MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-122J13
Chromosome	10 (Build37)
Map Location	85,331,086 - 85,331,855
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Rfx4, Ric8b, Fhl4, AI597468, Mterfd3, Cry1, EG666974, Btbd11, EG626858, LOC626878, LOC669723, LOC626940
Downstream gene	Pwp1, Prdm4, Ascl4, D10Wsu52e, Bpil2, Fbxo7, Syn3, Timp3, EG627035, LOC672902, LOC100041419, EG382395, Hsp90b1, Nt5dc3, Fabp3-ps1, C630002B14Rik, Stab2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rfx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71137 MGI:1918387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ric8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237422 MGI:2682307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fhl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14202 MGI:1338765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI597468 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103266 MGI:2143652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mterfd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74238 MGI:1921488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cry1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12952 MGI:1270841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666974 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666974 MGI:3647964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 389 ESTs, 7 Proteins

name	Btbd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74007 MGI:1921257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG626858 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626858 MGI:3645890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 69 Proteins

name	LOC626878 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC669723 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC626940 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 Proteins pseudo : _no_value

name	Pwp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103136 MGI:1914735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prdm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72843 MGI:1920093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ascl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67341 MGI:1914591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	D10Wsu52e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28088 MGI:106379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bpil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270757 MGI:3026884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69754 MGI:1917004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27204 MGI:1351334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21859 MGI:98754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627035 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627035 MGI:3646339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 Proteins

name	LOC672902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG382395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382395 MGI:3646116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 73 Proteins

name	Hsp90b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22027 MGI:98817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5dc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103220 MGI:3513266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Fabp3-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14074 MGI:101929
definition	gene_synonym : Fabph-3; Fabph-ps1; Fabph3 note : fatty acid binding protein 3, muscle and heart, pseudogene 1 pseudo : _no_value

name	C630002B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103466 MGI:2143852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stab2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192188 MGI:2178743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906190 GeneID:71137 MGI:1918387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X, 4 (influences HLA class II expression) transcript_id : NM_001024918.1

name	Rfx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892183 GeneID:71137 MGI:1918387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X, 4 (influences HLA class II expression) transcript_id : NM_027689.3

name	Ric8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147208 GeneID:237422 MGI:2682307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) transcript_id : NM_183172.1

name	Ric8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61806724 GeneID:237422 MGI:2682307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) transcript_id : NM_001013441.1

name	Fhl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802955 GeneID:14202 MGI:1338765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : four and a half LIM domains 4 transcript_id : NM_010214.3

name	AI597468 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61557490 GeneID:103266 MGI:2143652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI597468 transcript_id : NM_001013028.1

name	Mterfd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388641 GeneID:74238 MGI:1921488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MTERF domain containing 3 transcript_id : NM_028832.2

name	Cry1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742745 GeneID:12952 MGI:1270841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cryptochrome 1 (photolyase-like) transcript_id : NM_007771.3

name	EG666974 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388525 GeneID:666974 MGI:3647964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 389 ESTs, 7 Proteins product : predicted gene, EG666974, transcript variant 2 transcript_id : XM_001002751.1

name	Btbd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62953117 GeneID:74007 MGI:1921257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 11 transcript_id : NM_028709.1

name	Btbd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62953119 GeneID:74007 MGI:1921257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 11 transcript_id : NM_001017525.1

name	EG626858 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260990 GeneID:626858 MGI:3645890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 69 Proteins product : predicted gene, EG626858 transcript_id : XM_891465.2

name	Pwp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386883 GeneID:103136 MGI:1914735
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PWP1 homolog (S. cerevisiae) transcript_id : NM_133993.2

name	Prdm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676180 GeneID:72843 MGI:1920093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PR domain containing 4 transcript_id : NM_181650.2

name	Ascl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260995 GeneID:67341 MGI:1914591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : achaete-scute complex homolog 4 (Drosophila) transcript_id : XM_986783.2

name	D10Wsu52e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370951 GeneID:28088 MGI:106379
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, Wayne State University 52, expressed transcript_id : NM_145422.2

name	Bpil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802277 GeneID:270757 MGI:3026884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bactericidal/permeability-increasing protein-like 2 transcript_id : NM_177772.3

name	Fbxo7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686125 GeneID:69754 MGI:1917004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 7 transcript_id : NM_153195.2

