MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-276M11
Chromosome	10 (Build37)
Map Location	125,826,246 - 126,000,089
singlet/doublet	doublet
Overlap gene	none
Upstream gene	LOC100042987, EG668313, LOC100042992, LOC668317, LOC100042994, Lrig3, LOC100043547
Downstream gene	LOC668336, Xrcc6bp1, LOC622567, Ctdsp2, Avil, Tsfm, Mettl1, Cyp27b1, March9, Cdk4, Tspan31, Centg1, Os9, LOC100043028, B4galnt1, LOC100043035, C78409, D10Ertd610e, Dtx3, Pip5k2c, Kif5a, Dctn2, Mbd6, LOC100043045, Ddit3, Mars, LOC622075, Arhgap9, Gli1, Inhbe, Inhbc, R3hdm2, Stac3, Ndufa4l2, Shmt2, Nxph4, Lrp1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG668313 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668313 MGI:3645362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	LOC668317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Lrig3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320398 MGI:2443955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins pseudo : _no_value

name	LOC668336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Xrcc6bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68876 MGI:1916984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Ctdsp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52468 MGI:1098748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avil (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11567 MGI:1333798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsfm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66399 MGI:1913649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mettl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17299 MGI:1339986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp27b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13115 MGI:1098274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216438 MGI:2446144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12567 MGI:88357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67125 MGI:1914375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216439 MGI:3580016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Os9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216440 MGI:1924301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	B4galnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14421 MGI:1342057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043035 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	C78409 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216441 MGI:2143920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	D10Ertd610e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52666 MGI:1277173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80904 MGI:2135752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117150 MGI:2152214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16572 MGI:109564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dctn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69654 MGI:107733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110962 MGI:106378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043045 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ddit3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13198 MGI:109247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216443 MGI:1345633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Arhgap9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216445 MGI:2143764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gli1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14632 MGI:95727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inhbe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16326 MGI:109269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inhbc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16325 MGI:105932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	R3hdm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71750 MGI:1919000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237611 MGI:3606571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa4l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407790 MGI:3039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 57 ESTs, 5 Proteins

name	Shmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108037 MGI:1277989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxph4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104080 MGI:1336197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16971 MGI:96828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042987 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261100 GeneID:100042987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042987 transcript_id : XM_001479239.1

name	EG668313 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388718 GeneID:668313 MGI:3645362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668313 transcript_id : XM_001000832.1

name	LOC100042992 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261102 GeneID:100042992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001479245.1

name	Lrig3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475967 GeneID:320398 MGI:2443955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and immunoglobulin-like domains 3 transcript_id : NM_177152.4

name	Xrcc6bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754037 GeneID:68876 MGI:1916984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : XRCC6 binding protein 1 transcript_id : NM_026858.2

name	Ctdsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122478 GeneID:52468 MGI:1098748
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 transcript_id : NM_146012.1

name	Avil (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475908 GeneID:11567 MGI:1333798
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : advillin transcript_id : NM_009635.2

name	Tsfm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130307 GeneID:66399 MGI:1913649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ts translation elongation factor, mitochondrial transcript_id : NM_025537.3

name	Mettl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754681 GeneID:17299 MGI:1339986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase-like 1 transcript_id : NM_010792.1

name	Cyp27b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51890202 GeneID:13115 MGI:1098274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 27, subfamily b, polypeptide 1 transcript_id : NM_010009.1

name	March9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802613 GeneID:216438 MGI:2446144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 9 transcript_id : NM_001033262.2

name	Cdk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560614 GeneID:12567 MGI:88357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 4 transcript_id : NM_009870.2

name	Tspan31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803175 GeneID:67125 MGI:1914375
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 31 transcript_id : NM_025982.2

name	Centg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363313 GeneID:216439 MGI:3580016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, gamma 1 transcript_id : NM_001033263.2

name	Os9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341352 GeneID:216440 MGI:1924301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amplified in osteosarcoma transcript_id : NM_177614.2

name	B4galnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130998 GeneID:14421 MGI:1342057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,4-N-acetyl-galactosaminyl transferase 1 transcript_id : NM_008080.4

name	LOC100043035 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261109 GeneID:100043035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : similar to solute carrier family 26, member 10 transcript_id : XM_001479384.1

name	C78409 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261207 GeneID:216441 MGI:2143920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : expressed sequence C78409 transcript_id : XM_001480853.1

