MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-201F14
Chromosome	10 (Build37)
Map Location	76,558,298 - 76,558,538
singlet/doublet	singlet
Overlap gene	Col18a1
Upstream gene	Slc5a4b, Slc5a4a, LOC100040150, Prmt2, S100b, Dip2a, Pcnt, 2610028H24Rik, A130042E20Rik, Mcm3ap, Lss, 1700027D21Rik, Ftcd, Col6a2, Col6a1, Pcbp3, LOC100041099, Slc19a1
Downstream gene	LOC665762, Pofut2, Adarb1, 1810008A18Rik, Itgb2, Pttg1ip, Sumo3, Ube2g2, LOC674243, LOC670895, Krtap12-1, A030009A09Rik, LOC100041250, LOC100041261, LOC634517, LOC100041281, LOC634504, LOC675294, LOC670880, LOC100040299, LOC675238, C330046G03Rik, EG544710, LOC100041351, 1700009J07Rik, Lrrc3, Trpm2, 1810043G02Rik, Pfkl, Aire, Dnmt3l, Icosl
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc5a4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64454 MGI:1890478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64452 MGI:1927848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Prmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15468 MGI:1316652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	S100b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20203 MGI:98217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dip2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64451 MGI:2385920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18541 MGI:102722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610028H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76964 MGI:1924214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130042E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216119 MGI:2656825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcm3ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54387 MGI:1930089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lss (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16987 MGI:1336155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76573 MGI:1923823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftcd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14317 MGI:1339962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col6a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12834 MGI:88460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12833 MGI:88459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59093 MGI:1890470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Slc19a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20509 MGI:103182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col18a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12822 MGI:88451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Pofut2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80294 MGI:1916863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adarb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110532 MGI:891999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	1810008A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108707 MGI:1916334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16414 MGI:96611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pttg1ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108705 MGI:2652132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20610 MGI:1336201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22213 MGI:1343188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 908 ESTs pseudo : _no_value

name	LOC670895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Krtap12-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16694 MGI:1328315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A030009A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77763 MGI:1925013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100041250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins

name	LOC100041261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	LOC634517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	LOC100041281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC634504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC675294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC670880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins

name	LOC100040299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC675238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs

name	C330046G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252974 MGI:2671932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544710 MGI:3645300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins

name	1700009J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75188 MGI:1914938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 1 Protein

name	Lrrc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237387 MGI:2447899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28240 MGI:1351901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810043G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67884 MGI:1915134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18641 MGI:97547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aire (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11634 MGI:1338803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnmt3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54427 MGI:1859287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Icosl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50723 MGI:1354701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676362 GeneID:64454 MGI:1890478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (neutral amino acid transporters, system A), member 4b transcript_id : NM_023219.2

name	Slc5a4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444905 GeneID:64452 MGI:1927848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5, member 4a transcript_id : NM_133184.2

name	Prmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938279 GeneID:15468 MGI:1316652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 2 transcript_id : NM_133182.2

name	Prmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938281 GeneID:15468 MGI:1316652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 2 transcript_id : NM_001077638.1

name	S100b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54262155 GeneID:20203 MGI:98217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100 protein, beta polypeptide, neural transcript_id : NM_009115.2

name	Dip2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487256 GeneID:64451 MGI:2385920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIP2 disco-interacting protein 2 homolog A (Drosophila) transcript_id : NM_001081419.1

name	Pcnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93004084 GeneID:18541 MGI:102722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pericentrin (kendrin) transcript_id : NM_008787.3

name	2610028H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037478 GeneID:76964 MGI:1924214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610028H24 gene transcript_id : NM_029816.1

name	A130042E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865957 GeneID:216119 MGI:2656825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130042E20 gene transcript_id : NM_172550.4

name	Mcm3ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627647 GeneID:54387 MGI:1930089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 3 (S. cerevisiae) associated protein transcript_id : NM_019434.2

name	Lss (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122468 GeneID:16987 MGI:1336155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lanosterol synthase transcript_id : NM_146006.1

name	1700027D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313251 GeneID:76573 MGI:1923823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700027D21 gene transcript_id : NM_029661.1

name	Ftcd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252783 GeneID:14317 MGI:1339962
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formiminotransferase cyclodeaminase transcript_id : NM_080845.1

name	Col6a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203746 GeneID:12834 MGI:88460
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VI, alpha 2 transcript_id : NM_146007.1

name	Col6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129824 GeneID:12833 MGI:88459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VI, alpha 1 transcript_id : NM_009933.2

name	Pcbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947013 GeneID:59093 MGI:1890470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 3 transcript_id : NM_021568.1

name	LOC100041099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260965 GeneID:100041099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041099 transcript_id : XM_001477376.1

name	Slc19a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130166 GeneID:20509 MGI:103182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 19 (sodium/hydrogen exchanger), member 1 transcript_id : NM_031196.2

name	Col18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789281 GeneID:12822 MGI:88451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XVIII, alpha 1 transcript_id : NM_009929.2

name	Pofut2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044906 GeneID:80294 MGI:1916863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein O-fucosyltransferase 2 transcript_id : NM_030262.3

