MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-322O19
Chromosome	10 (Build37)
Map Location	42,488,110 - 42,629,781
singlet/doublet	doublet
Overlap gene	Sec63, Scml4, EG666569
Upstream gene	2410017P07Rik, Sesn1, Armc2, 1700016J18Rik, LOC624784, Foxo3a, Lace1, LOC666540, Snx3, Nr2e1, c222389, Ostm1
Downstream gene	C230040G06, Sobp, 9030612E09Rik, Pdss2, LOC100042155, AK122525, LOC100042179, 1700021F05Rik, Cd24a, EG668190, LOC100041418, 1700027J07Rik, EG668192, Qrsl1, Rtn4ip1
Link	Open Mouse BAC browser

Click to get alignment info.

name	2410017P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103268 MGI:1915511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sesn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140742 MGI:2155278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213402 MGI:1916449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016J18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75561 MGI:1922811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC624784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 280 ESTs, 3 Proteins

name	Foxo3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56484 MGI:1890081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lace1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215951 MGI:2148801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins pseudo : _no_value

name	Snx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54198 MGI:1860188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr2e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21907 MGI:1100526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	c222389 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:260346
definition	note : c222389 pseudo : _no_value

name	Ostm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14628 MGI:2655574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140740 MGI:2155302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268297 MGI:2446140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666569 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666569 MGI:3648983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	C230040G06 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:327749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Sobp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109205 MGI:1924427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030612E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74530 MGI:1921780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Pdss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71365 MGI:1918615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 1143 ESTs

name	AK122525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331623 MGI:2677212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 104 ESTs, 5 Proteins

name	1700021F05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67851 MGI:1915101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd24a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12484 MGI:88323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668190 MGI:3643528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1700027J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69443 MGI:1916693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG668192 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668192 MGI:3643526
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 26 Proteins

name	Qrsl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76563 MGI:1923813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtn4ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170728 MGI:2178759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410017P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801889 GeneID:103268 MGI:1915511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410017P07 gene transcript_id : NM_026643.3

name	Sesn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480143 GeneID:140742 MGI:2155278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sestrin 1 transcript_id : NM_001013370.1

name	Armc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131063 GeneID:213402 MGI:1916449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 2 transcript_id : NM_001034858.2

name	1700016J18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388053 GeneID:75561 MGI:1922811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 1700016J18 gene transcript_id : XM_994504.1

name	LOC624784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94387957 GeneID:624784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 280 ESTs, 2 Proteins product : similar to T:G mismatch-specific thymine-DNA glycosylase TDGb, transcript variant 1 transcript_id : XM_891912.2

name	LOC624784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94387958 GeneID:624784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 235 ESTs, 3 Proteins product : similar to T:G mismatch-specific thymine-DNA glycosylase TDGb, transcript variant 3 transcript_id : XM_899830.2

name	Foxo3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130536 GeneID:56484 MGI:1890081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box O3a transcript_id : NM_019740.2

name	Lace1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922662 GeneID:215951 MGI:2148801
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactation elevated 1 transcript_id : NM_145743.2

name	Snx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359771 GeneID:54198 MGI:1860188
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 3 transcript_id : NM_017472.3

name	Nr2e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892952 GeneID:21907 MGI:1100526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 2, group E, member 1 transcript_id : NM_152229.2

name	Ostm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29293830 GeneID:14628 MGI:2655574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : osteopetrosis associated transmembrane protein 1 transcript_id : NM_172416.2

name	Sec63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981947 GeneID:140740 MGI:2155302
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC63-like (S. cerevisiae) transcript_id : NM_153055.2

name	Scml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328393 GeneID:268297 MGI:2446140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sex comb on midleg-like 4 (Drosophila) transcript_id : NM_172938.2

name	EG666569 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94387959 GeneID:666569 MGI:3648983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666569 transcript_id : XM_989775.1

name	C230040G06 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260705 GeneID:327749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein C230040G06 transcript_id : XM_001476210.1

