MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-337B19
Chromosome	10 (Build37)
Map Location	59,101,111 - 59,235,901
singlet/doublet	doublet
Overlap gene	Cbara1
Upstream gene	Edar, LOC624335, LOC100039099, Sh3md4, Sept10, Ankrd57, LOC664892, P4ha1, LOC100039174, Pla2g12b, Oit3, Ccdc109a, LOC100039225
Downstream gene	EG664907, LOC664936, Dnajb12, Ddit4, D10Ertd641e, Ascc1, Spock2, Chst3, LOC100039080, Psap, Cdh23, 4632428N05Rik, Slc29a3, Unc5b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Edar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13608 MGI:1343498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624335 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100039099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Sh3md4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237353 MGI:2444637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103080 MGI:1918110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ankrd57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268301 MGI:3606051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 6 Proteins

name	LOC664892 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	P4ha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18451 MGI:97463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 323 ESTs, 6 Proteins

name	Pla2g12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69836 MGI:1917086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oit3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18302 MGI:1201782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc109a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215999 MGI:3026965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cbara1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216001 MGI:2384909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664907 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664907 MGI:3647495
definition	note : predicted gene, EG664907 pseudo : _no_value

name	LOC664936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 9 Proteins pseudo : _no_value

name	Dnajb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56709 MGI:1931881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddit4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74747 MGI:1921997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D10Ertd641e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52717 MGI:1289325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ascc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69090 MGI:1916340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spock2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94214 MGI:1891351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53374 MGI:1858224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Psap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19156 MGI:97783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22295 MGI:1890219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632428N05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74048 MGI:1921298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc29a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71279 MGI:1918529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107449 MGI:894703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803268 GeneID:13608 MGI:1343498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectodysplasin-A receptor transcript_id : NM_010100.2

name	LOC100039099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260891 GeneID:100039099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100039099 transcript_id : XM_001472224.1

name	Sh3md4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254251 GeneID:237353 MGI:2444637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 multiple domains 4 transcript_id : NM_172788.2

name	Sept10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369079 GeneID:103080 MGI:1918110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 10 transcript_id : NM_001024910.2

name	Sept10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906174 GeneID:103080 MGI:1918110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 10 transcript_id : NM_001024911.1

name	Ankrd57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260893 GeneID:268301 MGI:3606051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 6 Proteins product : ankyrin repeat domain 57, transcript variant 1 transcript_id : XM_884335.3

name	LOC664892 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94388207 GeneID:664892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to jumonji domain containing 3 transcript_id : XM_973302.1

name	P4ha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859595 GeneID:18451 MGI:97463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide transcript_id : NM_011030.1

name	LOC100039174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260894 GeneID:100039174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 323 ESTs, 6 Proteins product : similar to Translocase of inner mitochondrial membrane 23 homolog (yeast) transcript_id : XM_001472392.1

name	Pla2g12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980795 GeneID:69836 MGI:1917086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group XIIB transcript_id : NM_023530.2

name	Oit3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345064 GeneID:18302 MGI:1201782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oncoprotein induced transcript 3 transcript_id : NM_010959.2

name	Ccdc109a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803154 GeneID:215999 MGI:3026965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 109A transcript_id : NM_001033259.2

name	LOC100039225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260896 GeneID:100039225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039225 transcript_id : XM_001472485.1

name	Cbara1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130037 GeneID:216001 MGI:2384909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding atopy-related autoantigen 1 transcript_id : NM_144822.2

name	Dnajb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982700 GeneID:56709 MGI:1931881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 12 transcript_id : NM_019965.2

name	Ddit4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348052 GeneID:74747 MGI:1921997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA-damage-inducible transcript 4 transcript_id : NM_029083.2

name	D10Ertd641e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130312 GeneID:52717 MGI:1289325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, ERATO Doi 641, expressed transcript_id : NM_025514.2

name	Ascc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037140 GeneID:69090 MGI:1916340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating signal cointegrator 1 complex subunit 1 transcript_id : NM_026937.1

name	Spock2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254122 GeneID:94214 MGI:1891351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2 transcript_id : NM_052994.2

name	Chst3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328238 GeneID:53374 MGI:1858224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate (chondroitin 6/keratan) sulfotransferase 3 transcript_id : NM_016803.2

name	Psap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328184 GeneID:19156 MGI:97783
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prosaposin transcript_id : NM_011179.2