name	Syn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378140 GeneID:27204 MGI:1351334
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synapsin III transcript_id : NM_013722.2

name	Timp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637812 GeneID:21859 MGI:98754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue inhibitor of metalloproteinase 3 transcript_id : NM_011595.2

name	EG627035 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83027556 GeneID:627035 MGI:3646339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 Proteins product : predicted gene, EG627035 transcript_id : XM_891676.1

name	EG382395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388519 GeneID:382395 MGI:3646116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 73 Proteins product : predicted gene, EG382395 transcript_id : XM_487135.3

name	Hsp90b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755862 GeneID:22027 MGI:98817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 90kDa beta (Grp94), member 1 transcript_id : NM_011631.1

name	Nt5dc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556238 GeneID:103220 MGI:3513266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase domain containing 3 transcript_id : NM_001003939.1

name	Nt5dc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491846 GeneID:103220 MGI:3513266
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase domain containing 3 transcript_id : NM_001003910.1

name	Nt5dc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491877 GeneID:103220 MGI:3513266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase domain containing 3 transcript_id : NM_153595.2

name	C630002B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494222 GeneID:103466 MGI:2143852
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C630002B14 gene transcript_id : NM_175331.3

name	Stab2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801480 GeneID:192188 MGI:2178743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stabilin 2 transcript_id : NM_138673.2

name	Rfx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906191 CCDS:CCDS24082.1 GeneID:71137 MGI:1918387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; winged-helix transcription factor RFX4 product : regulatory factor X, 4 isoform 1 protein_id : NP_001020089.1

name	Rfx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906189 CCDS:CCDS24083.1 GeneID:71137 MGI:1918387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; winged-helix transcription factor RFX4 product : regulatory factor X, 4 isoform 2 protein_id : NP_081965.2

name	Ric8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147209 CCDS:CCDS24085.1 GeneID:237422 MGI:2682307
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; resistance to inhibitors of cholinesterase 8B product : resistance to inhibitors of cholinesterase 8B isoform 2 protein_id : NP_898995.1

name	Ric8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61806725 CCDS:CCDS24084.1 GeneID:237422 MGI:2682307
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; resistance to inhibitors of cholinesterase 8B product : resistance to inhibitors of cholinesterase 8B isoform 1 protein_id : NP_001013459.1

name	Fhl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560590 CCDS:CCDS24086.1 GeneID:14202 MGI:1338765
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : four and a half LIM domains 4 protein_id : NP_034344.2

name	AI597468 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61557491 CCDS:CCDS24087.1 GeneID:103266 MGI:2143652
definition	codon_start : 1 product : hypothetical protein LOC103266 protein_id : NP_001013046.1

name	Mterfd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518496 CCDS:CCDS24088.1 GeneID:74238 MGI:1921488
definition	codon_start : 1 product : transcription termination factor-like protein protein_id : NP_083108.1

name	Cry1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681031 CCDS:CCDS24089.1 GeneID:12952 MGI:1270841
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003913 - DNA photolyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IDA] [Evidence IMP]; GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 product : cryptochrome 1 (photolyase-like) protein_id : NP_031797.1

name	EG666974 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388526 GeneID:666974 MGI:3647964
definition	codon_start : 1 product : similar to zeta proteasome chain; PSMA5 isoform 2 protein_id : XP_001002751.1

name	Btbd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62953118 CCDS:CCDS24091.1 GeneID:74007 MGI:1921257
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : BTB (POZ) domain containing 11 isoform 1 protein_id : NP_082985.1

name	Btbd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62953120 GeneID:74007 MGI:1921257
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : BTB (POZ) domain containing 11 isoform 2 protein_id : NP_001017525.1

name	EG626858 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260991 GeneID:626858 MGI:3645890
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896558.2

name	Pwp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923062 CCDS:CCDS24092.1 GeneID:103136 MGI:1914735
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear phosphoprotein similar to S. cerevisiae PWP1 product : periodic tryptophan protein 1 homolog protein_id : NP_598754.1

name	Prdm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676181 CCDS:CCDS24093.1 GeneID:72843 MGI:1920093
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PR domain containing 4 protein_id : NP_857633.2

name	Ascl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260996 GeneID:67341 MGI:1914591
definition	codon_start : 1 product : achaete-scute complex homolog 4 protein_id : XP_991877.2

