MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-214H19
Chromosome	10 (Build37)
Map Location	77,249,668 - 77,371,830
singlet/doublet	doublet
Overlap gene	LOC634504, LOC675294, LOC670880, LOC100040299, LOC675238, C330046G03Rik, EG544710, LOC100041351, 1700009J07Rik, Lrrc3
Upstream gene	Pcbp3, LOC100041099, Slc19a1, Col18a1, LOC665762, Pofut2, Adarb1, 1810008A18Rik, Itgb2, Pttg1ip, Sumo3, Ube2g2, LOC674243, LOC670895, Krtap12-1, A030009A09Rik, LOC100041250, LOC100041261, LOC634517, LOC100041281
Downstream gene	Trpm2, 1810043G02Rik, Pfkl, Aire, Dnmt3l, Icosl, D10Jhu81e, Pwp2, Tmem1, Agpat3, LOC100041500, Rrp1, Cstb, Pdxk, EG665862, Olfr1358, LOC546482, Ilvbl, Syde1, Olfr1357, LOC665890, Casp14, Ccdc105, Slc1a6, Olfr1356, GA_x5J8B7W4DUT-12263-11330
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pcbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59093 MGI:1890470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Slc19a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20509 MGI:103182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col18a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12822 MGI:88451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Pofut2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80294 MGI:1916863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adarb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110532 MGI:891999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	1810008A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108707 MGI:1916334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16414 MGI:96611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pttg1ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108705 MGI:2652132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20610 MGI:1336201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22213 MGI:1343188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 908 ESTs pseudo : _no_value

name	LOC670895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Krtap12-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16694 MGI:1328315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A030009A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77763 MGI:1925013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100041250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins

name	LOC100041261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	LOC634517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	LOC100041281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC634504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC675294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC670880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins

name	LOC100040299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC675238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs

name	C330046G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252974 MGI:2671932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544710 MGI:3645300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins

name	1700009J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75188 MGI:1914938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 1 Protein

name	Lrrc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237387 MGI:2447899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28240 MGI:1351901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810043G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67884 MGI:1915134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18641 MGI:97547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aire (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11634 MGI:1338803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnmt3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54427 MGI:1859287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Icosl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50723 MGI:1354701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D10Jhu81e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28295 MGI:1351861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pwp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110816 MGI:1341200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216131 MGI:1336209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agpat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28169 MGI:1336186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 151 ESTs, 4 Proteins

name	Rrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18114 MGI:1203500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cstb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13014 MGI:109514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216134 MGI:1351869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665862 MGI:3643842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Olfr1358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258224 MGI:3031192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 508 Proteins

name	LOC546482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Ilvbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216136 MGI:1351911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syde1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71709 MGI:1918959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 77 ESTs, 2 Proteins

name	Olfr1357 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257883 MGI:3031191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins pseudo : _no_value

name	Casp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12365 MGI:1335092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70976 MGI:1918226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins

name	Slc1a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20513 MGI:1096331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1356 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258305 MGI:3031190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W4DUT-12263-11330 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257734
definition	note : olfactory receptor GA_x5J8B7W4DUT-12263-11330 pseudo : _no_value

name	Pcbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947013 GeneID:59093 MGI:1890470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 3 transcript_id : NM_021568.1

name	LOC100041099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260965 GeneID:100041099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041099 transcript_id : XM_001477376.1

name	Slc19a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130166 GeneID:20509 MGI:103182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 19 (sodium/hydrogen exchanger), member 1 transcript_id : NM_031196.2

name	Col18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789281 GeneID:12822 MGI:88451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XVIII, alpha 1 transcript_id : NM_009929.2

name	Pofut2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044906 GeneID:80294 MGI:1916863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-fucosyltransferase 2 transcript_id : NM_030262.3

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625742 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_130895.2

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625746 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024837.1

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625744 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024839.1

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625738 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024840.1

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67763819 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024838.1

name	1810008A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388778 GeneID:108707 MGI:1916334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810008A18 gene transcript_id : NM_133998.2

name	Itgb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802513 GeneID:16414 MGI:96611
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 2 transcript_id : NM_008404.3

name	Pttg1ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803230 GeneID:108705 MGI:2652132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pituitary tumor-transforming 1 interacting protein transcript_id : NM_145925.2

name	Sumo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801940 GeneID:20610 MGI:1336201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMT3 suppressor of mif two 3 homolog 3 (yeast) transcript_id : NM_019929.3

name	Ube2g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130569 GeneID:22213 MGI:1343188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2G 2 transcript_id : NM_019803.3

name	LOC670895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260932 GeneID:670895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001474402.1

name	Krtap12-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754489 GeneID:16694 MGI:1328315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 12-1 transcript_id : NM_010670.1

name	A030009A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260974 GeneID:77763 MGI:1925013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : RIKEN cDNA A030009A09 gene transcript_id : XM_001477721.1

name	LOC100041250 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260976 GeneID:100041250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477730.1

name	LOC100041261 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260978 GeneID:100041261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477744.1

name	LOC634517 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260980 GeneID:634517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477760.1

name	LOC100041281 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260982 GeneID:100041281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477777.1