name	Cdh23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517679 GeneID:22295 MGI:1890219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 23 (otocadherin) transcript_id : NM_023370.2

name	4632428N05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349860 GeneID:74048 MGI:1921298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632428N05 gene transcript_id : NM_028732.3

name	Slc29a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347496 GeneID:71279 MGI:1918529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 29 (nucleoside transporters), member 3 transcript_id : NM_023596.3

name	Unc5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861261 GeneID:107449 MGI:894703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-5 homolog B (C. elegans) transcript_id : NM_029770.2

name	LOC100039099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260892 GeneID:100039099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472274.1

name	Sh3md4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370164 GeneID:237353 MGI:2444637
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : SH3 multiple domains 4 protein_id : NP_766376.1

name	Sept10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906193 GeneID:103080 MGI:1918110
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : septin 10 isoform 1 protein_id : NP_001020081.1

name	Sept10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906175 GeneID:103080 MGI:1918110
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : septin 10 isoform 2 protein_id : NP_001020082.1

name	Ankrd57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933041 GeneID:268301 MGI:3606051
definition	codon_start : 1 product : ankyrin repeat domain 57 isoform 1 protein_id : XP_889428.1

name	LOC664892 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94388208 GeneID:664892
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978396.1

name	P4ha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859596 CCDS:CCDS23863.1 GeneID:18451 MGI:97463
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0004656 - procollagen-proline 4-dioxygenase activity [Evidence IDA] GO_process : GO:0018401 - peptidyl-proline hydroxylation to 4-hydroxy-L-proline [Evidence IDA]; GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 product : procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide protein_id : NP_035160.1

name	LOC100039174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260895 GeneID:100039174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472442.1

name	Pla2g12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980796 CCDS:CCDS23864.1 GeneID:69836 MGI:1917086
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006644 - phospholipid metabolism [Evidence IEA] codon_start : 1 note : group XIIB phospholipase A2; phospholipase A2, group XIII product : phospholipase A2, group XIIB protein_id : NP_076019.2

name	Oit3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27545185 CCDS:CCDS23865.1 GeneID:18302 MGI:1201782
definition	codon_start : 1 product : oncoprotein-induced transcript 3 protein_id : NP_035089.1

name	Ccdc109a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701766 CCDS:CCDS23866.1 GeneID:215999 MGI:3026965
definition	codon_start : 1 product : coiled-coil domain containing 109A protein_id : NP_001028431.1

name	LOC100039225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260897 GeneID:100039225
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472535.1

name	Cbara1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450201 GeneID:216001 MGI:2384909
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calcium binding atopy-related autoantigen 1 protein_id : NP_659071.1

name	Dnajb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982701 CCDS:CCDS23867.1 GeneID:56709 MGI:1931881
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : DnaJ homolog 10 product : DnaJ (Hsp40) homolog, subfamily B, member 12 protein_id : NP_064349.2

name	Ddit4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312868 CCDS:CCDS23868.1 GeneID:74747 MGI:1921997
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : dexamethasone-induced gene 2 product : HIF-1 responsive RTP801 protein_id : NP_083359.1

name	D10Ertd641e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384936 CCDS:CCDS23869.1 GeneID:52717 MGI:1289325
definition	codon_start : 1 product : hypothetical protein LOC52717 protein_id : NP_079790.1

name	Ascc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037141 CCDS:CCDS23870.1 GeneID:69090 MGI:1916340
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating signal cointegrator 1 complex subunit 1 protein_id : NP_081213.1

name	Spock2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16506279 GeneID:94214 MGI:1891351
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence ISS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0007416 - synaptogenesis [Evidence ISS] codon_start : 1 note : testican-2; granule cell antiserum positive 26 product : sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2 protein_id : NP_443720.1

name	Chst3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949014 CCDS:CCDS23871.1 GeneID:53374 MGI:1858224
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008459 - chondroitin 6-sulfotransferase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : chondroitin 6-sulfotransferase product : carbohydrate (chondroitin 6/keratan) sulfotransferase 3 protein_id : NP_058083.1

name	Psap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328185 GeneID:19156 MGI:97783
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : snoRNA MBII-198 product : prosaposin protein_id : NP_035309.2