name	D10Ertd610e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362982 GeneID:52666 MGI:1277173
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, ERATO Doi 610, expressed transcript_id : NM_028027.2

name	Dtx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71143148 GeneID:80904 MGI:2135752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 3 homolog (Drosophila) transcript_id : NM_030714.2

name	Pip5k2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543483 GeneID:117150 MGI:2152214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type II, gamma transcript_id : NM_054097.2

name	Kif5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345296 GeneID:16572 MGI:109564
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 5A transcript_id : NM_001039000.2

name	Kif5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130812 GeneID:16572 MGI:109564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 5A transcript_id : NM_008447.3

name	Dctn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076934 GeneID:69654 MGI:107733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 2 transcript_id : NM_027151.1

name	Mbd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778937 GeneID:110962 MGI:106378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl-CpG binding domain protein 6 transcript_id : NM_033072.2

name	LOC100043045 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261113 GeneID:100043045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043045 transcript_id : XM_001479400.1

name	Ddit3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982414 GeneID:13198 MGI:109247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA-damage inducible transcript 3 transcript_id : NM_007837.2

name	Mars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491851 GeneID:216443 MGI:1345633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine-tRNA synthetase transcript_id : NM_001003913.1

name	Arhgap9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90093350 GeneID:216445 MGI:2143764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 9 transcript_id : NM_146011.2

name	Gli1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90186272 GeneID:14632 MGI:95727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLI-Kruppel family member GLI1 transcript_id : NM_010296.2

name	Inhbe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680452 GeneID:16326 MGI:109269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibin beta E transcript_id : NM_008382.1

name	Inhbc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560578 GeneID:16325 MGI:105932
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibin beta-C transcript_id : NM_010565.2

name	R3hdm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76559939 GeneID:71750 MGI:1919000
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : R3H domain containing 2 transcript_id : NM_027900.3

name	Stac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803518 GeneID:237611 MGI:3606571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and cysteine rich domain 3 transcript_id : NM_177707.3

name	Ndufa4l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388702 GeneID:407790 MGI:3039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 57 ESTs, 5 Proteins product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2, transcript variant 2 transcript_id : XM_001004705.1

name	Shmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130451 GeneID:108037 MGI:1277989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine hydroxymethyltransferase 2 (mitochondrial) transcript_id : NM_028230.3

name	Nxph4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676392 GeneID:104080 MGI:1336197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexophilin 4 transcript_id : NM_183297.2

name	Lrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124494255 GeneID:16971 MGI:96828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein 1 transcript_id : NM_008512.2

name	LOC100042987 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261101 GeneID:100042987
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479289.1

name	LOC100042992 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261103 GeneID:100042992
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479295.1

name	Lrig3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475968 CCDS:CCDS24219.1 GeneID:320398 MGI:2443955
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine-rich and immunoglobulin-like domains 3 protein_id : NP_796126.3

name	Xrcc6bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754038 CCDS:CCDS24220.1 GeneID:68876 MGI:1916984
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : XRCC6 binding protein 1 protein_id : NP_081134.2

name	Ctdsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122479 GeneID:52468 MGI:1098748
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] codon_start : 1 note : NLI-interacting factor 2 product : Nuclear LIM interactor-interacting factor 2 protein_id : NP_666124.1

name	Avil (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857753 CCDS:CCDS24221.1 GeneID:11567 MGI:1333798
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007015 - actin filament organization [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 exception : mismatches in translation product : advillin protein_id : NP_033765.1

name	Tsfm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313468 CCDS:CCDS24222.1 GeneID:66399 MGI:1913649
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 note : translation elongation factor product : Ts translation elongation factor, mitochondrial protein_id : NP_079813.1

name	Mettl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754682 CCDS:CCDS24223.1 GeneID:17299 MGI:1339986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008176 - tRNA (guanine-N7-)-methyltransferase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0006400 - tRNA modification [Evidence ISS]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : methyltransferase-like 1 protein_id : NP_034922.1

name	Cyp27b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51890203 CCDS:CCDS24224.1 GeneID:13115 MGI:1098274
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004498 - calcidiol 1-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 40 (25-hydroxyvitamin D3 1 alpha-hydroxylase); P450VD1alpha; 1alpha(OH)ase; 25(OH)D 1alpha-hydroxylase; 25-hydroxyvitamin D3 1alpha-hydroxylase; cytochrome P450, 27b1 product : cytochrome P450, family 27, subfamily b, polypeptide 1 protein_id : NP_034139.1