name	LOC634504 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260984 GeneID:634504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477786.1

name	LOC675294 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260934 GeneID:675294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001474442.1

name	LOC670880 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260986 GeneID:670880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477799.1

name	LOC100040299 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260936 GeneID:100040299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001474461.1

name	LOC675238 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260988 GeneID:675238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs product : similar to hCG2043579 transcript_id : XM_001477814.1

name	C330046G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003907 GeneID:252974 MGI:2671932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330046G03 gene transcript_id : NM_145855.1

name	EG544710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363864 GeneID:544710 MGI:3645300
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG544710 transcript_id : NM_001024709.2

name	LOC100041351 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260992 GeneID:100041351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477837.1

name	Lrrc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365689 GeneID:237387 MGI:2447899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 3 transcript_id : NM_145152.3

name	Trpm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31083375 GeneID:28240 MGI:1351901
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily M, member 2 transcript_id : NM_138301.1

name	1810043G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778944 GeneID:67884 MGI:1915134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810043G02 gene transcript_id : NM_026431.2

name	Pfkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366236 GeneID:18641 MGI:97547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofructokinase, liver, B-type transcript_id : NM_008826.3

name	Aire (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753019 GeneID:11634 MGI:1338803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) transcript_id : NM_009646.1

name	Dnmt3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126158898 GeneID:54427 MGI:1859287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA (cytosine-5-)-methyltransferase 3-like transcript_id : NM_001081695.1

name	Dnmt3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343788 GeneID:54427 MGI:1859287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA (cytosine-5-)-methyltransferase 3-like transcript_id : NM_019448.3

name	Icosl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131092 GeneID:50723 MGI:1354701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : icos ligand transcript_id : NM_015790.3

name	D10Jhu81e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343834 GeneID:28295 MGI:1351861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, Johns Hopkins University 81 expressed transcript_id : NM_138601.2

name	Pwp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802993 GeneID:110816 MGI:1341200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PWP2 periodic tryptophan protein homolog (yeast) transcript_id : NM_029546.2

name	Tmem1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486683 GeneID:216131 MGI:1336209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 1 transcript_id : NM_001081055.1

name	Agpat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131207 GeneID:28169 MGI:1336186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 1-acylglycerol-3-phosphate O-acyltransferase 3 transcript_id : NM_053014.3

name	LOC100041500 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260997 GeneID:100041500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 151 ESTs, 4 Proteins product : similar to LSM7 homolog, U6 small nuclear RNA associated transcript_id : XM_001478166.1

name	Rrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676366 GeneID:18114 MGI:1203500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal RNA processing 1 homolog (S. cerevisiae) transcript_id : NM_010925.2

name	Cstb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921593 GeneID:13014 MGI:109514
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystatin B transcript_id : NM_007793.3

name	Pdxk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006860 GeneID:216134 MGI:1351869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyridoxal (pyridoxine, vitamin B6) kinase transcript_id : NM_172134.1

name	Olfr1358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260938 GeneID:258224 MGI:3031192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 508 Proteins product : olfactory receptor 1358 transcript_id : XM_622784.4

name	Ilvbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476077 GeneID:216136 MGI:1351911
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ilvB (bacterial acetolactate synthase)-like transcript_id : NM_173751.3

name	Syde1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388437 GeneID:71709 MGI:1918959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 77 ESTs, 2 Proteins product : synapse defective 1, Rho GTPase, homolog 1 (C. elegans) transcript_id : XM_359260.3

name	Olfr1357 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801267 GeneID:257883 MGI:3031191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1357 transcript_id : NM_001011737.1

name	Casp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802958 GeneID:12365 MGI:1335092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 14 transcript_id : NM_009809.3

name	Ccdc105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388439 GeneID:70976 MGI:1918226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins product : coiled-coil domain containing 105 transcript_id : XM_147407.6

name	Slc1a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130488 GeneID:20513 MGI:1096331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 transcript_id : NM_009200.2

name	Olfr1356 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490328 GeneID:258305 MGI:3031190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1356 transcript_id : NM_146308.2

name	Pcbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947014 GeneID:59093 MGI:1890470
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : poly(rC)-binding protein 3 product : poly(rC) binding protein 3 protein_id : NP_067543.1

name	LOC100041099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260966 GeneID:100041099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477426.1

name	Slc19a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654260 GeneID:20509 MGI:103182
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005542 - folic acid binding [Evidence IEA]; GO:0008518 - reduced folate carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 19 (sodium/hydrogen exchanger), member 1 protein_id : NP_112473.1

name	Col18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789282 CCDS:CCDS23953.1 GeneID:12822 MGI:88451
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IDA] [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0001886 - endothelial cell morphogenesis [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 product : procollagen, type XVIII, alpha 1 protein_id : NP_034059.2

name	Pofut2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19525731 CCDS:CCDS23954.1 GeneID:80294 MGI:1916863
definition	GO_function : GO:0046922 - peptide-O-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006004 - fucose metabolism [Evidence IEA] codon_start : 1 product : protein O-fucosyltransferase 2 protein_id : NP_084538.2

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625743 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : adenosine deaminase, RNA-specific, B1 isoform 1 protein_id : NP_570965.2