name	Cdh23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517680 GeneID:22295 MGI:1890219
definition	GO_component : GO:0005932 - basal body [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0001917 - photoreceptor inner segment [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0016339 - calcium-dependent cell-cell adhesion [Evidence ISS]; GO:0007155 - cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0048839 - inner ear development [Evidence IMP]; GO:0048563 - post-embryonic organ morphogenesis [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IMP]; GO:0050953 - sensory perception of light stimulus [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IGI] codon_start : 1 note : otocadherin; bustling; waltzer; modifier of deaf waddler; age related hearing loss 1; bobby product : cadherin 23 protein_id : NP_075859.2

name	4632428N05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386340 GeneID:74048 MGI:1921298
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : Gi24 receptor product : Gi24 receptor precursor protein_id : NP_083008.1

name	Slc29a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963743 GeneID:71279 MGI:1918529
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : equilibrative nucleoside transporter 3 protein_id : NP_076085.1

name	Unc5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861262 CCDS:CCDS23872.1 GeneID:107449 MGI:894703
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : unc5 homolog (C. elegans) 2 product : unc-5 homolog B protein_id : NP_084046.2

name	LOC624335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624335
definition	number : 1 pseudo : _no_value

name	LOC624335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624335
definition	number : 2 pseudo : _no_value

name	LOC100039080 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039080
definition	number : 3 pseudo : _no_value

name	LOC100039080 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039080
definition	number : 2 pseudo : _no_value

name	LOC100039080 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039080
definition	number : 1 pseudo : _no_value

name	LOC664936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260890 GeneID:664936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 9 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_030603.1