name	March9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781787 CCDS:CCDS24225.1 GeneID:216438 MGI:2446144
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : membrane-associated ring finger (C3HC4) 9 protein_id : NP_001028434.1

name	Cdk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753380 CCDS:CCDS24226.1 GeneID:12567 MGI:88357
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : p34/cdk4; serine/threonine kinase; cyclin dependent kinase 4 product : cyclin-dependent kinase 4 protein_id : NP_034000.1

name	Tspan31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385482 CCDS:CCDS24227.1 GeneID:67125 MGI:1914375
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : sarcoma amplified sequence protein_id : NP_080258.1

name	Centg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370300 CCDS:CCDS24228.1 GeneID:216439 MGI:3580016
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005768 - endosome [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008060 - ARF GTPase activator activity [Evidence ISS]; GO:0005524 - ATP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence IEA] [Evidence ISS]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0035014 - phosphoinositide 3-kinase regulator activity [Evidence ISS]; GO:0030295 - protein kinase activator activity [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0016197 - endosome transport [Evidence ISS]; GO:0045860 - positive regulation of protein kinase activity [Evidence ISS]; GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : centaurin, gamma 1 protein_id : NP_001028435.1

name	Os9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243990 CCDS:CCDS24229.1 GeneID:216440 MGI:1924301
definition	codon_start : 1 exception : mismatches in translation product : amplified in osteosarcoma protein_id : NP_808282.1

name	B4galnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679929 CCDS:CCDS24230.1 GeneID:14421 MGI:1342057
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003947 - (N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IMP] [Evidence IGI]; GO:0030259 - lipid glycosylation [Evidence IEA]; GO:0019915 - sequestering of lipid [Evidence IGI] codon_start : 1 note : GM2/GD2 synthase; UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)- galactosylglucosylceramide-beta-1, 4-N-acetylgalactosaminyltransferase; beta1,4GalNAC-T product : beta-1,4-N-acetylgalactosaminyltransferase protein_id : NP_032106.1

name	LOC100043035 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261110 GeneID:100043035
definition	codon_start : 1 product : similar to solute carrier family 26, member 10 protein_id : XP_001479434.1

name	C78409 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261208 GeneID:216441 MGI:2143920
definition	codon_start : 1 product : hypothetical protein LOC216441 protein_id : XP_001480903.1

name	D10Ertd610e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26553439 CCDS:CCDS24231.1 GeneID:52666 MGI:1277173
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAC/CDC42 exchange factor protein_id : NP_082303.1

name	Dtx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507662 GeneID:80904 MGI:2135752
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007219 - Notch signaling pathway [Evidence TAS] [Evidence IDA] codon_start : 1 product : deltex 3 protein_id : NP_109639.1

name	Pip5k2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17298686 CCDS:CCDS24232.1 GeneID:117150 MGI:2152214
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : phosphatidylinositol-4-phosphate 5-kinase, type II, gamma protein_id : NP_473438.1

name	Kif5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781727 CCDS:CCDS24233.1 GeneID:16572 MGI:109564
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005871 - kinesin complex [Evidence TAS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence TAS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : kinesin family member 5A protein_id : NP_001034089.1

name	Kif5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254635 CCDS:CCDS24233.1 GeneID:16572 MGI:109564
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005871 - kinesin complex [Evidence TAS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence TAS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : kinesin family member 5A protein_id : NP_032473.2

name	Dctn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076935 CCDS:CCDS24234.1 GeneID:69654 MGI:107733
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005869 - dynactin complex [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0030426 - growth cone [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : dynactin 2 protein_id : NP_081427.1

name	Mbd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778938 CCDS:CCDS24235.1 GeneID:110962 MGI:106378
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : methyl-CpG binding domain protein 6 protein_id : NP_149063.2

name	LOC100043045 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261114 GeneID:100043045
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479450.1

name	Ddit3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982415 CCDS:CCDS24236.1 GeneID:13198 MGI:109247
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IEA]; GO:0006983 - ER overload response [Evidence IMP]; GO:0042789 - mRNA transcription from RNA polymerase II promoter [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0030503 - regulation of cell redox homeostasis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0030968 - unfolded protein response [Evidence IMP] codon_start : 1 exception : mismatches in translation note : C/EBP homoologous protein 10 product : DNA-damage inducible transcript 3 protein_id : NP_031863.2

