8 8 8 8 10 10 10 11 15 7 7 6 6 6 6 9 9 10 6 8 8 6 6 6 8 8 8 8 8 10 10 3 0	Open. Hide. 7 7 7 6 6 6 6 9 13 13 11 11 9 10 7 9 9 7 12 12 22 31 37 39 39 41 41 39 39 37 32 32 37 37 37 25 25 10 9 9 9 9 9 10 10 16 16 30 25 37 32 31 32 35 30 33 33 33 37 39 59 59 59 44 44 28 19 10 15 16 20 15 28 32 34 30 30 28 28 32 35 38 42 50 59 57 57 57 57 57 53 53 47 47 47 47 47 47 51 51 42 42 50 51 68 68 68 68 51 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 48 48 48 48 50 51 68 68 68 68 68 68 68 68 50 51 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 68 68 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 68 68 62 62 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 68 68 68 68 68 68 68 68 59 59 59 59 59 59 68 68 59 59 68 68 68 68 68 59 59 59 68 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 50 50 48 59 57 59 59 59 59 59 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 59 59 57 59 59 57 57 57 57 57 57 59 48 48 48 48 48 54 44 44 57 57 59 59 59 54 54 57 59 59 68 68 54 50 50 50 57 59 59 43 43 43 59 44 57 48 59 59 48 48 48 48 48 48 40 40 40 41 39 39 32 27 25 30 30 37 37 40 40 40 40 44 43 42 40 41 41 47 30 24 16 16 16 24 30 39 39 34 34 25 25 25 34 34 41 39 32 39 39 35 32 35 39 34 37 30 30 30 30 27 30 10 9 8 12 8 12 16 23 25 24 21 16 14 21 28 37 34 34 23 23 20 25 25 25 25 30 24 23 11 11 11 21 16 29 34 32 28 23 22 20 23 23 34 28 22 22 22 24 18 20 19 19 11 12 11 16 21 28 28 28 28 28 29 26 33 28 28 24 16 10 10 10 10 8 9 10 10 10 11 12 13 12 14 12 18 11 12 12 15 12 15 8 8 8 6 6 3 0 3 8 9 31 14 12 10 10 11 22 21 30 19 23 17 14 14 14 15 15 11 12 12 21 18 18 18 19 17

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no515_c21.g1 MSMg01no515_c21.g1 CHROMAT_FILE:
MSMg01no515_c21.g1 PHD_FILE: MSMg01no515_c21.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:46:23 2005
         (578 letters)



>mm_chr1_164636571_164637548
          Length = 978

 Score = 1087 bits (562), Expect = 0.0
 Identities = 574/578 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaaggtattaccaacataacaaccttacccatgtgtacatataccccttcactgcagcat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 aaaggtattaccaacataacaaccttacccatgtgtacatataccccttcactgcagcat 260

                                                                       
Query: 61  tacccctacaaccccacccctgaatacaaaataatgaatcctaagtataaagagcattga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 261 tacccctacaaccccacccctgaatacaaaataatgaatcctaagtataaagaacattga 320

                                                                       
Query: 121 cattccccaattaaaaatatcttaacaaagagaagaacacagagtatctatatcattgag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cattccccaattaaaaatatcttaacaaagagaagaacacagagtatctatatcattgag 380

                                                                       
Query: 181 tgaatgaagaaattatgacgatgttactcagggaaaataagaaaagataactgtgaaaca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tgaatgaagaaattatgacgatgttactcagggaaaataagaaaagataactgtgaaaca 440

                                                                       
Query: 241 ctaatgcagataagagttttgctggtagcaagggcaccaattgtatcagggtacaaatat 300
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 441 ctaatgcagataagagttttgctggtagcaagggcaccaattgtatcagggtgcaaatat 500

                                                                       
Query: 301 aacaaccaacctcattcaagcagaatatagaatgaagattactagagggcttagggcagt 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 aacaaccaacctcattcaagcagaatatagaatgaagattactagagggcttagggcagt 560

                                                                       
Query: 361 cagaaacatggagatgctgttataaatgatggggtaaactttcagtcacacactatgaag 420
           ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 561 cagaaacgtggagatgctgttataaatgatggggtaaactttcagtcacacaatatgaag 620

                                                                       
Query: 421 ctctgtatctgtaactgcagatagtaatatggacttgtatactgaagttctaatacacca 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 ctctgtatctgtaactgcagatagtaatatggacttgtatactgaagttctaatacacca 680

                                                                       
Query: 481 attagttagtataactaatatactagagcaagtctatcaatttgccaatcacaaataact 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 attagttagtataactaatatactagagcaagtctatcaatttgccaatcacaaataact 740

                                                 
Query: 541 atacaacataatcactaaaatacatccccataaaagaa 578
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 741 atacaacataatcactaaaatacatccccataaaagaa 778


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 26
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 578
Length of database: 978
Length adjustment: 10
Effective length of query: 568
Effective length of database: 968
Effective search space:   549824
Effective search space used:   549824
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information