clone name	MSMg01-466K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345I09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-500H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257N19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-337B19.b	B6Ng01-337B19.g
ACC	GA121834	GA121835
length	1,004	1,075
definition	B6Ng01-337B19.b	B6Ng01-337B19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(59,101,111 - 59,102,116)	(59,234,826 - 59,235,901)
sequence	gaattccacacagctaaatgctttacatactgatccagttaggaactgct aagagagatgagcatcccacgttcaatcaatgctttataggattaagcct gaaccaaatcaccagccgttaacaggatagactagtggcttcggactgct tctttgtatatttggtattatggccaagatgaggagaaacgggctagtca atgccggtgagacactcatcggcaggcttctttaaaaagagatgtcaaag actctaaagacattggttacttcagtgaggcggctagaaaaacaactgca gtttgttgctttaatgttacaagaaaggcagctgggatccagagaatagt tgcgggttcctgagggaaagaaagggaatgagtcattttgttggagtgtg aaaaataaaaaaattggaatgtgtcttaaggtcctggccaagacccagtg gacgataacagagagcgcagcatttagtgctctggtatttcactgttagg tatgcatatcagagctgagggtgtagccccatagacagcctgcttgccta gcacctgtacggccatgggttcaactcctcagcatcttgtgtactggagt agtaggacacatctatactcctaacacttggatggcgtacaagctgcttt tgtttgtcaacttgaccaagctgaagtcaacagagaaaggagcttcagcc aaggaaatgcctctatgagatccagttctaaagcattttctcaattagca atcaatacaggagggcccagtccactgtgggcagtaccacccctgggctg gtggtcctgagtttgataagaaagtaggctaagcaagccatgaggagcaa gccagtaagcagcatcctctatggcctctgcatcagcttctgcctccagg ttcctaccctgtttgaatccctgtcttgacttcctccagggatgaactat gatctggaagtgttagactctgataacccctttcctccccaactgctttt ttgg	gaattcactatatatcctggctgatctcaaccttgccgccatcctcctgc ctcagactcccaaatgctggggttataggcatgtgcctccatacccagct tgcaatggccccttaaaaacttgtttcagaaacaaggaaggagccaacga tgaagcctgagcatccacaacattgtaagctacatgtttaaggcataccg acagacgtgtagctaggtgtgcaggcaggtatagacactgggttccagtc cagggcttacaggccatgagagaaggccctgaaacatggtaactgctgag aactaagctcccacagaaccttagaggacaggggtggcactgagggtgaa gggttattcatgactcagagagggctaactttcagtctgcctagggtaac agaagagagacagggcatgacaccaaagtccacatgagactgtcataagt cagacatccttccagaagaattctgtcttgttcatcccaagtaaaaccct ccctgggtggtggctgatacaatgatgtccatacgtctgctttctggaga cctggcatcactgaaatgacatctgttctcacacatagctgctcaaacat gacctcacatactacaaatctgaaaggattttttaaaaatatcaccatta ttgtgactgtccagcacatgtatgaatttataagaaatatgcaaaaccgt gtaaacagtgagacatgatttaatatttactcagccaaattcagctaccg taaagacacaattcaatttctttattcattgcctgaaatctaaaatagtc aaaatcagaatgtgctgagttatgcctgacagtcattagacctacataaa ctttaaagccctaggtactgaacataccacagggtttctctggtgccctt ttgaagcttcacagtgaatagcaagggaagacgcttcatcttgagctttt ataatgtctcattaccatttgcctcccccagccaagactgtcccatggta ttagctcacagggattaccattttattaggatagctatgggagataggat acaatatagtcatttgtcaaaataa
quality values	Open. Hide. 49 31 16 14 58 49 28 15 54 42 42 41 62 62 54 62 62 62 47 54 62 62 62 54 62 56 42 62 62 62 62 62 47 54 62 59 43 62 62 62 62 62 62 49 62 59 62 62 62 59 62 62 62 59 62 62 62 59 49 62 62 62 62 62 62 62 54 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 54 62 59 59 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 58 58 58 38 46 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 54 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 52 58 58 58 54 39 58 58 54 58 58 58 58 58 58 58 58 54 58 58 48 54 58 52 54 54 58 54 58 58 58 51 58 54 58 58 51 51 51 51 54 58 58 58 54 49 58 51 58 42 58 49 58 58 58 58 58 58 53 50 58 54 58 48 41 54 53 54 50 58 51 58 50 58 58 58 51 58 51 50 51 54 58 58 51 40 50 58 46 49 44 28 58 54 50 48 49 50 58 58 51 50 52 52 53 53 43 41 41 51 54 49 50 49 58 54 58 58 44 37 49 58 52 58 54 50 51 40 58 50 58 51 51 51 54 58 58 58 58 39 58 52 58 40 50 49 42 50 54 54 49 29 32 38 32 54 32 54 54 51 54 50 35 49 49 37 41 41 50 41 46 34 35 54 39 49 54 51 21 50 54 45 45 39 40 49 42 21 38 38 49 49 49 27 35 49 26 44 51 39 35 40 39 47 46 25 31 33 33 42 40 45 51 46 37 41 38 54 47 40 41 39 33 49 49 47 36 42 33 30 41 31 34 39 35 45 42 52 52 39 26 45 53 32 52 31 18 49 31 15 52 41 31 40 40 27 25 26 28 41 31 32 31 35 21 27 37 33 32 31 31 31 30 28 33 33 30 33 33 33 26 42 46 46 30 31 37 36 25 42 46 22 31 43 31 42 35 20 42 46 41 30 31 29 19 35 31 46 47 37 31 31 31 17 46 31 33 31 44 25 43 31 29 28 28 27 26 31 27 23 18 31 33 21 30 24 27 31 27 24 24 33 27 31 36 24 31 32 31 31 32 33 32 38 31 37 31 27 30 31 46 26 31 29 33 22 32 30 26 31 31 37 19 26 30 24 31 31 33 20 31 38 23 25 31 33 35 8 19 14 37 31 33 21 28 24 21 24 12 24 20 16 23 15 14 14 37 18 22 33 23 18 13 10 29 22 31 15 31 10 18 28 15 34 25 22 43 24 11 24 19 12 25 9 23 32 31 22 30 32 29 22 14 23 11 22 24 22 21 8 19 28 15 17 17 27 9 9 7 32 5 5 10 3 20 18 8 24 40 21 15 8 13 16 30 16 14 7 11 17 23 13 9 15 31 40 38 21 14 7 3	Open. Hide. 62 47 51 44 62 44 51 47 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 49 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 54 49 54 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 49 56 62 62 62 62 62 62 62 62 62 62 54 62 54 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 49 43 49 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 54 53 58 58 52 58 45 41 58 58 58 58 58 54 58 58 58 58 58 54 46 58 58 58 58 49 58 52 54 54 58 54 58 48 58 58 58 54 47 58 52 58 58 58 54 58 58 52 58 58 53 58 58 58 53 49 58 51 58 54 58 58 49 58 58 58 58 49 58 54 58 50 54 53 51 58 51 58 54 58 53 58 58 58 54 33 42 24 58 58 58 58 51 46 53 53 53 46 51 58 58 58 54 49 58 58 50 50 58 54 58 58 51 58 52 54 53 52 49 50 54 50 58 51 49 58 58 58 58 58 52 50 43 43 50 50 54 54 58 43 43 44 50 43 49 40 53 52 58 49 51 49 40 46 49 54 51 51 51 58 58 42 49 58 32 26 58 58 58 58 53 32 54 54 54 49 52 40 50 49 41 44 50 49 54 46 50 50 51 54 41 54 46 41 40 54 44 49 51 28 45 53 35 50 45 53 54 53 53 51 51 49 44 46 54 51 53 53 39 54 38 49 36 44 40 45 41 46 44 32 54 51 34 39 26 44 42 46 35 44 54 40 42 40 42 34 49 35 37 29 22 36 47 38 22 16 51 34 32 51 52 45 46 49 47 32 41 53 32 25 33 52 38 25 40 35 34 52 31 31 36 53 53 30 21 32 40 30 40 46 41 45 34 31 19 33 23 36 51 33 29 13 40 40 47 31 37 29 46 31 37 27 19 30 19 35 31 31 28 31 31 31 45 47 29 31 35 31 33 51 51 30 31 37 31 42 31 36 47 37 40 31 31 31 26 46 33 26 46 30 42 42 42 31 38 27 46 31 27 28 41 30 29 22 38 31 18 30 22 17 29 28 31 31 31 26 27 16 32 31 31 35 24 28 18 33 20 25 37 46 31 31 46 44 43 31 33 26 31 14 17 15 26 27 32 32 37 22 25 12 17 37 31 26 14 20 29 33 26 47 24 5 41 8 16 30 33 31 29 25 14 29 7 30 8 36 44 43 25 30 18 30 23 31 31 31 30 25 19 20 33 16 24 9 26 19 20 16 31 17 30 17 48 11 27 18 16 23 19 31 28 25 34 31 31 32 20 26 13 30 30 27 29 34 43 39 30 23 19 16 17 16 24 17 21 18 26 20 14 15 27 18 17 12 12 30 7 6 19 8 14 11 34 28 28 17 16 6 15 6 15 10 11 25 24 26 12 11 17 28 20 8 8 16 9 3 8 28 20 19 16 28 27 14 12 11 10 10 40 7 29 10 15 7 4 6 25 18 38 38 16 5 3 5 5 12 6 21 12 8 11 16 22 13 17 9 24 10 12 9 12 11 25 4 4 20 10 8 4 4 5 4 5 2 4 7 9 18 19 25 17 8 8 5 6 10 17 25 5 7 24 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_59101111_59102116
seq2: B6Ng01-337B19.b_46_1049