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625747 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : adenosine deaminase, RNA-specific, B1 isoform 2 protein_id : NP_001020008.1

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67763820 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : adenosine deaminase, RNA-specific, B1 isoform 3 protein_id : NP_001020009.1

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625745 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5 product : adenosine deaminase, RNA-specific, B1 isoform 5 protein_id : NP_001020010.1

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625739 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : adenosine deaminase, RNA-specific, B1 isoform 4 protein_id : NP_001020011.1

name	1810008A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527218 CCDS:CCDS23955.1 GeneID:108707 MGI:1916334
definition	codon_start : 1 product : hypothetical protein LOC108707 protein_id : NP_598759.1

name	Itgb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607447 CCDS:CCDS23956.1 GeneID:16414 MGI:96611
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0045123 - cellular extravasation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IDA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP] codon_start : 1 note : integrin beta 2 (Cd18); Mac-1 beta; macrophage antigen-1 beta; lymphocyte function associated antigen 1 product : integrin beta 2 protein_id : NP_032430.2

name	Pttg1ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122339 CCDS:CCDS23957.1 GeneID:108705 MGI:2652132
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : pituitary tumor-transforming gene 1 protein-interacting protein protein_id : NP_666037.1

name	Sumo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910556 CCDS:CCDS23958.1 GeneID:20610 MGI:1336201
definition	GO_function : GO:0019949 - SUMO conjugating enzyme activity [Evidence IDA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : SMT3 (supressor of mif two, 3) homolog 1 protein_id : NP_064313.1

name	Ube2g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806111 GeneID:22213 MGI:1343188
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme 7 homolog product : ubiquitin-conjugating enzyme E2G 2 protein_id : NP_062777.2

name	LOC670895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260933 GeneID:670895
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001474452.1

name	Krtap12-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754490 CCDS:CCDS23959.1 GeneID:16694 MGI:1328315
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 product : keratin associated protein 12-1 protein_id : NP_034800.1

name	A030009A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260975 GeneID:77763 MGI:1925013
definition	codon_start : 1 product : hypothetical protein LOC77763 protein_id : XP_001477771.1

name	LOC100041250 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260977 GeneID:100041250
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477780.1

name	LOC100041261 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260979 GeneID:100041261
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477794.1

name	LOC634517 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260981 GeneID:634517
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477810.1

name	LOC100041281 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260983 GeneID:100041281
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477827.1

name	LOC634504 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260985 GeneID:634504
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477836.1

name	LOC675294 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260935 GeneID:675294
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001474492.1

name	LOC670880 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260987 GeneID:670880
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477849.1

name	LOC100040299 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260937 GeneID:100040299
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001474511.1

name	LOC675238 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260989 GeneID:675238
definition	codon_start : 1 product : similar to hCG2043579 protein_id : XP_001477864.1

name	C330046G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003908 GeneID:252974 MGI:2671932
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : thrombospondin N-terminal domain/EPTP protein 1 product : RIKEN cDNA C330046G03 protein_id : NP_665854.1

name	EG544710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701540 GeneID:544710 MGI:3645300
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC544710 protein_id : NP_001019880.1

name	LOC100041351 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260993 GeneID:100041351
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477887.1

name	Lrrc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553121 CCDS:CCDS23960.1 GeneID:237387 MGI:2447899
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine-rich repeat-containing 3 product : leucine rich repeat containing 3 protein_id : NP_660134.1

name	Trpm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31083376 GeneID:28240 MGI:1351901
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047631 - ADP-ribose diphosphatase activity [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : transient receptor potential channel 7; transient receptor protein 7; transient receptor potential cation channel, subfamily M, member 2 (Trpm2) product : transient receptor potential cation channel, subfamily M, member 2 protein_id : NP_612174.1

name	1810043G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778945 GeneID:67884 MGI:1915134
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC67884 protein_id : NP_080707.2

name	Pfkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560653 GeneID:18641 MGI:97547
definition	GO_component : GO:0005945 - 6-phosphofructokinase complex [Evidence IEA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003872 - 6-phosphofructokinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006002 - fructose 6-phosphate metabolism [Evidence ISS]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : phosphofructokinase, liver, B-type protein_id : NP_032852.2

name	Aire (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753020 CCDS:CCDS23961.1 GeneID:11634 MGI:1338803
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0045182 - translation regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006959 - humoral immune response [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) protein_id : NP_033776.1

name	Dnmt3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126158899 GeneID:54427 MGI:1859287
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008047 - enzyme activator activity [Evidence IDA] [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI] [Evidence ISS]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006349 - imprinting [Evidence ISS] [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IMP] codon_start : 1 product : DNA (cytosine-5-)-methyltransferase 3-like protein_id : NP_001075164.1

name	Dnmt3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956092 CCDS:CCDS23962.1 GeneID:54427 MGI:1859287
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008047 - enzyme activator activity [Evidence IDA] [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI] [Evidence ISS]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006349 - imprinting [Evidence ISS] [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IMP] codon_start : 1 product : DNA (cytosine-5-)-methyltransferase 3-like protein_id : NP_062321.1