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625742 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_130895.2

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625746 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024837.1

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625744 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024839.1

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625738 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024840.1

name	Adarb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67763819 GeneID:110532 MGI:891999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase, RNA-specific, B1 transcript_id : NM_001024838.1

name	1810008A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388778 GeneID:108707 MGI:1916334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810008A18 gene transcript_id : NM_133998.2

name	Itgb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802513 GeneID:16414 MGI:96611
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 2 transcript_id : NM_008404.3

name	Pttg1ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803230 GeneID:108705 MGI:2652132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pituitary tumor-transforming 1 interacting protein transcript_id : NM_145925.2

name	Sumo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801940 GeneID:20610 MGI:1336201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMT3 suppressor of mif two 3 homolog 3 (yeast) transcript_id : NM_019929.3

name	Ube2g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130569 GeneID:22213 MGI:1343188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2G 2 transcript_id : NM_019803.3

name	LOC670895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260932 GeneID:670895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001474402.1

name	Krtap12-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754489 GeneID:16694 MGI:1328315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 12-1 transcript_id : NM_010670.1

name	A030009A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260974 GeneID:77763 MGI:1925013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : RIKEN cDNA A030009A09 gene transcript_id : XM_001477721.1

name	LOC100041250 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260976 GeneID:100041250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477730.1

name	LOC100041261 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260978 GeneID:100041261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477744.1

name	LOC634517 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260980 GeneID:634517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477760.1

name	LOC100041281 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260982 GeneID:100041281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477777.1

name	LOC634504 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260984 GeneID:634504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477786.1

name	LOC675294 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260934 GeneID:675294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001474442.1

name	LOC670880 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260986 GeneID:670880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477799.1

name	LOC100040299 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260936 GeneID:100040299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001474461.1

name	LOC675238 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260988 GeneID:675238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs product : similar to hCG2043579 transcript_id : XM_001477814.1

name	C330046G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003907 GeneID:252974 MGI:2671932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330046G03 gene transcript_id : NM_145855.1

name	EG544710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363864 GeneID:544710 MGI:3645300
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG544710 transcript_id : NM_001024709.2

name	LOC100041351 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260992 GeneID:100041351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : similar to A030009A09Rik protein transcript_id : XM_001477837.1

name	Lrrc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365689 GeneID:237387 MGI:2447899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 3 transcript_id : NM_145152.3

name	Trpm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31083375 GeneID:28240 MGI:1351901
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily M, member 2 transcript_id : NM_138301.1

name	1810043G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778944 GeneID:67884 MGI:1915134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810043G02 gene transcript_id : NM_026431.2

name	Pfkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366236 GeneID:18641 MGI:97547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofructokinase, liver, B-type transcript_id : NM_008826.3

name	Aire (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753019 GeneID:11634 MGI:1338803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) transcript_id : NM_009646.1

name	Dnmt3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126158898 GeneID:54427 MGI:1859287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA (cytosine-5-)-methyltransferase 3-like transcript_id : NM_001081695.1

name	Dnmt3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343788 GeneID:54427 MGI:1859287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA (cytosine-5-)-methyltransferase 3-like transcript_id : NM_019448.3

name	Icosl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131092 GeneID:50723 MGI:1354701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : icos ligand transcript_id : NM_015790.3

name	Slc5a4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676363 GeneID:64454 MGI:1890478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 note : low affinity sodium-glucose cotransporter product : solute carrier family 5 member 4b protein_id : NP_075708.2

name	Slc5a4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444906 GeneID:64452 MGI:1927848
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 5, member alpha 4a; sodium-dependent glucose cotransporter product : solute carrier family 5, member 4a protein_id : NP_573447.2

name	Prmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938282 GeneID:15468 MGI:1316652
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein methyltransferase-like 1 protein_id : NP_001071106.1

name	Prmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938280 GeneID:15468 MGI:1316652
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein methyltransferase-like 1 protein_id : NP_573445.2

name	S100b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677839 GeneID:20203 MGI:98217
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence NAS] [Evidence TAS]; GO:0005576 - extracellular region [Evidence IDA] [Evidence NAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence NAS] [Evidence TAS]; GO:0019210 - kinase inhibitor activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0048154 - S100 beta binding [Evidence ISS]; GO:0048156 - tau protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0048143 - astrocyte activation [Evidence ISS]; GO:0007409 - axonogenesis [Evidence ISS]; GO:0006874 - calcium ion homeostasis [Evidence NAS]; GO:0006112 - energy reserve metabolism [Evidence NAS]; GO:0048151 - hyperphosphorylation [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence NAS]; GO:0007613 - memory [Evidence IMP]; GO:0045917 - positive regulation of complement activation [Evidence ISS]; GO:0042035 - regulation of cytokine biosynthesis [Evidence NAS]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence NAS]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence IMP] codon_start : 1 product : S100 protein, beta polypeptide, neural protein_id : NP_033141.1

name	Dip2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487257 GeneID:64451 MGI:2385920
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : disco interacting protein 2 homolog protein_id : NP_001074888.1