name	Sobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938304 GeneID:109205 MGI:1924427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sine oculis-binding protein homolog (Drosophila) transcript_id : NM_175407.3

name	Pdss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90568029 GeneID:71365 MGI:1918615
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenyl (solanesyl) diphosphate synthase, subunit 2 transcript_id : NM_027772.1

name	LOC100042155 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260741 GeneID:100042155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 1143 ESTs product : hypothetical protein LOC100042155 transcript_id : XM_001477613.1

name	AK122525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39841054 GeneID:331623 MGI:2677212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AK122525 transcript_id : NM_199028.1

name	LOC100042179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260743 GeneID:100042179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 104 ESTs, 5 Proteins product : similar to mitochondria-associated granulocyte macrophage CSF signaling molecule transcript_id : XM_001477683.1

name	1700021F05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385903 GeneID:67851 MGI:1915101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021F05 gene transcript_id : NM_026411.1

name	Cd24a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816954 GeneID:12484 MGI:88323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD24a antigen transcript_id : NM_009846.2

name	LOC100041418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260712 GeneID:100041418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041418 transcript_id : XM_001476352.1

name	1700027J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260745 GeneID:69443 MGI:1916693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700027J07 gene transcript_id : XM_001477707.1

name	EG668192 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260747 GeneID:668192 MGI:3643526
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 26 Proteins product : predicted gene, EG668192 transcript_id : XM_994853.2

name	Qrsl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486687 GeneID:76563 MGI:1923813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 transcript_id : NM_001081054.1

name	Rtn4ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802350 GeneID:170728 MGI:2178759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 4 interacting protein 1 transcript_id : NM_130892.3

name	Sesn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480144 CCDS:CCDS23809.1 GeneID:140742 MGI:2155278
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IEA] codon_start : 1 exception : mismatches in translation note : p53 regulated PA26 nuclear protein product : sestrin 1 protein_id : NP_001013388.1

name	Armc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702203 GeneID:213402 MGI:1916449
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : armadillo repeat containing 2 protein_id : NP_001030030.1

name	1700016J18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388054 GeneID:75561 MGI:1922811
definition	codon_start : 1 product : hypothetical protein LOC75561 protein_id : XP_999598.1

name	LOC624784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82932266 GeneID:624784
definition	codon_start : 1 product : similar to T:G mismatch-specific thymine-DNA glycosylase TDGb isoform 3 protein_id : XP_904923.1

name	LOC624784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82932268 GeneID:624784
definition	codon_start : 1 product : similar to T:G mismatch-specific thymine-DNA glycosylase TDGb isoform 1 protein_id : XP_897005.1

name	Foxo3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789951 CCDS:CCDS23810.1 GeneID:56484 MGI:1890081
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0001547 - antral ovarian follicle growth [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IMP]; GO:0001544 - initiation of primordial ovarian follicle growth [Evidence IMP]; GO:0001556 - oocyte maturation [Evidence IMP]; GO:0001542 - ovulation (sensu Mammalia) [Evidence IMP]; GO:0045648 - positive regulation of erythrocyte differentiation [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : forkhead protein FKHR2 product : forkhead box O3a protein_id : NP_062714.1

name	Lace1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922663 CCDS:CCDS23811.1 GeneID:215951 MGI:2148801
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : lactation elevated 1 protein_id : NP_665686.2

name	Snx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560433 CCDS:CCDS23812.1 GeneID:54198 MGI:1860188
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 3 protein_id : NP_059500.2

name	Nr2e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726205 CCDS:CCDS23813.1 GeneID:21907 MGI:1100526
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0021960 - anterior commissure morphogenesis [Evidence IMP]; GO:0007610 - behavior [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0045165 - cell fate commitment [Evidence IGI]; GO:0021987 - cerebral cortex development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0008347 - glial cell migration [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0021772 - olfactory bulb development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0002073 - retina development (sensu Mammalia) [Evidence IMP]; GO:0035176 - social behavior [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : tailless homolog product : nuclear receptor subfamily 2, group E, member 1 protein_id : NP_689415.1