name	D10Wsu52e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703842 CCDS:CCDS24094.1 GeneID:28088 MGI:106379
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC28088 protein_id : NP_663397.1

name	Bpil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244288 GeneID:270757 MGI:3026884
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0001530 - lipopolysaccharide binding [Evidence ISS]; GO:0005543 - phospholipid binding [Evidence ISS] codon_start : 1 product : bactericidal/permeability-increasing protein-like 2 protein_id : NP_808440.1

name	Fbxo7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116686126 CCDS:CCDS24095.1 GeneID:69754 MGI:1917004
definition	codon_start : 1 product : F-box only protein 7 protein_id : NP_694875.2

name	Syn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305535 CCDS:CCDS24096.1 GeneID:27204 MGI:1351334
definition	GO_component : GO:0045202 - synapse [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IEA]; GO:0030672 - synaptic vesicle membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007269 - neurotransmitter secretion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : synapsin 3; Synapsin IIIa product : synapsin III protein_id : NP_038750.1

name	Timp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755793 CCDS:CCDS24097.1 GeneID:21859 MGI:98754
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008191 - metalloendopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 product : tissue inhibitor of metalloproteinase 3 protein_id : NP_035725.1

name	EG627035 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83027557 GeneID:627035 MGI:3646339
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896769.1

name	EG382395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388520 GeneID:382395 MGI:3646116
definition	codon_start : 1 product : hypothetical protein protein_id : XP_487135.3

name	Hsp90b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755863 GeneID:22027 MGI:98817
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0050750 - low-density lipoprotein receptor binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : tumor rejection antigen (gp96) 1; endoplasmin; transforming growth factor alpha regulated gene 2 product : tumor rejection antigen gp96 protein_id : NP_035761.1

name	Nt5dc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491847 CCDS:CCDS24098.1 GeneID:103220 MGI:3513266
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3; Grp94 neighboring nucleotidase variant 4 product : 5'-nucleotidase domain containing 3 isoform 3 protein_id : NP_001003910.1

name	Nt5dc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491878 GeneID:103220 MGI:3513266
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; Grp94 neighboring nucleotidase variant 4 product : 5'-nucleotidase domain containing 3 isoform 2 protein_id : NP_705823.2

name	Nt5dc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556239 CCDS:CCDS24099.1 GeneID:103220 MGI:3513266
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; Grp94 neighboring nucleotidase variant 4 product : 5'-nucleotidase domain containing 3 isoform 1 protein_id : NP_001003939.1

name	C630002B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111494223 GeneID:103466 MGI:2143852
definition	codon_start : 1 note : TU12B1-TY protein homolog product : hypothetical protein LOC103466 protein_id : NP_780540.2

name	Stab2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149764 GeneID:192188 MGI:2178743
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008368 - Gram-negative bacterial binding [Evidence ISS]; GO:0005540 - hyaluronic acid binding [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence ISS] [Evidence IEA] codon_start : 1 product : stabilin-2 protein_id : NP_619614.1

name	Fabp3-ps1 (CDS detail)
type	TATA_signal
link	vega ensembl
xref
definition	gene_synonym : Fabph-3; Fabph-ps1; Fabph3

name	LOC626878 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626878
definition	number : 3 pseudo : _no_value

name	LOC626878 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626878
definition	number : 2 pseudo : _no_value

name	LOC626878 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626878
definition	number : 1 pseudo : _no_value

name	LOC669723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669723
definition	number : 1 pseudo : _no_value

name	LOC669723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669723
definition	number : 2 pseudo : _no_value

name	LOC669723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669723
definition	number : 3 pseudo : _no_value

name	LOC669723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669723
definition	number : 4 pseudo : _no_value

name	LOC669723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669723
definition	number : 5 pseudo : _no_value

name	LOC626940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626940
definition	number : 1 pseudo : _no_value

name	LOC672902 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672902
definition	number : 2 pseudo : _no_value

name	LOC672902 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672902
definition	number : 1 pseudo : _no_value

name	LOC100041419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041419
definition	number : 1 pseudo : _no_value

name	LOC100041419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041419
definition	number : 2 pseudo : _no_value

name	LOC100041419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041419
definition	number : 3 pseudo : _no_value

name	LOC100041419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041419
definition	number : 4 pseudo : _no_value

name	LOC100041419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041419
definition	number : 5 pseudo : _no_value

name	LOC100041419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041419
definition	number : 6 pseudo : _no_value