seq1  GAATTCCACACAGCTAAATGCTTTACATACTGATCCAGTTAGGAACTGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACACAGCTAAATGCTTTACATACTGATCCAGTTAGGAACTGCT  50

seq1  AAGAGAGATGAGCATCCCACGTTCAATCAATGCTTTATAGGATTAAGCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAGATGAGCATCCCACGTTCAATCAATGCTTTATAGGATTAAGCCT  100

seq1  GAACCAAATCACCAGCCGTTAACAGGATAGACTAGTGGCTTCGGACTGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCAAATCACCAGCCGTTAACAGGATAGACTAGTGGCTTCGGACTGCT  150

seq1  TCTTTGTATATTTGGTATTATGGCCAAGATGAGGAGAAACGGGCTAGTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGTATATTTGGTATTATGGCCAAGATGAGGAGAAACGGGCTAGTCA  200

seq1  ATGCCGGTGAGACACTCATCGGCAGGCTTCTTTAAAAAGAGATGTCAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCGGTGAGACACTCATCGGCAGGCTTCTTTAAAAAGAGATGTCAAAG  250

seq1  ACTCTAAAGACATTGGTTACTTCAGTGAGGCGGCTAGAAAAACAACTGCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTAAAGACATTGGTTACTTCAGTGAGGCGGCTAGAAAAACAACTGCA  300

seq1  GTTTGTTGCTTTAATGTTACAAGAAAGGCAGCTGGGATCCAGAGAATAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGTTGCTTTAATGTTACAAGAAAGGCAGCTGGGATCCAGAGAATAGT  350

seq1  TGCGGGTTCCTGAGGGAAAGAAAGGGAATGAGTCATTTTGTTGGAGTGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGGGTTCCTGAGGGAAAGAAAGGGAATGAGTCATTTTGTTGGAGTGTG  400