name	Ostm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369545 CCDS:CCDS23814.1 GeneID:14628 MGI:2655574
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030316 - osteoclast differentiation [Evidence IMP] codon_start : 1 note : grey-lethal; grey lethal osteroperosis; grey lethal osteopetrosis product : osteopetrosis associated transmembrane protein 1 protein_id : NP_766004.1

name	Sec63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981948 CCDS:CCDS23815.1 GeneID:140740 MGI:2155302
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : promotes implantation of embryo product : SEC63-like protein_id : NP_694695.2

name	EG666569 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94387960 GeneID:666569 MGI:3648983
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994869.1

name	Scml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328394 CCDS:CCDS23816.1 GeneID:268297 MGI:2446140
definition	codon_start : 1 exception : mismatches in translation note : sex comb on midleg-like product : sex comb on midleg-like 4 protein_id : NP_766526.2

name	C230040G06 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260706 GeneID:327749
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476260.1

name	Sobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938305 GeneID:109205 MGI:1924427
definition	codon_start : 1 product : sine oculis-binding protein homolog protein_id : NP_780616.4

name	Pdss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90568030 GeneID:71365 MGI:1918615
definition	GO_function : GO:0046982 - protein heterodimerization activity [Evidence IDA]; GO:0000010 - trans-hexaprenyltranstransferase activity [Evidence IDA]; GO:0050347 - trans-octaprenyltranstransferase activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008299 - isoprenoid biosynthesis [Evidence IEA] [Evidence IDA]; GO:0051290 - protein heterotetramerization [Evidence IPI]; GO:0006744 - ubiquinone biosynthesis [Evidence IDA] [Evidence IPI] codon_start : 1 exception : mismatches in translation note : prenyltransferase-like mitochondrial protein product : prenyl diphosphate synthase, subunit 2 protein_id : NP_082048.1

name	LOC100042155 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260742 GeneID:100042155
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477663.1

name	AK122525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841055 GeneID:331623 MGI:2677212
definition	codon_start : 1 product : hypothetical protein LOC331623 protein_id : NP_950193.1

name	LOC100042179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260744 GeneID:100042179
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477733.1

name	1700021F05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385904 CCDS:CCDS23820.1 GeneID:67851 MGI:1915101
definition	codon_start : 1 product : hypothetical protein LOC67851 protein_id : NP_080687.1

name	Cd24a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753342 CCDS:CCDS23821.1 GeneID:12484 MGI:88323
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0007274 - neuromuscular synaptic transmission [Evidence IGI] [Evidence IMP]; GO:0048488 - synaptic vesicle endocytosis [Evidence IMP] codon_start : 1 note : heat stable antigen; cluster of differentiation 24 product : CD24a antigen protein_id : NP_033976.1

name	LOC100041418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260713 GeneID:100041418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476402.1

name	1700027J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260746 GeneID:69443 MGI:1916693
definition	codon_start : 1 product : hypothetical protein LOC69443 protein_id : XP_001477757.1

name	EG668192 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260748 GeneID:668192 MGI:3643526
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_999947.2

name	Qrsl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486688 GeneID:76563 MGI:1923813
definition	GO_function : GO:0004040 - amidase activity [Evidence IEA]; GO:0017068 - glutamyl-tRNA(Gln) amidotransferase activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 protein_id : NP_001074523.1

name	Rtn4ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543608 CCDS:CCDS23823.1 GeneID:170728 MGI:2178759
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : NOGO-interacting mitochondrial protein; reticulon 4 interacting protein 1, mitochondrial product : reticulon 4 interacting protein 1 protein_id : NP_570962.2

name	EG668190 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668190
definition	number : 1 pseudo : _no_value

name	EG668190 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668190
definition	number : 2 pseudo : _no_value

name	EG668190 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668190
definition	number : 3 pseudo : _no_value