name	Mars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491852 CCDS:CCDS24237.1 GeneID:216443 MGI:1345633
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004825 - methionine-tRNA ligase activity [Evidence IEA] [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IEA] GO_process : GO:0006431 - methionyl-tRNA aminoacylation [Evidence ISS] [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0009303 - rRNA transcription [Evidence ISS]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 note : methionine tRNA ligase product : methionyl-tRNA synthetase protein_id : NP_001003913.1

name	Arhgap9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90093351 GeneID:216445 MGI:2143764
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 9 protein_id : NP_666123.2

name	Gli1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90186273 CCDS:CCDS24238.1 GeneID:14632 MGI:95727
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0008589 - regulation of smoothened signaling pathway [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS]; GO:0007283 - spermatogenesis [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 5 product : GLI-Kruppel family member GLI1 protein_id : NP_034426.2

name	Inhbe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680453 CCDS:CCDS24239.1 GeneID:16326 MGI:109269
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : activin; activin betaE product : inhibin beta E protein_id : NP_032408.1

name	Inhbc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754354 CCDS:CCDS24240.1 GeneID:16325 MGI:105932
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : activin product : inhibin beta-C protein_id : NP_034695.1

name	R3hdm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76559940 CCDS:CCDS24241.1 GeneID:71750 MGI:1919000
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : R3H domain containing 2 protein_id : NP_082176.3

name	Stac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244166 CCDS:CCDS24242.1 GeneID:237611 MGI:3606571
definition	GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : SH3 and cysteine rich domain 3 protein_id : NP_808375.1

name	Ndufa4l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388703 GeneID:407790 MGI:3039567
definition	codon_start : 1 product : similar to NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 isoform 2 protein_id : XP_001004705.1

name	Shmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312298 CCDS:CCDS24244.1 GeneID:108037 MGI:1277989
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006544 - glycine metabolism [Evidence IEA]; GO:0006563 - L-serine metabolism [Evidence IEA] codon_start : 1 note : serine hydroxymethyl transferase 2 (mitochondrial) product : serine hydroxymethyltransferase 2 (mitochondrial) protein_id : NP_082506.1

name	Nxph4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676393 GeneID:104080 MGI:1336197
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] codon_start : 1 product : neurexophilin 4 protein_id : NP_899120.2

name	Lrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124494256 CCDS:CCDS24245.1 GeneID:16971 MGI:96828
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 note : alpha 2-macroglobulin receptor; lipoprotein receptor-related protein product : low density lipoprotein receptor-related protein 1 protein_id : NP_032538.2

name	LOC668317 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668317
definition	number : 1 pseudo : _no_value

name	LOC100042994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042994
definition	number : 1 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 4 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 3 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 2 pseudo : _no_value

name	LOC668336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668336
definition	number : 1 pseudo : _no_value

name	LOC622567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622567
definition	number : 1 pseudo : _no_value

name	LOC100043028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043028
definition	number : 2 pseudo : _no_value

name	LOC100043028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043028
definition	number : 1 pseudo : _no_value

name	LOC100043547 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261206 GeneID:100043547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : similar to ribosomal protein S19 pseudo : _no_value transcript_id : XR_034853.1

name	LOC622075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261209 GeneID:622075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034887.1