name	Fabp3-ps1 (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition	gene_synonym : Fabph-3; Fabph-ps1; Fabph3

name	Fabp3-ps1 (CDS detail)
type	misc_recomb
link	vega ensembl
xref
definition	gene_synonym : Fabph-3; Fabph-ps1; Fabph3 note : putative pseudogene (retroposon)

clone name	MSMg01-383C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-305A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429N20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-446E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455H20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113P22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519P11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-190I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386P18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-105O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150I07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-122J13.b	B6Ng01-122J13.g
ACC	DH925980	DH925981
length	1,116	1,222
definition	DH925980\|Mus musculus domesticus DNA, BAC clone: B6Ng01-122J13, 5' end.	DH925981\|Mus musculus domesticus DNA, BAC clone: B6Ng01-122J13, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcattggtcttaccatgttccccatcatcctgaagcagctggtctg atagaaagatggaatggccttttgaagacccagttacagtgccatttagg tggtaacagcatggaaggctggggcagagttcttcagaagacagtatatg ttttgaatcagcgtttgatacatggtacagtttcacccatagccaggatt catgggtccaggaatcaaggggtggaaaaggaaatagttccacacactat cactcctagtgaccctctaagaaaaatttttgcttcctgtccccataact ctaggttctgctggcttagaagttttggctccagaggggggagtgctaca ggagctacaacaaacattccattgaactggaagctcagacttccccctgg tcattttggcttctaatacctttaaaccaacaggctaaaaaaaggaataa cagtgttaggaggggtgatagatccagattaccatggggaaattggatta cctcttcacaatggtggtaagcaagattatgtctggaatgtaagagatcc cttggggcatctcttagtactaccatgtgctgtgattaaagtcaatggga aactacaacagcctaatccaagcaggatgacaaaggacacagacccatca ggaatgaaggtatggatcaatcctccaggaaaatagccaagacatgctga ggtgctggctgaaggtgaaggaaataccgaatgggtagaagaggaaggta attataaataccaattaaagccacgtaaccagttgcagaaacgaggatta taaagtaatatgaatgcccctgtcttattttgctaatgaatacatttgtc tttcttccaatttctttaacatcaatttatatttaagttgagacactaaa aggatgttcccaagggaatattgccccattataaatttacaaatgcattt gtgattgtatgagggatagttatatcatgtagttgtattcacaaacttgt tattgtttcatgcaacatgaagatttatttgtgtcgaattgacaaggggt ggattgtatgtgctattctggtgtctactttgactattatttagattgac tacaatcagaaatgga	gaattcaccagttggttatccaattccaaacaatcagccctaaaaaaata catacaagtaacatgatacaaactgagcttgatatgttgaggaatatgta tatatttatgtttgtatgttatacacacacacacacacacacacacacac acatatatatatatgcgcatgtgtttatctgtgtgtgtatcttagtcagg gtttgtatttctgcataaaacatcatgaccaagaagcaagttgggaaaaa aaaatggtttattcagcttgtacttccacattgctattcatcaccaaagg aagtaagaacaggaactcacacagggcagaaacttagaggtaggggctaa tgcagaggttatggagggatgctgcttacaggattgcttcccctgacttg ctcagcttgctttcttataaaatctaggactactagcccagggatggccc cacccacaatgggccctccctgatcactaatttagaaaatatcttacagc ttgatcactaatttagaaaatgtcttacagctggatctcatggaggcatt