name	Icosl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657220 GeneID:50723 MGI:1354701
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005102 - receptor binding [Evidence TAS] [Evidence IDA] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0006952 - defense response [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0045190 - isotype switching [Evidence NAS]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence TAS]; GO:0045404 - positive regulation of interleukin-4 biosynthesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence NAS]; GO:0042110 - T cell activation [Evidence NAS] codon_start : 1 product : icos ligand protein_id : NP_056605.1

name	D10Jhu81e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070420 GeneID:28295 MGI:1351861
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : es1 protein protein_id : NP_613067.1

name	Pwp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30102930 GeneID:110816 MGI:1341200
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : WD-repeat protein p103 product : PWP2 periodic tryptophan protein homolog protein_id : NP_083822.1

name	Tmem1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486684 GeneID:216131 MGI:1336209
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 product : transmembrane protein 1 protein_id : NP_001074524.1

name	Agpat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229278 CCDS:CCDS23963.1 GeneID:28169 MGI:1336186
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : 1-acylglycerol-3-phosphate O-acyltransferase 3 protein_id : NP_443747.2

name	LOC100041500 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260998 GeneID:100041500
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478216.1

name	Rrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676367 GeneID:18114 MGI:1203500
definition	GO_component : GO:0030688 - nucleolar preribosome, small subunit precursor [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : novel nuclear protein 1 protein_id : NP_035055.2

name	Cstb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681071 CCDS:CCDS23964.1 GeneID:13014 MGI:109514
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence ISS]; GO:0002020 - protease binding [Evidence ISS] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP] codon_start : 1 product : cystatin B protein_id : NP_031819.1

name	Pdxk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006861 CCDS:CCDS23965.1 GeneID:216134 MGI:1351869
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008478 - pyridoxal kinase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : pyridoxal (pyridoxine, vitamin B6) kinase protein_id : NP_742146.1

name	Olfr1358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260939 GeneID:258224 MGI:3031192
definition	codon_start : 1 product : similar to olfactory receptor Olfr1358 protein_id : XP_622784.4

name	Ilvbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424591 CCDS:CCDS23966.1 GeneID:216136 MGI:1351911
definition	GO_function : GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030976 - thiamin pyrophosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : ilvB (bacterial acetolactate synthase)-like protein_id : NP_776112.1

name	Syde1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388438 GeneID:71709 MGI:1918959
definition	codon_start : 1 product : synapse defective 1, Rho GTPase, homolog 1 protein_id : XP_359260.3

name	Olfr1357 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801268 CCDS:CCDS23968.1 GeneID:257883 MGI:3031191
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGN0-3196801-3197742; olfactory receptor MOR128-3 product : olfactory receptor 1357 protein_id : NP_001011737.1

name	Casp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753280 CCDS:CCDS23969.1 GeneID:12365 MGI:1335092
definition	GO_function : GO:0030693 - caspase activity [Evidence TAS]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 product : caspase 14 protein_id : NP_033939.1

name	Ccdc105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83030962 GeneID:70976 MGI:1918226
definition	codon_start : 1 product : coiled-coil domain containing 105 protein_id : XP_147407.5

name	Slc1a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678003 CCDS:CCDS23970.1 GeneID:20513 MGI:1096331
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0017153 - sodium:dicarboxylate symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006835 - dicarboxylic acid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 1, member 6 product : solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 protein_id : NP_033226.1

name	Olfr1356 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490329 GeneID:258305 MGI:3031190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGN0-2962025-2962987; olfactory receptor MOR142-1 product : olfactory receptor 1356 protein_id : NP_666420.2

name	LOC665762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665762
definition	number : 1 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 1 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 2 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 3 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 4 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 5 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 6 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 7 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 8 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 9 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 10 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 11 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 12 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 13 pseudo : _no_value

name	EG665862 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665862
definition	number : 14 pseudo : _no_value

name	LOC674243 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260971 GeneID:674243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 908 ESTs product : hypothetical LOC674243 pseudo : _no_value transcript_id : XR_033366.1

name	1700009J07Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260994 GeneID:75188 MGI:1914938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 1 Protein product : RIKEN cDNA 1700009J07 gene transcript_id : XR_035305.1

name	LOC546482 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260940 GeneID:546482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to protein tyrosine phosphatase 4a1 pseudo : _no_value transcript_id : XR_031840.1

name	LOC665890 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260941 GeneID:665890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 4 Proteins product : similar to L-2-hydroxyglutarate dehydrogenase pseudo : _no_value transcript_id : XR_031854.1