name	LOC666540 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260739 GeneID:666540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : similar to U1 snRNP-specific protein C pseudo : _no_value transcript_id : XR_033198.1

name	9030612E09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260740 GeneID:74530 MGI:1921780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 9030612E09 gene transcript_id : XR_035348.1

clone name	MSMg01-096C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477G11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-070M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-322O19.b	B6Ng01-322O19.g
ACC	GA111639	GA111640
length	956	1,100
definition	B6Ng01-322O19.b	B6Ng01-322O19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(42,628,826 - 42,629,781)	(42,488,110 - 42,489,199)
sequence	gaattcataacacaaaaatctatttctgggtctcaacaccaacaaatacc ccaaacattcactggtgcaaaagaagtcaaaagcacaaacagatcaataa aaatcacaaaggtcttgttgggtgaaagtcagtctcattttgatctatcg tgatcgaatttctgcttctttgttatgagcttaagattttagaaacagaa ggttttcttattgtagggtgtatttctgcatctttctactttgcctttat ctttaaattttattttgctttgtttatttttggtttcaagacacaagatc ctgctacgcagtccaagacaccctctagcttattatgttccttctgctcc agtctccagaaagctgggaatacaaggtttgctcatgcctgtcttacttt gcctttagtgtggagattaacaatgtatctaatcgcatcagtgtcaaaac ggaagcaagagaaagcttagggttaggggctgagcagaaagcccagctga tacactgctcatcttgcaaggtgaggctctggtgccaaactcagcacaat ataaaaaaggcaggcatagtagctgtgcttgtgatgctagcaccggggag gcaggaacaggtacatctattgggttggtgtactggcctgccagcctaat cagtgagccccaggtcccactgatagaccttgtctcaaaactaaggtgga caccaacataggagataattgctaccctttacactcacctatatgcatgt attctgtccctgtgtgtgcacacacataataaataaaatgcaacaatttc taagaaaatcaagtttagaacaatatgagttagcaatgaagtttcaaata taagtaaacctaaaaagaggtttactttgatatccaacaagtaaaattaa ctttccttaagttgttccatataataaagtccttccaggaagaagaaggg gaggaa	gaattctctgtgaggatcattttagaaatagtcttacttgggctgtcccc acttgcccctccaaggaagagttatagaactacagcccttttcacctcat ctgtttattagtcttaaggtgaggtgtgcttaatgctctttgaatagcac ttgaggaaatgtgctacctatattagaaaactgagacctcagggaggtga gaggtattcaacttgcctcaagccattagctgtaagattggatgttggac ccaaattagtcttattccaaagcttctcttttagttgctactttgtactc ctttctgtaattaagtaaacattgcatgttataataatatcaatacagca agtggaaagtgctgaaggagaacggaatttctgttttggggcttgggcaa atgcttcatgcaaaggtgatttaagatggatcttgaaaagaaggacattc ttaactaggggaaacactgcaaaagcatgggtgctctgtacataagtgat gaggacttgaaatgtaacgggcactttggatcaagtgagcagtttggagt tgattctttgtcctattattgacttgaacagtagagcaatgacacctggc tggtgtgggttttgtgaatctagtggagaatggtttggaagttgggggac cctaagtataactgagagtccatctcagcttatttcattgagatgttagg atttagaagtataactagatttaaaaaattctgagatagtttggactgtt tatttcttatatatttatttccccttaactgatttctgttccctttaaag ttatttggtgattgcagttatagtttgggaactgagtgtagtgaaaaaga ttgggatgaacattaaaaaaaagaaaagaaaagaagtcagggctggagag agatggcttcagcgagtaagagcactgactgctcttctgagtcctgagtt caatttcccagcaaccacattggtggctcaccatccatcttataagagaa ttctgaccttcccttcttctgggattgtcctgaagacagctaccttgtac ctccacatattattattatattaatctctttaaacgaaagaaagttttac