clone name	MSMg01-448N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-108J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-276M11.b	B6Ng01-276M11.g
ACC	GA077471	GA077472
length	806	1,179
definition	B6Ng01-276M11.b	B6Ng01-276M11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(125,999,289 - 126,000,089)	(125,826,246 - 125,827,409)
sequence	gaattctaggtctggtggagcaatggggaagtaggatgacttagctaagt ggtgttgccttgttgctttcatggctgtgactagagagaagtccctctgt gctatttcaggcactgtcagttttggtctacgaagcatatagctaaatct gcccattccttaatacacatactgagaatgaaagtgtcttagttagggtt ttacttctgtgaacagacaccatgaccaaggcaactcttataaggacaac atttaattgaggttggcttgcaggttcagaggttcagtccattatcatca aggcgggagcatggcagtgtccaagcaggagtggtacaggcagagctgag agttctacatcttcatctgaaggctgctagtggaagcctgacttccaggc agctaaggtgagggtcttaagcccacacccacagtgccacacctactcta acacctcctaatagtgctacttcctgggctgagcatatacaaaccataac agcaagaattctgttatgcatgtatgacagtctgcggtgttgaacttgca ataatgggctgagtgttaactgggaagcaaagagaaaatggagcaccctg tgaatccaggtttgtgttaatgcatacacaccagcacattcaacatgtgt ttgtgcacatgtgtatgtatgtgtgttgggaacaaaaaaagggggggggt ccctggggaagaggtgggaggagaaccccacactccgtcagagtttttac ctatttctctgggctgccagagcatggggagggctggttactacccttcc attcat	gaattcctcatggttacgcaagcttttggtgactccaagacagaaccgaa tataatctgtttcattttgcttggaatacctcagccacatgacatatata tatatagtattgattaaataacaaacacctattatgtatagttctggaac ctggtaagtctgcagtctgggtaccagtacactggatatctaaaatcgat ctttgtttaaggatggccttaggctctctgtgacctcaaaggacctttcc ttgacatgtccgagaaatggagatttggtgtctctttccctctttataag ggcgctcttcccattgtgacttatggcactaaccctactcaccccccaag agccccaccttcatctgcagccacactggagatgaatgggaacttgaata tttgaatatgggaagaaagaaacacaagtgcccagtccatagcacgggcc ttaacttacttttaaggaagttagcttatacaccgtgaattaatgtaagt aggtaggtatggcttccacagggaaggaccccaccatctgaatgatcccc tatagtactggtttctacatgtttgatgcagacagcattgcctttgttaa gtggagctacaggagctgaacagtctaaatactttatcaaactgtaaatg ctaaggggaagaaagcacccaccaacactcttctgaaagaagtgtagcaa agccatttcctagtgccttggaacccagaactcagtctcacttggaatag agaaggtcacttgtcagcagcaatgtaaaaggagtcattcagacaaaacg taagtcaacatccgctgaatgttaaaacaaggcagctagaaacaagaggt gcagagaatcaaggctgcgttgttaggcattgcccctgacataaaacatt aaaatgatgtgtatgtttcatgaaagatgttacatttgaaggattggtct gttgttatgtattgtgatgctgagtgtggtctcccaaggcctggtttgct ccagagaggagtctgcacatagacccaagtgacactatgtgacctttgcc ccccacgtaatttctgaattggtgaatagagaatgtccctaagaagctgc gtagaactggaaatagcaagtcttgggggtttccaggaccaagaagtcac cgtcctgtagagggttggccaaggtggag
quality values	Open. Hide. 41 22 33 24 58 52 52 30 62 49 62 62 54 62 62 62 62 62 47 56 56 62 62 49 62 62 62 62 47 62 19 22 23 12 24 21 27 30 15 19 24 23 28 23 36 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 49 51 50 38 29 25 35 46 43 34 46 43 59 49 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 59 54 62 62 59 62 62 62 62 62 54 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 43 43 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 43 49 62 62 49 44 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 49 62 56 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 39 58 58 49 54 54 58 54 58 58 58 58 58 58 52 47 52 58 58 53 58 41 58 58 58 44 39 58 58 58 50 54 54 45 41 41 52 58 58 43 49 58 54 58 54 52 58 58 54 58 58 58 51 53 