clone name	MSMg01-418D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456B24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357F12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-189D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452H18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-232C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454P07
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-012L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148I14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-214H19.b	B6Ng01-214H19.g
ACC	GA031721	GA031722
length	1,085	1,077
definition	B6Ng01-214H19.b	B6Ng01-214H19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(77,370,747 - 77,371,830)	(77,249,668 - 77,250,741)
sequence	gaattctggacgatccaggaatccctggagatccaagaatcccgggagat ctaggatttctgggaaaaacaaggattatagtggcacagaggaggtcgcc tggctcaaactgttgaagaaaaaaaaaaaggatataaaaagcaaccggct ctgctctggctggcctggcagctccttgtccaccttatgtcatgcgatta agtcactgcatgcattaatatcatgatggtgcacagatgggggtggggtg agcacgtgggagcaaaacaaaccaatctcatgcccaccagctgagagatt cactgagagatgcaggtcatggtttcctccaagggtacctctgcaatgac tggagacaccccctattccaattcagttccacctcctgaaggtcccacca ccttccagaagcaccgtgtcaggggtgaagcctccaacattcaaggtatg aacccaaatcacagtcccatgcctagtccaagaaggcagacaaggaaaca aagacatgctgagagatttcttaagagctcctctgcttccaggtcatccc ttaaccaagccagtgatgccaggagacaccacaggccttaacagctatgg tctggccctcatgctgacccgctctctctggatttctcctggctgtcatt tgtcttaggagctcattatactgatgcaggctggttgacactgacttctt agcttcccctacctgcagcagggcctcagacgtctgtttgtctgtagcga ccttttcagtgttgagcatcctgtgtattcagttccagtgtgtctgctgc cttcccacagctgcgtggacttgctggacaggacatttttagtggcactt taaaaggtgtgttacagttttccccttacccagttggctcccaataattg agactgagctattacatttattttacagctgtgagggcacaataactgag cagttattactcttatttttaatctatcctaatctggctacctccaggca aaatccctgtgctacttgcatttttatggtttctctgcttcaagtgtttt ctcatgaactatcctggaccccactttcgctcttc	gaattcctgtgaagctacaaccctgagtttctcccagggtttcaggacaa gggcatgccttatctcctctccaagatatgcctctttctcacaatgaaac cctttccaaggatttatcagagtcactctgtgagccccaagacaggaaag tcctggcccagacccagaggaggtagaacccggatcccagtatcagagca tggaacaaggggacagaagctgtgtaaagactccaagcctcacagctgaa gatacagagatagtggaagaggataacagtcactgtggagacataatcga tcagaagaacttttattaatatgcattggtcgagagtagtacagctgacc acagatgcagggtcatccagacagggagggaggaagaagccagctctcct gtgacctggtgaggaggaatctgctgggccttctaaggggtcgagctaca ctcaggtttctcgtcagactgtacacatctttcttctgagctgtgcctcc atcagtagcaaccacaggctgatggaggtgtggttctgtgccctgctgcc ttagtggggcctggccctcagcagctggacttctgtccacagcaggcctg tctgcagcaggcagggcggcacagcagggacacagaggaggttgggccac agcagctgggctggcaggaggaggcacagcaggaggaggtgggcacacag caggcaggtctgcacactgggcgacacagcagggacaggctggagcaggg cttgcagcacacaggagcacagcagagggctggcagcaggaggaggagcc agagcagatgggtgtgcagcacacaggcttgcagcagataggcacacagc aggggattgacagcatgaggactggcagctagactgctggcagcatggtc cagagcagatgggtgtgcagcagacaggcttgcagcaaagggtcaccaca gcaggatggctggcaggtggagcagttgcagccagctggctggcagctag actgcctggcagcattgaggtgtgcagccagaagatttgcagcaggggct tgacaccacagcctcactgggggtgca
quality values	Open. Hide. 58 33 27 41 62 62 47 62 62 39 39 56 54 47 62 31 24 62 62 47 51 47 62 62 62 62 62 62 59 59 43 59 62 59 43 62 62 59 62 59 62 62 62 62 62 62 59 59 59 49 62 59 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 56 59 62 62 62 62 62 62 62 59 46 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 54 62 62 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 54 54 58 54 54 58 58 45 42 54 44 43 47 54 58 58 41 42 52 52 54 58 54 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 47 54 58 58 58 39 58 49 54 52 54 54 58 58 58 58 58 53 58 58 58 58 58 53 53 53 53 52 49 45 54 58 36 58 58 53 53 52 51 