seq1  AAAAATAAAAAAATTGGAATGTGTCTTAAGGTCCTGGCCAAGACCCAGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATAAAAAAATTGGAATGTGTCTTAAGGTCCTGGCCAAGACCCAGTG  450

seq1  GACGATAACAGAGAGCGCAGCATTTAGTGCTCTGGTATTTCACTGTTAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGATAACAGAGAGCGCAGCATTTAGTGCTCTGGTATTTCACTGTTAGG  500

seq1  TATGCATATCAGAGCTGAGGGTGTAGCCCCATAGACAGCCTGCTTGCCTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCATATCAGAGCTGAGGGTGTAGCCCCATAGACAGCCTGCTTGCCTA  550

seq1  GCACCTGTACGGCCATGGGTTCAACTCCTCAGCATCTTGTGTACTGGAGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCTGTACGGCCATGGGTTCAACTCCTCAGCATCTTGTGTACTGGAGT  600

seq1  AGTAGGACACATCTATACTCCTAACACTTGGATGGCGTACAAGCTGCTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGGACACATCTATACTCCTAACACTTGGATGGCGTACAAGCTGCTTT  650

seq1  TGTTTGTCAACTTGACCAAGCTGAAGTCAACAGAGAAAGGAGCTTCAGCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTGTCAACTTGACCAAGCTGAAGTCAACAGAGAAAGGAGCTTCAGCC  700

seq1  AAGGAAATGCCTCTATGAGATCCAGTTCTAAAGCATTTTCTCAATTAGCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAATGCCTCTATGAGATCCAGTTCTAAAGCATTTTCTCAATTAGCA  750

seq1  ATCAATACAGGAGGGCCCAGTCCACTGTGGGCAGTACCACCCCTGGGCTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAATACAGGAGGGCCCAGTCCACTGTGGGCAGTACCACCCCTGGGCTG  800

seq1  GTGGTCCTGAGTTTGATAAGAAAGTAGGCTAAGCAAGCCATGAGGAGCAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTCCTGAGTTTGATAAGAAAGTAGGCTAAGCAAGCCATGAGGAGCAA  850

seq1  GCCAGTAAGCAGCATCCTCTATGGCCTCTGCATCAGCTTCTGCCTCCAGG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGTAAGCAGCATCCTCTATGGCCTCTGCATCAGCTTCTGCCTCCAGG  900

seq1  TTCCTACCCTGTTTGAATCCCTGTCTTGACTTCCTCCAGGGATGAACTAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTACCCTGTTTGAATCCCTGTCTTGACTTCCTCCAGGGATGAACTAT  950

seq1  GATCTGGAAGTGTTAGACTCTGAATAAACCCTTTCCTCCCCAACTTGCTT  1000
      |||||||||||||||||||||| |||| |||||||||||||||| |||||
seq2  GATCTGGAAGTGTTAGACTCTG-ATAACCCCTTTCCTCCCCAAC-TGCTT  998

seq1  TTTTGG  1006
      ||||||
seq2  TTTTGG  1004

seq1: chr10_59234826_59235901
seq2: B6Ng01-337B19.g_64_1138 (reverse)

seq1  TTATTTTGACAAATGACTATTTATTTTGTATTCTTATCT-CCATAGCTAT  49
      |||||||||||||||||    ||| ||||| || ||||| ||||||||||
seq2  TTATTTTGACAAATGAC----TATATTGTA-TCCTATCTCCCATAGCTAT  45

seq1  CCTAATTAAAATTGTTAATCCTGTGAGCTAATACCATGGGACAGTCTTGG  99
      ||||| |||||| || |  |||||||||||||||||||||||||||||||
seq2  CCTAA-TAAAATGGTAATCCCTGTGAGCTAATACCATGGGACAGTCTTGG  94

seq1  CT-GGGGAGGC-AATGGTAATGAGACATTTATAAAAGCTCAAGATGAAGC  147
      || |||||||| ||||||||||||||| ||||||||||||||||||||||
seq2  CTGGGGGAGGCAAATGGTAATGAGACA-TTATAAAAGCTCAAGATGAAGC  143

seq1  GTCTT-CCTTGCTATTCACTGTGAAGCTTCAAAA-GGCACCAGAG-AACC  194
      ||||| |||||||||||||||||||||||||||| |||||||||| ||||
seq2  GTCTTCCCTTGCTATTCACTGTGAAGCTTCAAAAGGGCACCAGAGAAACC  193