54 42 47 42 42 58 49 51 58 51 58 50 58 51 58 45 40 50 58 50 58 49 58 54 51 41 54 51 52 58 51 53 53 58 58 58 58 58 58 54 37 51 46 58 58 58 58 49 50 47 58 51 49 46 58 47 58 58 58 53 49 58 48 43 49 48 35 50 51 58 58 58 58 49 37 58 58 58 58 58 58 49 41 37 50 42 30 37 58 58 41 39 32 43 9 23 11 43 19 42 21 21 26 11 40 33 9 6 5 9 16 14 21 18 37 28 32 6 39 20 18 9 39 29 16 50 9 10 18 15 13 9 6 6 4 9 16 10 26 15 22 15 13 15 15 11 9 17 7 13 9 15 16 19 12 18 13 13 19 21 10 15 5 24 13 37 37 20 15 8 13 10 6 9 9 9 15 9 18 13 13 25 15 14 18 9 6 15 12 14	Open. Hide. 62 47 56 47 62 62 62 62 47 54 24 34 28 18 19 18 16 18 23 23 36 33 45 50 50 62 62 62 59 62 62 59 49 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 41 49 51 38 43 48 50 59 46 59 56 49 49 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 54 42 42 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 43 54 49 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 43 44 59 62 49 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 41 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 54 47 62 54 62 62 49 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 52 62 62 62 62 52 62 62 62 62 62 62 62 62 62 47 42 62 62 62 52 58 58 54 58 58 58 58 58 54 58 58 54 54 54 58 58 54 58 54 54 58 58 58 58 54 58 58 58 54 58 54 54 54 54 54 49 58 58 58 54 58 58 58 54 58 54 58 38 49 48 58 58 58 58 58 54 54 52 43 42 54 54 58 58 41 42 58 54 58 58 54 58 37 58 58 31 54 52 52 58 45 38 58 58 54 58 48 50 49 49 58 49 42 48 47 47 50 47 48 49 52 42 50 46 41 44 47 30 40 54 51 53 49 58 37 58 51 50 51 38 48 34 58 58 46 58 50 52 58 49 49 40 48 31 47 50 48 36 49 40 31 50 49 50 49 54 54 53 58 49 49 49 35 58 48 30 54 51 32 39 51 32 49 24 48 40 58 58 30 37 44 32 49 58 37 40 49 28 47 32 52 52 37 44 39 25 49 27 43 40 27 58 50 50 33 54 44 33 53 34 39 35 29 42 42 37 28 39 33 33 44 32 54 49 41 45 32 52 29 41 38 19 51 34 39 30 39 51 35 49 40 34 39 32 51 41 29 46 21 29 31 52 42 32 54 54 39 24 47 51 16 20 31 33 45 39 37 29 19 47 31 27 54 54 32 30 30 37 51 19 21 37 31 37 31 33 10 25 14 11 9 18 45 47 47 27 29 45 20 51 29 52 47 33 40 24 31 47 41 26 34 31 32 53 35 32 53 52 26 33 29 31 31 51 26 31 25 30 28 24 18 32 16 33 24 28 31 27 27 24 36 18 31 31 35 24 33 29 32 22 30 34 21 30 29 33 32 29 33 17 46 41 32 15 29 32 26 14 19 34 46 42 31 26 31 26 35 31 46 46 23 20 31 31 17 18 29 36 32 19 25 31 30 48 26 31 21 32 36 27 48 43 30 31 18 31 32 12 14 31 20 15 46 21 13 7 17 24 20 30 28 8 18 16 6 23 32 37 25 21 25 13 33 26 31 31 21 19 33 26 19 5 17 21 14 14 23 27 15 25 9 25 32 18 18 24 7 10 22 17 44 33 30 21 22 24 8 14 29 13 24 7 43 14 21 32 33 17 10 4 6 31 7 19 9 27 25 8 10 21 21 32 21 13 23 18 23 21 7 17 11 43 26 8 20 19 11 33 28 12 5 10 11 9 15 20 18 11 22 10 13 10 15 6 7 21 17 34 28 30 9 13 12 8 17 3 4 14 40 27 27 24 10 4 7 28 13 24 9 3 5 3 11 7 11 5 6 5 3 6 8 7 4 18 33 14 24 20 8 4 3 7 16 20 19 18 8 3 2 6 13 23 24 6 13 9 5 6 3 7 4 5 9 3 5 4 3 1 3 2 7 15 15 28 29 16 5 11 6 8 20 5 4 3 2 1 1 4 14 4 11 12 1 1 2 7 6 3 7 4 17 18 4 6 6 6 7 6 8 16 17 3 7 7 6 3 5 12 6 4 8 4 7 10 4 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_125999289_126000089
seq2: B6Ng01-276M11.b_46_851 (reverse)