49 58 49 51 53 58 50 50 42 42 58 49 58 49 49 53 58 51 18 46 58 31 43 54 50 43 51 52 53 52 49 51 58 58 41 35 58 50 49 23 58 50 51 51 54 50 46 51 58 26 53 53 51 51 54 46 58 58 53 52 37 49 37 54 58 51 40 58 33 49 39 42 39 58 40 54 53 53 39 51 38 11 58 54 50 43 46 39 31 17 51 32 53 53 29 41 58 45 54 41 51 32 42 42 54 34 42 32 53 45 37 24 51 52 54 54 35 42 37 33 42 53 34 49 52 46 23 41 37 53 42 54 34 51 32 49 39 37 36 33 38 37 35 28 37 26 54 37 33 21 35 40 53 37 39 40 40 39 45 37 19 32 33 31 28 54 25 33 37 33 42 43 33 31 34 32 15 27 27 18 18 53 32 45 31 31 31 33 35 19 32 16 15 32 24 30 41 53 52 51 19 29 32 26 47 31 28 32 31 33 47 20 25 51 46 24 7 36 13 51 28 45 37 31 39 37 33 38 31 51 45 33 22 32 40 43 11 13 8 8 51 12 12 33 39 31 26 41 21 42 33 46 29 25 13 26 27 29 29 12 25 42 11 33 20 32 31 41 19 32 26 20 27 30 31 15 12 37 46 40 31 26 48 46 10 9 23 20 28 24 25 21 31 34 33 27 46 14 27 17 13 22 24 30 18 32 27 32 31 30 13 29 26 14 15 23 30 25 31 22 13 9 28 11 7 10 18 48 44 44 23 25 32 18 38 32 32 26 37 35 28 30 24 21 31 31 24 29 14 28 18 23 25 29 43 28 11 9 32 12 18 44 39 33 27 32 36 33 15 28 16 23 31 31 32 9 13 14 32 18 27 32 39 39 37 8 20 9 17 18 7 40 26 15 14 32 14 21 19 17 19 18 15 21 6 4 4 6 43 36 19 7 7 6 6 12 16 15 12 13 6 6 8 6 9 14 9 18 15 7 12 30 9 14 6 13 16 11 8 4 3 3 4 4 10 9	Open. Hide. 62 49 44 44 62 62 62 62 62 62 62 59 62 62 62 59 62 49 46 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 59 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 54 49 54 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 54 62 62 62 62 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 54 51 62 62 62 56 62 62 62 62 62 62 62 56 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 48 62 52 62 62 62 62 62 62 62 54 62 62 62 62 62 54 58 58 54 58 58 58 52 58 58 58 58 58 58 58 54 54 58 42 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 54 58 58 58 58 54 54 58 58 58 41 54 52 58 54 58 58 54 58 54 58 58 52 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 50 45 41 51 49 54 48 50 58 58 54 53 53 50 54 51 53 54 58 49 48 38 48 51 51 50 58 58 58 50 39 40 51 51 50 37 53 41 58 50 54 58 58 54 48 50 54 51 50 46 49 51 39 58 37 41 39 58 51 51 47 51 50 46 54 53 46 54 43 19 58 41 28 39 41 53 50 39 44 21 58 28 16 44 35 53 53 51 49 37 51 32 52 38 40 54 50 32 58 53 51 58 44 50 53 51 51 39 40 15 54 39 27 54 49 29 44 30 35 45 49 30 49 38 14 49 46 25 52 51 28 54 51 54 54 54 42 47 45 49 50 39 35 41 30 7 54 52 31 16 54 34 41 53 52 49 34 47 38 46 53 51 54 54 38 37 34 26 31 52 34 34 53 52 32 54 54 33 32 36 27 54 26 42 28 40 28 14 35 32 28 53 33 31 53 45 34 32 32 32 52 45 35 31 42 32 24 44 33 18 43 30 32 32 32 31 6 7 9 13 53 45 32 45 31 43 30 33 28 43 29 24 38 40 17 30 31 8 31 33 11 36 40 18 26 28 9 31 31 14 31 33 33 51 30 19 30 31 31 34 31 33 31 31 31 31 32 7 14 16 27 30 31 37 28 31 19 31 21 13 37 19 29 11 38 32 24 38 30 35 32 32 29 9 17 37 48 36 10 16 26 28 30 25 26 31 28 17 30 32 29 27 14 29 24 35 33 36 29 25 16 32 31 31 31 31 32 31 36 26 35 29 31 29 30 19 31 24 30 25 14 19 31 10 11 22 36 8 11 9 10 30 11 25 41 30 24 25 18 21 31 31 23 24 29 7 21 13 29 30 20 22 31 15 26 31 31 20 26 25 36 27 20 38 17 11 24 9 6 6 11 32 31 25 22 12 18 15 32 13 14 17 18 33 25 16 6 6 17 39 9 39 13 26 8 21 12 7 5 6 7 11 18 14 18 6 23 21 32 32 19 14 12 28 21 21 24 16 9 21 31 21 16 13 16 6 13 14 11 21 13 11 6 6 8 25 7 5 4 6 23 21 18 6 4 9 16 8 7 7 9 6 3 6 8 18 13 26 10 16 7 29 10 10 11 27 14 22 34 30 6 8 20 7 29 11 7 8 16 6 7 11 5 16 6 10 18 6 4 5 11 7 8 9 15 11 7 10 6 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_77370747_77371830
seq2: B6Ng01-214H19.b_48_1132 (reverse)