quality values	Open. Hide. 58 33 35 34 58 32 26 58 58 58 28 26 42 39 62 62 62 42 47 62 62 62 62 62 62 46 49 62 62 62 62 62 56 47 32 36 51 44 49 25 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 35 59 62 62 59 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 54 42 58 58 54 58 58 58 58 58 58 52 58 58 58 58 58 48 48 54 49 58 54 58 58 45 58 52 58 54 58 58 58 52 58 54 54 31 58 58 54 58 58 49 52 58 58 54 54 58 58 54 58 54 58 58 58 58 58 48 58 54 54 49 58 52 51 58 58 54 51 58 50 58 58 58 53 58 58 58 58 58 52 58 45 41 58 49 51 49 50 58 50 54 54 48 58 58 58 42 31 58 50 52 39 58 58 46 46 52 40 58 50 41 49 46 49 54 58 53 51 51 58 58 51 40 53 58 46 41 58 52 50 51 50 58 48 52 58 51 58 46 47 40 53 51 58 39 39 50 53 53 53 50 49 58 53 41 49 41 39 40 39 37 58 50 44 49 40 52 47 41 41 32 37 50 43 49 33 43 53 39 51 49 53 53 50 52 54 54 50 40 52 40 50 30 49 26 54 46 46 31 29 38 37 39 37 52 39 53 51 40 54 46 39 53 34 45 42 51 36 33 32 40 39 35 54 50 42 54 51 30 37 40 47 52 53 38 54 49 38 51 44 42 42 52 39 37 35 54 40 45 42 37 45 38 54 37 39 54 54 38 54 45 53 42 54 45 39 32 37 53 32 45 32 47 31 52 42 53 32 31 52 33 33 24 51 49 32 28 40 23 29 40 35 23 42 33 49 32 40 39 31 33 28 53 52 51 37 33 40 33 33 29 42 51 31 42 24 44 32 30 32 31 45 32 32 30 43 31 35 31 32 31 31 33 23 31 45 37 38 29 37 51 29 32 24 51 42 31 30 31 33 44 33 36 24 41 29 21 26 31 36 46 48 48 33 18 42 16 30 21 47 21 31 38 36 48 37 30 29 31 32 34 24 42 27 30 31 29 30 31 26 31 48 48 42 18 42 31 30 30 32 48 32 29 27 26 33 25 36 31 37 30 33 27 24 28 31 24 31 29 13 25 5 15 16 48 31 25 25 28 33 34 36 27 28 41 11 5 19 33 11 30 33 11 26 25 7 41 36 19 18 9 26 9 5	Open. Hide. 62 47 37 41 62 62 62 62 62 62 56 56 43 25 49 18 44 59 44 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 54 49 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 59 62 62 59 59 59 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 54 62 62 62 62 54 42 62 62 62 62 54 43 62 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 52 54 58 58 54 54 58 54 54 48 43 58 54 58 58 58 50 58 58 52 58 58 58 58 58 58 52 58 58 54 45 30 49 54 58 58 58 58 54 54 58 52 52 58 42 52 42 58 58 46 54 58 58 58 58 50 51 39 51 51 58 47 58 50 52 52 51 51 58 53 53 50 58 58 51 58 45 51 42 58 58 50 58 53 58 58 50 51 58 58 58 58 53 58 51 58 53 53 52 51 50 49 58 29 54 39 49 37 37 58 49 40 58 34 54 40 41 51 39 53 53 51 58 58 58 44 36 17 58 53 53 50 50 39 53 37 50 28 51 50 50 51 53 25 47 32 39 34 53 28 53 49 51 42 52 25 43 46 50 35 27 54 40 28 21 52 49 51 47 25 41 33 51 32 26 41 53 42 49 31 54 41 45 32 54 54 30 45 32 42 53 39 38 42 39 37 17 19 54 52 53 54 54 54 54 37 40 35 34 39 42 51 22 35 25 42 37 53 49 23 23 24 34 26 34 54 33 47 32 41 52 52 34 32 39 35 37 35 36 40 36 41 49 31 27 28 51 52 32 46 51 40 41 42 17 31 32 24 42 39 10 49 33 36 26 51 32 40 21 51 45 43 51 40 11 41 31 30 21 42 15 13 32 22 14 24 26 29 19 8 10 29 31 30 19 20 30 16 31 25 28 31 45 30 33 37 27 29 31 34 25 30 32 20 31 31 11 18 10 18 19 15 41 41 30 31 24 10 6 33 32 42 31 30 18 32 33 18 27 9 25 13 32 35 46 46 46 36 46 29 21 44 31 38 33 24 38 44 16 21 23 22 10 7 30 11 25 16 29 15 20 32 31 26 32 13 37 16 31 14 29 17 30 30 11 19 16 10 17 13 31 16 27 14 13 13 20 16 41 6 5 6 19 12 6 27 26 24 31 22 25 38 42 35 22 21 21 13 5 4 15 24 25 31 29 14 33 19 10 10 22 9 19 22 13 39 17 24 9 21 20 8 5 19 17 7 8 6 7 20 32 29 14 10 4 15 7 7 11 7 34 6 19 20 31 34 15 5 6 22 12 33 9 6 6 5 6 11 6 7 10 5 8 8 6 9 20 5 7 30 27 25 9 15 27 21 18 5 5 9 15 4 3 3 7 15 13 11 9 8 28 17 9 17 16 10 10 14 23 13 22 8 9 8 4 4 5 7 9 16 9 6 6 14 13 19 6 10 9 17 5 4 11 4 9 17 6 4 5 20 22 22 6 7 11 8 21 23 16 11 6 6 1 1 3 27 16 9 7 24 9 5 13 27 26 24 6 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_42628826_42629781
seq2: B6Ng01-322O19.b_45_1000 (reverse)