tttctcaagggcagctcctgtctcggacaactccagcttatgtcaagttg acacacaaaaccagccagtacaactgaccccttgtcaacttgacacataa acacatcactattaaaccacaatccttactttcttattcattcctaagat ctaaataaccttaaaagtcccacagtctttataattcttacatattgaaa tgtcaatccctttaaaatgtcctatctcttttaaattcagtcattttaca attcaaagtctcttaactgtccgctctactaaaatactttctttcttgag agggaaaaaatatcaggcaacagtcatcatcaaaaccataatcaaacttc taactatccaatgtctggacccactcacatcttatggctcaagctgcctg tactccacgctgctgctgccgtttttggtggtcatctcatgttaagcact gcttcttctgctgcaactttcccaaatagccagtctaagtcccttttata gtgattagcttcaactttctacagactttcattcctgccctaactgccat ggctctacttcacatggcctctcctggcctcaatgcaggatcagtgccac ccctaagtcaactgaaacttggagacctaacatataagtcgtgtgccgct aagataaaccgctgtgcgtcca
quality values	Open. Hide. 47 31 31 38 61 38 31 43 61 61 31 53 61 61 61 61 61 38 27 61 61 61 61 61 19 19 24 10 21 17 10 24 20 29 34 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 41 59 59 55 44 44 55 59 59 49 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 59 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 39 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 42 61 61 61 61 47 61 53 61 61 61 61 61 61 61 52 53 40 61 61 61 57 53 57 42 52 53 57 53 53 57 57 57 47 33 53 57 53 53 57 53 57 57 47 47 47 43 57 45 52 57 53 57 50 53 36 57 57 57 57 53 57 57 57 53 53 53 47 57 57 53 57 57 57 38 53 45 47 53 53 57 53 50 52 57 53 57 53 57 57 50 57 47 45 52 30 57 57 47 45 50 52 57 53 57 47 46 57 47 47 37 50 50 53 38 57 53 45 52 47 57 41 47 47 53 53 41 26 41 50 53 45 53 47 53 33 53 53 36 30 53 52 50 53 52 45 45 53 53 43 41 53 57 57 27 47 47 30 17 57 53 45 45 50 52 46 14 43 21 50 41 53 53 32 50 41 42 36 50 50 52 53 38 29 30 40 53 57 57 57 37 33 50 40 53 47 27 57 42 52 25 38 50 53 50 53 40 52 20 30 32 52 38 42 41 52 27 52 37 52 38 22 30 23 39 57 31 14 53 45 57 33 33 36 42 57 37 52 52 36 52 46 53 35 43 27 42 52 30 53 14 42 33 33 38 52 15 42 23 15 52 34 53 41 57 37 48 31 40 39 19 22 22 18 7 8 7 10 4 9 5 35 34 33 29 40 37 44 28 44 34 41 37 36 31 33 43 57 33 33 18 38 13 34 33 17 31 34 22 10 46 46 39 32 38 48 30 32 29 35 29 31 29 30 26 51 51 38 20 31 27 30 34 24 30 28 47 47 33 18 20 26 10 43 27 28 23 33 21 31 39 24 30 45 30 32 18 33 33 48 28 24 25 24 48 31 29 19 30 46 26 29 28 51 36 31 29 29 22 28 27 15 23 25 51 29 27 13 10 14 29 25 29 27 18 28 29 28 31 13 23 13 20 27 29 34 51 51 30 29 24 11 4 8 15 24 28 43 30 16 13 22 28 14 16 5 7 12 14 24 19 10 46 41 30 16 41 13 15 7 9 39 26 30 51 34 22 29 17 51 26 27 26 16 14 29 46 20 8 8 26 35 30 21 35 19 23 29 30 33 15 46 23 27 19 28 28 26 13 19 26 20 20 28 22 23 25 29 10 8 5 6 24 7 17 13 19 14 8 28 20 38 28 25 20 19 28 12 38 28 25 6 28 10 51 22 29 21 11 28 14 36 26 17 13 18 20 18 5 5 13 5 12 22 18 22 38 29 22 10 23 16 14 5 11 21 7 22 16 10 15 15 25 6 35 44 12 17 26 23 13 19 29 21 11 11 16 6 6 33 14 26 17 33 14 20 14 10 26 6 3 5 18 6 21 12 9 14 21 17 7 20 9 12 29 10 6 13 33 14 6 5 29 8 12 7 13 11 12 14 17 9 13 12 14 4 5 21 17 10 