seq1  GAAGAGAGAAAGT-GGGTCCAGGATAGTTCATGAGAAAACACTTGAAGCA  49
      |||||| |||||| ||||||||||||||||||||||||||||||||||||
seq2  GAAGAGCGAAAGTGGGGTCCAGGATAGTTCATGAGAAAACACTTGAAGCA  50

seq1  GAGAAAACCAT-AAAATGCAAGTAGCACAGGGATTTTGCCTGGGAGGTAG  98
      ||| ||||||| ||||||||||||||||||||||||||||| ||||||||
seq2  GAG-AAACCATAAAAATGCAAGTAGCACAGGGATTTTGCCT-GGAGGTAG  98

seq1  CCAGATTAGGATAGATTAAAA--TAGAGTAATAACTGCTCAGTTATTGTG  146
      |||||||||||||||||||||   ||||||||||||||||||||||||||
seq2  CCAGATTAGGATAGATTAAAAATAAGAGTAATAACTGCTCAGTTATTGTG  148

seq1  CCCTCACAGCTGTAAAATAAATGTAATAGCTCAGTCTCAATTATTTGGGA  196
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CCCTCACAGCTGTAAAATAAATGTAATAGCTCAGTCTCAATTA-TTGGGA  197

seq1  GCCAACTGGGTAAGGGGAAAACTGTAACACACCTTTTAAAGTGCCACTAA  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAACTGGGTAAGGGGAAAACTGTAACACACCTTTTAAAGTGCCACTAA  247

seq1  AAATGTCCTGTCCAGCAAGTCCACGCAGCTGTGGGAAGGCAGCAGACACA  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTCCTGTCCAGCAAGTCCACGCAGCTGTGGGAAGGCAGCAGACACA  297

seq1  CTGGAACTGAATACACAGGATGCTCAACACTGAAAAGGTCGCTACAGACA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAACTGAATACACAGGATGCTCAACACTGAAAAGGTCGCTACAGACA  347

seq1  AACAGACGTCTGAGGCCCTGCTGCAGGTAGGGGAAGCTAAGAAGTCAGTG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGACGTCTGAGGCCCTGCTGCAGGTAGGGGAAGCTAAGAAGTCAGTG  397

seq1  TCAACCAGCCTGCATCAGTATAATGAGCTCCTAAGACAAATGACAGCCAG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACCAGCCTGCATCAGTATAATGAGCTCCTAAGACAAATGACAGCCAG  447

seq1  GAGAAATCCAGAGAGAGCGGGTCAGCATGAGGGCCAGACCATAGCTGTTA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAATCCAGAGAGAGCGGGTCAGCATGAGGGCCAGACCATAGCTGTTA  497

seq1  AGGCCTGTGGTGTCTCCTGGCATCACTGGCTTGGTTAAGGGATGACCTGG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTGTGGTGTCTCCTGGCATCACTGGCTTGGTTAAGGGATGACCTGG  547

seq1  AAGCAGAGGAGCTCTTAAGAAATCTCTCAGCATGTCTTTGTTTCCTTGTC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGAGGAGCTCTTAAGAAATCTCTCAGCATGTCTTTGTTTCCTTGTC  597

seq1  TGCCTTCTTGGACTAGGCATGGGACTGTGATTTGGGTTCATACCTTGAAT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTCTTGGACTAGGCATGGGACTGTGATTTGGGTTCATACCTTGAAT  647

seq1  GTTGGAGGCTTCACCCCTGACACGGTGCTTCTGGAAGGTGGTGGGACCTT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGAGGCTTCACCCCTGACACGGTGCTTCTGGAAGGTGGTGGGACCTT  697

seq1  CAGGAGGTGGAACTGAATTGGAATAGGGGGTGTCTCCAGTCATTGCAGAG  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGGTGGAACTGAATTGGAATAGGGGGTGTCTCCAGTCATTGCAGAG  747

seq1  GTACCCTTGGAGGAAACCATGACCTGCATCTCTCAGTGAATCTCTCAGCT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACCCTTGGAGGAAACCATGACCTGCATCTCTCAGTGAATCTCTCAGCT  797

seq1  GGTGGGCATGAGATTGGTTTGTTTTGCTCCCACGTGCTCACCCCACCCCC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGGCATGAGATTGGTTTGTTTTGCTCCCACGTGCTCACCCCACCCCC  847

seq1  ATCTGTGCACCATCATGATATTAATGCATGCAGTGACTTAATCGCATGAC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGTGCACCATCATGATATTAATGCATGCAGTGACTTAATCGCATGAC  897

seq1  ATAAGGTGGACAAGGAGCTGCCAGGCCAGCCAGAGCAGAGCCGGTTGCTT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGTGGACAAGGAGCTGCCAGGCCAGCCAGAGCAGAGCCGGTTGCTT  947

seq1  TTTATATCCTTTTTTTTTTTCTTCAACAGTTTGAGCCAGGCGACCTCCTC  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATATCCTTTTTTTTTTTCTTCAACAGTTTGAGCCAGGCGACCTCCTC  997

seq1  TGTGCCACTATAATCCTTGTTTTTCCCAGAAATCCTAGATCTCCCGGGAT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCACTATAATCCTTGTTTTTCCCAGAAATCCTAGATCTCCCGGGAT  1047

seq1  TCTTGGATCTCCAGGGATTCCTGGATCGTCCAGAATTC  1084
      ||||||||||||||||||||||||||||||||||||||
seq2  TCTTGGATCTCCAGGGATTCCTGGATCGTCCAGAATTC  1085

seq1: chr10_77249668_77250741
seq2: B6Ng01-214H19.g_64_1140

seq1  GAATTCCTGTGAAGCTACAACCCTGAGTTTCTCCCAGGGTTTCAGGACAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGTGAAGCTACAACCCTGAGTTTCTCCCAGGGTTTCAGGACAA  50

seq1  GGGCATGCCTTATCTCCTCTCCAAGATATGCCTCTTTCTCACAATGAAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCATGCCTTATCTCCTCTCCAAGATATGCCTCTTTCTCACAATGAAAC  100