seq1  TTCCTCCCCTTCTTCTTCTTGGAAGGACTTTATTATATGGAACAACTTAA  50
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  TTCCTCCCCTTCTTCTTCCTGGAAGGACTTTATTATATGGAACAACTTAA  50

seq1  GGAAAGTTAATTTTACTTGTTGGATATCAAAGTAAACCTCTTTTTAGGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGTTAATTTTACTTGTTGGATATCAAAGTAAACCTCTTTTTAGGTT  100

seq1  TACTTATATTTGAAACTTCATTGCTAACTCATATTGTTCTAAACTTGATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTATATTTGAAACTTCATTGCTAACTCATATTGTTCTAAACTTGATT  150

seq1  TTCTTAGAAATTGTTGCATTTTATTTATTATGTGTGTGCACACACAGGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTAGAAATTGTTGCATTTTATTTATTATGTGTGTGCACACACAGGGA  200

seq1  CAGAATACATGCATATAGGTGAGTGTAAAGGGTAGCAATTATCTCCTATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATACATGCATATAGGTGAGTGTAAAGGGTAGCAATTATCTCCTATG  250

seq1  TTGGTGTCCACCTTAGTTTTGAGACAAGGTCTATCAGTGGGACCTGGGGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGTCCACCTTAGTTTTGAGACAAGGTCTATCAGTGGGACCTGGGGC  300

seq1  TCACTGATTAGGCTGGCAGGCCAGTACACCAACCCAATAGATGTACCTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTGATTAGGCTGGCAGGCCAGTACACCAACCCAATAGATGTACCTGT  350

seq1  TCCTGCCTCCCCGGTGCTAGCATCACAAGCACAGCTACTATGCCTGCCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCCTCCCCGGTGCTAGCATCACAAGCACAGCTACTATGCCTGCCTT  400

seq1  TTTTATATTGTGCTGAGTTTGGCACCAGAGCCTCACCTTGCAAGATGAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATATTGTGCTGAGTTTGGCACCAGAGCCTCACCTTGCAAGATGAGC  450

seq1  AGTGTATCAGCTGGGCTTTCTGCTCAGCCCCTAACCCTAAGCTTTCTCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTATCAGCTGGGCTTTCTGCTCAGCCCCTAACCCTAAGCTTTCTCTT  500