4 4 22 14	Open. Hide. 50 47 36 36 61 36 22 42 43 10 10 25 37 55 55 50 41 50 55 55 47 38 55 55 55 61 37 17 61 61 49 49 61 61 61 47 55 61 61 61 61 61 61 61 61 61 61 61 52 49 52 36 36 28 30 26 41 37 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 32 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 59 61 59 59 59 59 59 59 59 61 59 55 43 59 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 49 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 53 61 61 61 61 61 61 61 61 61 61 61 47 47 61 61 61 61 61 61 47 61 61 50 47 61 47 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 52 50 53 61 61 61 61 61 61 61 61 47 61 53 53 52 53 61 47 50 61 61 39 61 61 61 42 61 61 53 50 53 45 46 47 47 47 53 57 47 47 47 57 57 57 52 53 47 52 47 47 57 53 47 38 47 57 53 53 50 57 57 53 53 53 45 53 57 53 47 53 53 42 57 57 53 46 47 42 53 53 50 53 37 47 53 53 53 57 45 45 57 57 53 52 47 57 33 52 52 47 53 53 38 53 53 52 37 57 47 50 53 52 53 50 38 47 37 52 16 37 47 45 50 57 57 57 57 53 50 45 42 43 50 53 52 45 53 50 52 45 53 52 53 57 38 45 53 53 52 33 46 23 43 47 45 53 50 31 20 50 45 57 35 42 50 53 53 41 32 52 50 36 36 38 52 37 42 53 34 38 53 33 26 50 47 52 33 35 57 57 39 53 30 27 37 30 28 53 36 47 31 28 57 42 37 37 52 52 42 36 37 27 26 35 40 32 34 31 30 50 32 37 23 57 14 36 30 31 19 52 36 50 40 52 32 42 43 38 39 39 21 31 28 41 40 47 33 40 37 31 33 31 31 38 57 28 37 21 31 36 52 17 35 22 38 38 52 34 18 15 43 33 33 12 37 33 32 57 14 29 35 38 27 40 34 36 24 47 45 26 20 37 41 57 37 28 33 33 33 33 29 26 57 29 24 33 57 57 28 29 33 33 37 27 24 21 38 13 13 32 32 32 51 41 27 32 14 31 24 23 27 23 46 34 23 46 31 30 45 45 30 24 41 29 22 44 27 30 28 31 27 30 33 51 46 28 43 46 30 29 12 18 29 25 13 21 23 13 45 46 21 23 23 14 39 35 15 17 21 51 18 16 22 33 18 22 19 12 32 18 26 26 33 11 15 10 51 28 25 27 22 23 28 20 27 51 51 16 11 7 18 20 43 43 34 28 43 33 27 15 18 29 40 6 14 6 41 35 28 41 41 41 41 13 9 7 21 28 23 16 16 7 7 5 17 19 16 18 16 11 29 28 24 28 10 11 41 51 29 25 27 17 6 7 51 29 12 19 27 25 9 6 14 9 24 31 28 14 12 10 23 20 26 12 19 20 34 17 15 9 17 22 20 20 51 28 15 22 23 12 9 12 5 7 20 20 17 12 5 20 29 21 28 16 17 20 26 31 14 17 19 14 8 17 13 19 16 10 7 23 10 16 7 7 21 16 26 18 20 18 12 15 18 22 9 12 39 35 35 17 28 9 6 19 39 13 17 10 31 11 9 9 20 6 30 5 6 5 3 4 8 9 10 14 22 6 21 9 27 22 14 5 3 7 19 13 8 9 26 17 24 20 34 13 5 4 7 9 31 21 16 21 6 13 12 6 12 5 5 3 7 19 6 16 12 6 4 11 42 42 21 4 7 10 6 5 8 11 6 5 16 9 18 4 7 8 13 11 7 8 9 4 4 4 4 7 10 8 6 5 4 4 4 11 7 16 20 10 7 7 4 3 6 4 7 4 3 3 9 9 9 14 4 9 24 23 6 7 6 6 3 10 6 20 5 4 11 10 3 11 11 9 8 10 7 7 9 20 4 7 14 5 9 10 7 3 4 1 7 6 4 4 2 5 9 6 7 6 3 4 4 4 3 12 30 19 7 18 6 3 3 9 3 14 22 4 13 6 3 1 2 4 1 3 5 6 10 4 13 6 6 7 2 5 4 9 5 4 7 1 2 1 3 7 20 6 21 3 3 3 4 4 4 3 13 9 6 27 5 8 6 3 3 4 5 4 3 8 6 15 3 5 5 4 7 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_85331086_85331855
seq2: B6Ng01-122J13.b_397_1163