seq1  ATGAGTGGAA-GGTAGTTAGCAGCCCT-CCCATGC-CTGGCAGACCAGAG  47
      |||| ||||| |||||| | ||||||| ||||||| ||||||| ||||||
seq2  ATGAATGGAAGGGTAGTAACCAGCCCTCCCCATGCTCTGGCAGCCCAGAG  50

seq1  -AATAGGT-AAAACTCTGGCGGGGTGTGGGTCTCTCCTCCCACCTCTTCC  95
       ||||||| ||||||||| ||| |||||||  ||||||||||||||||||
seq2  AAATAGGTAAAAACTCTGACGGAGTGTGGGGTTCTCCTCCCACCTCTTCC  100

seq1  CCAGGGACCCCCCCCCTTTTTTTGTTCCCAACACACATACATACACATGT  145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGGACCCCCCCCCTTTTTTTGTTCCCAACACACATACATACACATGT  150

seq1  GCACAAACACATGTTGAATGTGCTGGTGTGTATGCATTAACACAAACCTG  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAAACACATGTTGAATGTGCTGGTGTGTATGCATTAACACAAACCTG  200

seq1  GATTCACAGGGTGCTCCATTTTCTCTTTGCTTCCCAGTTAACACTCAGCC  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCACAGGGTGCTCCATTTTCTCTTTGCTTCCCAGTTAACACTCAGCC  250

seq1  CATTATTGCAAGTTCAACACCGCAGACTGTCATACATGCATAACAGAATT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTATTGCAAGTTCAACACCGCAGACTGTCATACATGCATAACAGAATT  300

seq1  CTTGCTGTTATGGTTTGTATATGCTCAGCCCAGGAAGTAGCACTATTAGG  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCTGTTATGGTTTGTATATGCTCAGCCCAGGAAGTAGCACTATTAGG  350

seq1  AGGTGTTAGAGTAGGTGTGGCACTGTGGGTGTGGGCTTAAGACCCTCACC  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTTAGAGTAGGTGTGGCACTGTGGGTGTGGGCTTAAGACCCTCACC  400

seq1  TTAGCTGCCTGGAAGTCAGGCTTCCACTAGCAGCCTTCAGATGAAGATGT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTGCCTGGAAGTCAGGCTTCCACTAGCAGCCTTCAGATGAAGATGT  450

seq1  AGAACTCTCAGCTCTGCCTGTACCACTCCTGCTTGGACACTGCCATGCTC  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACTCTCAGCTCTGCCTGTACCACTCCTGCTTGGACACTGCCATGCTC  500

seq1  CCGCCTTGATGATAATGGACTGAACCTCTGAACCTGCAAGCCAACCTCAA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCCTTGATGATAATGGACTGAACCTCTGAACCTGCAAGCCAACCTCAA  550

seq1  TTAAATGTTGTCCTTATAAGAGTTGCCTTGGTCATGGTGTCTGTTCACAG  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATGTTGTCCTTATAAGAGTTGCCTTGGTCATGGTGTCTGTTCACAG  600

seq1  AAGTAAAACCCTAACTAAGACACTTTCATTCTCAGTATGTGTATTAAGGA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAAAACCCTAACTAAGACACTTTCATTCTCAGTATGTGTATTAAGGA  650

seq1  ATGGGCAGATTTAGCTATATGCTTCGTAGACCAAAACTGACAGTGCCTGA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGCAGATTTAGCTATATGCTTCGTAGACCAAAACTGACAGTGCCTGA  700

seq1  AATAGCACAGAGGGACTTCTCTCTAGTCACAGCCATGAAAGCAACAAGGC  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAGCACAGAGGGACTTCTCTCTAGTCACAGCCATGAAAGCAACAAGGC  750

seq1  AACACCACTTAGCTAAGTCATCCTACTTCCCCATTGCTCCACCAGACCTA  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACCACTTAGCTAAGTCATCCTACTTCCCCATTGCTCCACCAGACCTA  800

seq1  GAATTC  801
      ||||||
seq2  GAATTC  806

seq1: chr10_125826246_125827409
seq2: B6Ng01-276M11.g_67_1245

seq1  GAATTCCTCATGGTTACGCAAGCTTTTGGTGACTCCAAGACAGAACCGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTCATGGTTACGCAAGCTTTTGGTGACTCCAAGACAGAACCGAA  50

seq1  TATAATCTGTTTCATTTTGCTTGGAATACCTCAGCCACATGACATATATA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATCTGTTTCATTTTGCTTGGAATACCTCAGCCACATGACATATATA  100

seq1  TATATAGTATTGATTAAATAACAAACACCTATTATGTATAGTTCTGGAAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATAGTATTGATTAAATAACAAACACCTATTATGTATAGTTCTGGAAC  150

seq1  CTGGTAAGTCTGCAGTCTGGGTACCAGTACACTGGATATCTAAAATCGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTAAGTCTGCAGTCTGGGTACCAGTACACTGGATATCTAAAATCGAT  200

seq1  CTTTGTTTAAGGATGGCCTTAGGCTCTCTGTGACCTCAAAGGACCTTTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGTTTAAGGATGGCCTTAGGCTCTCTGTGACCTCAAAGGACCTTTCC  250

seq1  TTGACATGTCCGAGAAATGGAGATTTGGTGTCTCTTTCCCTCTTTATAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACATGTCCGAGAAATGGAGATTTGGTGTCTCTTTCCCTCTTTATAAG  300

seq1  GGCGCTCTTCCCATTGTGACTTATGGCACTAACCCTACTCACCCCCCAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGCTCTTCCCATTGTGACTTATGGCACTAACCCTACTCACCCCCCAAG  350