seq1  CCTTTCCAAGGATTTATCAGAGTCACTCTGTGAGCCCCAAGACAGGAAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTCCAAGGATTTATCAGAGTCACTCTGTGAGCCCCAAGACAGGAAAG  150

seq1  TCCTGGCCCAGACCCAGAGGAGGTAGAACCCGGATCCCAGTATCAGAGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGCCCAGACCCAGAGGAGGTAGAACCCGGATCCCAGTATCAGAGCA  200

seq1  TGGAACAAGGGGACAGAAGCTGTGTAAAGACTCCAAGCCTCACAGCTGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAACAAGGGGACAGAAGCTGTGTAAAGACTCCAAGCCTCACAGCTGAA  250

seq1  GATACAGAGATAGTGGAAGAGGATAACAGTCACTGTGGAGACATAATCGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATACAGAGATAGTGGAAGAGGATAACAGTCACTGTGGAGACATAATCGA  300

seq1  TCAGAAGAACTTTTATTAATATGCATTGGTCGAGAGTAGTACAGCTGACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAAGAACTTTTATTAATATGCATTGGTCGAGAGTAGTACAGCTGACC  350

seq1  ACAGATGCAGGGTCATCCAGACAGGGAGGGAGGAAGAAGCCAGCTCTCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGATGCAGGGTCATCCAGACAGGGAGGGAGGAAGAAGCCAGCTCTCCT  400

seq1  GTGACCTGGTGAGGAGGAATCTGCTGGGCCTTCTAAGGGGTCGAGCTACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACCTGGTGAGGAGGAATCTGCTGGGCCTTCTAAGGGGTCGAGCTACA  450

seq1  CTCAGGTTTCTCGTCAGACTGTACACATCTTTCTTCTGAGCTGTGCCTCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGTTTCTCGTCAGACTGTACACATCTTTCTTCTGAGCTGTGCCTCC  500

seq1  ATCAGTAGCAACCACAGGCTGATGGAGGTGTGGTTCTGTGCCCTGCTGCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGTAGCAACCACAGGCTGATGGAGGTGTGGTTCTGTGCCCTGCTGCC  550

seq1  TTAGTGGGGCCTGGCCCTCAGCAGCTGGACTTCTGTCCACAGCAGGCCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTGGGGCCTGGCCCTCAGCAGCTGGACTTCTGTCCACAGCAGGCCTG  600

seq1  TCTGCAGCAGGCAGGGCGGCACAGCAGGGACACAGAGGAGGTTGGGCCAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCAGCAGGCAGGGCGGCACAGCAGGGACACAGAGGAGGTTGGGCCAC  650

seq1  AGCAGCTGGGCTGGCAGGAGGAGGCACAGCAGGAGGAGGTGGGCACACAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGCTGGGCTGGCAGGAGGAGGCACAGCAGGAGGAGGTGGGCACACAG  700

seq1  CAGGCAGGTCTGCACACTGGGCGACACAGCAGGGACAGGCTGGAGCAGGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCAGGTCTGCACACTGGGCGACACAGCAGGGACAGGCTGGAGCAGGG  750

seq1  CTTGCAGCACACAGGAGCACAGCAGGAGGGCTGGCAGCAGGAGGAGGAGC  800
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  CTTGCAGCACACAGGAGCACAGCA-GAGGGCTGGCAGCAGGAGGAGGAGC  799

seq1  CAGAGCAGATGGGTGTGCAGCACACAGGCTTGCAGCAGATAGGCACACAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCAGATGGGTGTGCAGCACACAGGCTTGCAGCAGATAGGCACACAG  849

seq1  CAGGGGGATTGACAGCATGAGGACTGGCAGCTAGACTGCTGGCAGCATGG  900
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  CA-GGGGATTGACAGCATGAGGACTGGCAGCTAGACTGCTGGCAGCATGG  898

seq1  TCCAGAGCAGATGGGTGTGCAGCAGACAGGCTTGCAGCAAAGGGTCA-CA  949
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  TCCAGAGCAGATGGGTGTGCAGCAGACAGGCTTGCAGCAAAGGGTCACCA  948

seq1  CAGCAGGATGGCTGGCAGGGGGAGCAGGTGCAGCAAGCTGGCTGGCAGCT  999
      ||||||||||||||||||| ||||||| |||||| |||||||||||||||
seq2  CAGCAGGATGGCTGGCAGGTGGAGCAGTTGCAGCCAGCTGGCTGGCAGCT  998

seq1  AGACTG-CTGGCAGCATGAGGGTGTGCAGCAGGAAGATTGGCAGCAGGGG  1048
      |||||| ||||||||||   ||||||||||  ||||||| ||||||||||
seq2  AGACTGCCTGGCAGCATTGAGGTGTGCAGCCAGAAGATTTGCAGCAGGGG  1048

seq1  CTGGACA-CACAG-CTCACT-GGGGTGCA  1074
      || |||| ||||| |||||| ||||||||
seq2  CTTGACACCACAGCCTCACTGGGGGTGCA  1077

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information