seq1  GCTTCCGTTTTGACACTGATGCGATTAGATACATTGTTAATCTCCACACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCCGTTTTGACACTGATGCGATTAGATACATTGTTAATCTCCACACT  550

seq1  AAAGGCAAAGTAAGACAGGCATGAGCAAACCTTGTATTCCCAGCTTTCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCAAAGTAAGACAGGCATGAGCAAACCTTGTATTCCCAGCTTTCTG  600

seq1  GAGACTGGAGCAGAAGGAACATAATAAGCTAGAGGGTGTCTTGGACTGCG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTGGAGCAGAAGGAACATAATAAGCTAGAGGGTGTCTTGGACTGCG  650

seq1  TAGCAGGATCTTGTGTCTTGAAACCAAAAATAAACAAAGCAAAATAAAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAGGATCTTGTGTCTTGAAACCAAAAATAAACAAAGCAAAATAAAAT  700

seq1  TTAAAGATAAAGGCAAAGTAGAAAGATGCAGAAATACACCCTACAATAAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGATAAAGGCAAAGTAGAAAGATGCAGAAATACACCCTACAATAAG  750

seq1  AAAACCTTCTGTTTCTAAAATCTTAAGCTCATAACAAAGAAGCAGAAATT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACCTTCTGTTTCTAAAATCTTAAGCTCATAACAAAGAAGCAGAAATT  800

seq1  CGATCACGATAGATCAAAATGAGACTGACTTTCACCCAACAAGACCTTTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGATCACGATAGATCAAAATGAGACTGACTTTCACCCAACAAGACCTTTG  850

seq1  TGATTTTTATTGATCTGTTTGTGCTTTTGACTTCTTTTGCACCAGTGAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTTTATTGATCTGTTTGTGCTTTTGACTTCTTTTGCACCAGTGAAT  900

seq1  GTTTGGGGTATTTGTTGGTGTTGAGACCCAGAAATAGATTTTTGTGTTAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGGGGTATTTGTTGGTGTTGAGACCCAGAAATAGATTTTTGTGTTAT  950

seq1  GAATTC  956
      ||||||
seq2  GAATTC  956

seq1: chr10_42488110_42489199
seq2: B6Ng01-322O19.g_66_1165

seq1  GAATTCTCTGTGAGGATCATTTTAGAAATAGTCTTACTTGGGCTGTCCCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTGTGAGGATCATTTTAGAAATAGTCTTACTTGGGCTGTCCCC  50

seq1  ACTTGCCCCTCCAAGGAAGAGTTATAGAACTACAGCCCTTTTCACCTCAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGCCCCTCCAAGGAAGAGTTATAGAACTACAGCCCTTTTCACCTCAT  100

seq1  CTGTTTATTAGTCTTAAGGTGAGGTGTGCTTAATGCTCTTTGAATAGCAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTATTAGTCTTAAGGTGAGGTGTGCTTAATGCTCTTTGAATAGCAC  150

seq1  TTGAGGAAATGTGCTACCTATATTAGAAAACTGAGACCTCAGGGAGGTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGAAATGTGCTACCTATATTAGAAAACTGAGACCTCAGGGAGGTGA  200

seq1  GAGGTATTCAACTTGCCTCAAGCCATTAGCTGTAAGATTGGATGTTGGAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTATTCAACTTGCCTCAAGCCATTAGCTGTAAGATTGGATGTTGGAC  250

seq1  CCAAATTAGTCTTATTCCAAAGCTTCTCTTTTAGTTGCTACTTTGTACTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAATTAGTCTTATTCCAAAGCTTCTCTTTTAGTTGCTACTTTGTACTC  300

seq1  CTTTCTGTAATTAAGTAAACATTGCATGTTATAATAATATCAATACAGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTGTAATTAAGTAAACATTGCATGTTATAATAATATCAATACAGCA  350