seq1  AGCCCCACCTTCATCTGCAGCCACACTGGAGATGAATGGGAACTTGAATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCCACCTTCATCTGCAGCCACACTGGAGATGAATGGGAACTTGAATA  400

seq1  TTTGAATATGGGAAGAAAGAAACACAAGTGCCCAGTCCATAGCACGGGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAATATGGGAAGAAAGAAACACAAGTGCCCAGTCCATAGCACGGGCC  450

seq1  TTAACTTACTTTTAAGGAAGTTAGCTTATACACCGTGAATTAATGTAAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTTACTTTTAAGGAAGTTAGCTTATACACCGTGAATTAATGTAAGT  500

seq1  AGGTAGGTATGGCTTCCACAGGGAAGGACCCCACCATCTGAATGATCCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTAGGTATGGCTTCCACAGGGAAGGACCCCACCATCTGAATGATCCCC  550

seq1  TATAGTACTGGTTTCTACATGTTTGATGCAGACAGCATTGCCTTTGTTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGTACTGGTTTCTACATGTTTGATGCAGACAGCATTGCCTTTGTTAA  600

seq1  GTGGAGCTACAGGAGCTGAACAGTCTAAATACTTTATCAAACTGTAAATG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAGCTACAGGAGCTGAACAGTCTAAATACTTTATCAAACTGTAAATG  650

seq1  CTAAGGGGAAGAAAGCACCCACCAACACTCTTCTGAAAGAAGTGTAGCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGGGGAAGAAAGCACCCACCAACACTCTTCTGAAAGAAGTGTAGCAA  700

seq1  AGCCATTTCCTAGTGCCTTGGAACCCAGAACTCAGTCTCACTTGGAATAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCATTTCCTAGTGCCTTGGAACCCAGAACTCAGTCTCACTTGGAATAG  750

seq1  AGAAGGTCACTTGTCAGCAGCAATGTAAAAGGAGTCATTCAGACAAAACG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGGTCACTTGTCAGCAGCAATGTAAAAGGAGTCATTCAGACAAAACG  800

seq1  TAAGTCAACATCCGCTGAATGTTAAAACAAGGCAGCTAGAAACAAGAGGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTCAACATCCGCTGAATGTTAAAACAAGGCAGCTAGAAACAAGAGGT  850

seq1  GCAGAGAATCAAGGCTGCGTTGTTAGGCATTGCCCCTGACATAAAACATT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAGAATCAAGGCTGCGTTGTTAGGCATTGCCCCTGACATAAAACATT  900

seq1  AAAATGATGTGTATGTTTCATGAAAGATGTTACATT--GAGGATTGGTCT  948
      ||||||||||||||||||||||||||||||||||||   |||||||||||
seq2  AAAATGATGTGTATGTTTCATGAAAGATGTTACATTTGAAGGATTGGTCT  950

seq1  GTTGTTATGTATTGTGATGCTGAGTGTGGTCTCCCAAGGCCTGG-TTGCT  997
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GTTGTTATGTATTGTGATGCTGAGTGTGGTCTCCCAAGGCCTGGTTTGCT  1000

seq1  CCAGAGAGGAGTCTGCACATAGACCCAAGTGACACTATGTGACCTT--GC  1045
      ||||||||||||||||||||||||||||||||||||||||||||||   |
seq2  CCAGAGAGGAGTCTGCACATAGACCCAAGTGACACTATGTGACCTTTGCC  1050

seq1  CCCCACGTTATTTCTG-ATTGGTGAATAGAGA---TGCCTA--GAGCTGC  1089
      |||||||| ||||||| |||||||||||||||   | ||||   ||||||
seq2  CCCCACGTAATTTCTGAATTGGTGAATAGAGAATGTCCCTAAGAAGCTGC  1100

seq1  GTAGAACT-GAGATAGGCAGGCCTTGGGGTTCCCAGGAGTCAAGAAAGCA  1138
      |||||||| || ||||  || | | |||||| ||||||  ||||||  ||
seq2  GTAGAACTGGAAATAGCAAGTCTTGGGGGTTTCCAGGA-CCAAGAAGTCA  1149

seq1  CGGCCCT---GAGGGTTGGCCAA-GTGGAG  1164
      | | |||   ||||||||||||| ||||||
seq2  CCGTCCTGTAGAGGGTTGGCCAAGGTGGAG  1179

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information