seq1  AGGAGCTACAACAAACATTCCATTGAACTGGAAGCTCAGACTTCCCCCTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGCTACAACAAACATTCCATTGAACTGGAAGCTCAGACTTCCCCCTG  50

seq1  GTCATTTTGAGCTTCTAATGTCCTTAAACCGACAGGCT-AAAAAAGGAAT  99
      ||||||||| |||||||||  | ||||||| ||||||| |||||||||||
seq2  GTCATTTTG-GCTTCTAATACCTTTAAACCAACAGGCTAAAAAAAGGAAT  99

seq1  AACAGTGTTAGGAGGGGTGATAGATCCATATTACCATGGGGAAATTGGAT  149
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  AACAGTGTTAGGAGGGGTGATAGATCCAGATTACCATGGGGAAATTGGAT  149

seq1  TACCTCTTCACAATGGAGGTAAGCAAGATTATGTCTGGAATGTAGGAGAT  199
      |||||||||||||||| ||||||||||||||||||||||||||| |||||
seq2  TACCTCTTCACAATGGTGGTAAGCAAGATTATGTCTGGAATGTAAGAGAT  199

seq1  CCCTTAGGGCGTCTCTTAGTACTACCATGTCCTGTGATTAAAGTCAATGG  249
      ||||| |||| ||||||||||||||||||| |||||||||||||||||||
seq2  CCCTTGGGGCATCTCTTAGTACTACCATGTGCTGTGATTAAAGTCAATGG  249

seq1  GAAACTACAACAGCCTAATCCAAGCAGGATGACAAAGGACACAGACCCAT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACTACAACAGCCTAATCCAAGCAGGATGACAAAGGACACAGACCCAT  299

seq1  CAGGAATGAAGGTATGGGTCAATCCTCCAGGAAAAGAGCCAAGACCTGCT  349
      ||||||||||||||||| ||||||||||||||||| ||||||||| ||||
seq2  CAGGAATGAAGGTATGGATCAATCCTCCAGGAAAATAGCCAAGACATGCT  349

seq1  GAGGTGCTGGCTGAAGGTGAAGGAAATACAGAATGGGTAGTAGAGGAAGG  399
      ||||||||||||||||||||||||||||| |||||||||| |||||||||
seq2  GAGGTGCTGGCTGAAGGTGAAGGAAATACCGAATGGGTAGAAGAGGAAGG  399

seq1  TAGTTATAAATACCAATTAAGGCCACGTAACCAGTTGCAGAAACGAGGAT  449
      || ||||||||||||||||| |||||||||||||||||||||||||||||
seq2  TAATTATAAATACCAATTAAAGCCACGTAACCAGTTGCAGAAACGAGGAT  449

seq1  TATAAAGTAATATGAATGCCCCTGTCTTATTTTGCTAACAAATATATTTG  499
      ||||||||||||||||||||||||||||||||||||||  |||| |||||
seq2  TATAAAGTAATATGAATGCCCCTGTCTTATTTTGCTAATGAATACATTTG  499

seq1  TCTTTCTTCCAATTTCTTTAACATCAATAGGTATTTAAATTGAGACAGTA  549
      ||||||||||||||||||||||||||||   ||||||| |||||||| ||
seq2  TCTTTCTTCCAATTTCTTTAACATCAATTTATATTTAAGTTGAGACACTA  549

seq1  AAAGGATGTTCTTAAGGG-ACATTGCCCCATTGTAAATTTACAAATGTGT  598
      |||||||||||  ||||| | ||||||||||| ||||||||||||||  |
seq2  AAAGGATGTTCCCAAGGGAATATTGCCCCATTATAAATTTACAAATGCAT  599

seq1  TTGCGATTGTATGAGGGATAGTTATATCATGTTAGGCATATTCACAACCT  648
      ||| ||||||||||||||||||||||||||| |||   ||||||||| ||
seq2  TTGTGATTGTATGAGGGATAGTTATATCATG-TAGTTGTATTCACAAACT  648

seq1  TGTCATTGTTTCATGTGAACATG-AGATATTATTTGTGTCAAGTTGACAA  697
      ||| |||||||||||  |||||| |||| ||||||||||| | |||||||
seq2  TGTTATTGTTTCATG-CAACATGAAGAT-TTATTTGTGTCGAATTGACAA  696

seq1  GGGGTGGATTGTAGTGGCTATTCCTGGTTGTCAAC-TTGACTA-TATTTG  745
      |||||||||||||   |||||| |||| |||| || ||||||| ||||| 
seq2  GGGGTGGATTGTATGTGCTATT-CTGG-TGTCTACTTTGACTATTATTTA  744

seq1  GAATGAACTACAATCCAGAATTGGA  770
      || || |||||||| ||||| ||||
seq2  GATTG-ACTACAAT-CAGAAATGGA  767

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information