seq1  CTGTGGTATGTTCAGTACCTAGGGCTTTAAAGTTTATGTAGGTCTAATGA  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGTATGTTCAGTACCTAGGGCTTTAAAGTTTATGTAGGTCTAATGA  243

seq1  CTGTCAGGCATAACTCAGCACATTCTGATTTTGACTATTTTAGATTTCAG  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCAGGCATAACTCAGCACATTCTGATTTTGACTATTTTAGATTTCAG  293

seq1  GCAATGAATAAAGAAATTGAATTGTGTCTTTACGGTAGCTGAATTTGGCT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATGAATAAAGAAATTGAATTGTGTCTTTACGGTAGCTGAATTTGGCT  343

seq1  GAGTAAATATTAAATCATGTCTCACTGTTTACACGGTTTTGCATATTTCT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTAAATATTAAATCATGTCTCACTGTTTACACGGTTTTGCATATTTCT  393

seq1  TATAAATTCATACATGTGCTGGACAGTCACAATAATGGTGATATTTTTAA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAATTCATACATGTGCTGGACAGTCACAATAATGGTGATATTTTTAA  443

seq1  AAAATCCTTTCAGATTTGTAGTATGTGAGGTCATGTTTGAGCAGCTATGT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCCTTTCAGATTTGTAGTATGTGAGGTCATGTTTGAGCAGCTATGT  493

seq1  GTGAGAACAGATGTCATTTCAGTGATGCCAGGTCTCCAGAAAGCAGACGT  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGAACAGATGTCATTTCAGTGATGCCAGGTCTCCAGAAAGCAGACGT  543

seq1  ATGGACATCATTGTATCAGCCACCACCCAGGGAGGGTTTTACTTGGGATG  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGACATCATTGTATCAGCCACCACCCAGGGAGGGTTTTACTTGGGATG  593

seq1  AACAAGACAGAATTCTTCTGGAAGGATGTCTGACTTATGACAGTCTCATG  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAGACAGAATTCTTCTGGAAGGATGTCTGACTTATGACAGTCTCATG  643

seq1  TGGACTTTGGTGTCATGCCCTGTCTCTCTTCTGTTACCCTAGGCAGACTG  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACTTTGGTGTCATGCCCTGTCTCTCTTCTGTTACCCTAGGCAGACTG  693

seq1  AAAGTTAGCCCTCTCTGAGTCATGAATAACCCTTCACCCTCAGTGCCACC  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTAGCCCTCTCTGAGTCATGAATAACCCTTCACCCTCAGTGCCACC  743

seq1  CCTGTCCTCTAAGGTTCTGTGGGAGCTTAGTTCTCAGCAGTTACCATGTT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTCCTCTAAGGTTCTGTGGGAGCTTAGTTCTCAGCAGTTACCATGTT  793

seq1  TCAGGGCCTTCTCTCATGGCCTGTAAGCCCTGGACTGGAACCCAGTGTCT  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGCCTTCTCTCATGGCCTGTAAGCCCTGGACTGGAACCCAGTGTCT  843

seq1  ATACCTGCCTGCACACCTAGCTACACGTCTGTCGGTATGCCTTAAACATG  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCTGCCTGCACACCTAGCTACACGTCTGTCGGTATGCCTTAAACATG  893

seq1  TAGCTTACAATGTTGTGGATGCTCAGGCTTCATCGTTGGCTCCTTCCTTG  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTTACAATGTTGTGGATGCTCAGGCTTCATCGTTGGCTCCTTCCTTG  943

seq1  TTTCTGAAACAAGTTTTTAAGGGGCCATTGCAAGCTGGGTATGGAGGCAC  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGAAACAAGTTTTTAAGGGGCCATTGCAAGCTGGGTATGGAGGCAC  993

seq1  ATGCCTATAACCCCAGCATTTGGGAGTCTGAGGCAGGAGGATGGCGGCAA  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCTATAACCCCAGCATTTGGGAGTCTGAGGCAGGAGGATGGCGGCAA  1043

seq1  GGTTGAGATCAGCCAGGATATATAGTGAATTC  1076
      ||||||||||||||||||||||||||||||||
seq2  GGTTGAGATCAGCCAGGATATATAGTGAATTC  1075

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information