seq1  AGTGGAAAGTGCTGAAGGAGAACGGAATTTCTGTTTTGGGGCTTGGGCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGAAAGTGCTGAAGGAGAACGGAATTTCTGTTTTGGGGCTTGGGCAA  400

seq1  ATGCTTCATGCAAAGGTGATTTAAGATGGATCTTGAAAAGAAGGACATTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTTCATGCAAAGGTGATTTAAGATGGATCTTGAAAAGAAGGACATTC  450

seq1  TTAACTAGGGGAAACACTGCAAAAGCATGGGTGCTCTGTACATAAGTGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTAGGGGAAACACTGCAAAAGCATGGGTGCTCTGTACATAAGTGAT  500

seq1  GAGGACTTGAAATGTAACGGGCACTTTGGATCAAGTGAGCAGTTTGGAGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGACTTGAAATGTAACGGGCACTTTGGATCAAGTGAGCAGTTTGGAGT  550

seq1  TGATTCTTTGTCCTATTATTGACTTGAACAGTAGAGCAATGACACCTGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTCTTTGTCCTATTATTGACTTGAACAGTAGAGCAATGACACCTGGC  600

seq1  TGGTGTGGGTTTTGTGAATCTAGTGGAGAATGGTTTGGAAGTTGGGGGAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGTGGGTTTTGTGAATCTAGTGGAGAATGGTTTGGAAGTTGGGGGAC  650

seq1  CCTAAGTATAACTGAGAGTCCATCTCAGCTTATTTCATTGAGATGTTAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAGTATAACTGAGAGTCCATCTCAGCTTATTTCATTGAGATGTTAGG  700

seq1  ATTTAGAAGTATAACTAGATTTAAAAAATTCTGAGATAGTTTGGACTGTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGAAGTATAACTAGATTTAAAAAATTCTGAGATAGTTTGGACTGTT  750

seq1  TATTTCTTATATATTTATTTCCCCTTAACTGATTTCTGTTCCCTTTAAAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTCTTATATATTTATTTCCCCTTAACTGATTTCTGTTCCCTTTAAAG  800

seq1  TTATTTGGTGATTGCAGTTATAGTTTGGGAACTGAGTGTAGTGAAAAAGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTGGTGATTGCAGTTATAGTTTGGGAACTGAGTGTAGTGAAAAAGA  850

seq1  TTGGGATGAACATTAAAAAAAAGAAAAGAAAAGAAGTCAGGGGCTGGAGA  900
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  TTGGGATGAACATTAAAAAAAAGAAAAGAAAAGAAGTCA-GGGCTGGAGA  899

seq1  GAGATGGC-TCAGCGAGTAAGAGCACTGACTGCTCTTCTGAAGGTCCTGA  949
      |||||||| ||||||||||||||||||||||||||||||||  |||||||
seq2  GAGATGGCTTCAGCGAGTAAGAGCACTGACTGCTCTTCTGA--GTCCTGA  947

seq1  GTTCAA-TTCCCAGCAACCACA-TGGTGGCTCA-CAACCATCTATAAAGA  996
      |||||| ||||||||||||||| |||||||||| || ||||||   ||||
seq2  GTTCAATTTCCCAGCAACCACATTGGTGGCTCACCATCCATCTTATAAGA  997

seq1  GA--TCTGAC--TCCC-TCTTCT-GGAGTGT-CTGAAGACAGCTACACTG  1039
      ||  ||||||  |||| |||||| ||| ||| ||||||||||||||  ||
seq2  GAATTCTGACCTTCCCTTCTTCTGGGATTGTCCTGAAGACAGCTACCTTG  1047

seq1  TAC--TCACATATAATAAATAAATAAATCTTTAAAAAAAAAAGAAAGTTT  1087
      |||   ||||||| || | || || ||||| |  |||  |||||||||||
seq2  TACCTCCACATATTATTATTATATTAATCTCTTTAAACGAAAGAAAGTTT  1097

seq1  TAC  1090
      |||
seq2  TAC  1100

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information