name	Pcnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93004085 CCDS:CCDS23944.1 GeneID:18541 MGI:102722
definition	GO_component : GO:0005814 - centriole [Evidence IDA]; GO:0005813 - centrosome [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IDA] GO_process : GO:0042384 - cilium biogenesis [Evidence ISS]; GO:0007051 - spindle organization and biogenesis [Evidence IDA] codon_start : 1 note : pericentrin 2; pericentrin-360; pericentrin-250 product : pericentrin protein_id : NP_032813.3

name	2610028H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037479 GeneID:76964 MGI:1924214
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC76964 protein_id : NP_084092.1

name	A130042E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607131 CCDS:CCDS23946.1 GeneID:216119 MGI:2656825
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC216119 protein_id : NP_766138.3

name	Mcm3ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109627648 CCDS:CCDS23947.1 GeneID:54387 MGI:1930089
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : nuclear protein GANP; minichromosome maintenance deficient (S. cerevisiae) 3-associated protein product : minichromosome maintenance complex component 3 associated protein protein_id : NP_062307.2

name	Lss (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122469 CCDS:CCDS23948.1 GeneID:16987 MGI:1336155
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0000250 - lanosterol synthase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 product : lanosterol synthase protein_id : NP_666118.1

name	1700027D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313252 CCDS:CCDS23949.1 GeneID:76573 MGI:1923823
definition	codon_start : 1 product : hypothetical protein LOC76573 protein_id : NP_083937.1

name	Ftcd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252784 CCDS:CCDS23950.1 GeneID:14317 MGI:1339962
definition	GO_function : GO:0030412 - formimidoyltetrahydrofolate cyclodeaminase activity [Evidence TAS]; GO:0030409 - glutamate formimidoyltransferase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006548 - histidine catabolism [Evidence TAS]; GO:0006547 - histidine metabolism [Evidence IEA] codon_start : 1 note : glutamate formiminotransferase product : formiminotransferase cyclodeaminase protein_id : NP_543121.1

name	Col6a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203747 CCDS:CCDS23951.1 GeneID:12834 MGI:88460
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type VI, alpha 2 protein_id : NP_666119.1

name	Col6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753484 CCDS:CCDS23952.1 GeneID:12833 MGI:88459
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type VI, alpha 1 protein_id : NP_034063.1

name	Pcbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947014 GeneID:59093 MGI:1890470
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : poly(rC)-binding protein 3 product : poly(rC) binding protein 3 protein_id : NP_067543.1

name	LOC100041099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260966 GeneID:100041099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477426.1

name	Slc19a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654260 GeneID:20509 MGI:103182
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005542 - folic acid binding [Evidence IEA]; GO:0008518 - reduced folate carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 19 (sodium/hydrogen exchanger), member 1 protein_id : NP_112473.1

name	Col18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789282 CCDS:CCDS23953.1 GeneID:12822 MGI:88451
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IDA] [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0001886 - endothelial cell morphogenesis [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 product : procollagen, type XVIII, alpha 1 protein_id : NP_034059.2

name	Pofut2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19525731 CCDS:CCDS23954.1 GeneID:80294 MGI:1916863
definition	GO_function : GO:0046922 - peptide-O-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006004 - fucose metabolism [Evidence IEA] codon_start : 1 product : protein O-fucosyltransferase 2 protein_id : NP_084538.2

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625743 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : adenosine deaminase, RNA-specific, B1 isoform 1 protein_id : NP_570965.2

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625747 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : adenosine deaminase, RNA-specific, B1 isoform 2 protein_id : NP_001020008.1

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67763820 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : adenosine deaminase, RNA-specific, B1 isoform 3 protein_id : NP_001020009.1

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625745 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5 product : adenosine deaminase, RNA-specific, B1 isoform 5 protein_id : NP_001020010.1

name	Adarb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625739 GeneID:110532 MGI:891999
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0004000 - adenosine deaminase activity [Evidence IEA]; GO:0003726 - double-stranded RNA adenosine deaminase activity [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016553 - base conversion or substitution editing [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : adenosine deaminase, RNA-specific, B1 isoform 4 protein_id : NP_001020011.1

name	1810008A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527218 CCDS:CCDS23955.1 GeneID:108707 MGI:1916334
definition	codon_start : 1 product : hypothetical protein LOC108707 protein_id : NP_598759.1

name	Itgb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607447 CCDS:CCDS23956.1 GeneID:16414 MGI:96611
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0045123 - cellular extravasation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IDA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP] codon_start : 1 note : integrin beta 2 (Cd18); Mac-1 beta; macrophage antigen-1 beta; lymphocyte function associated antigen 1 product : integrin beta 2 protein_id : NP_032430.2

name	Pttg1ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122339 CCDS:CCDS23957.1 GeneID:108705 MGI:2652132
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : pituitary tumor-transforming gene 1 protein-interacting protein protein_id : NP_666037.1

name	Sumo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910556 CCDS:CCDS23958.1 GeneID:20610 MGI:1336201
definition	GO_function : GO:0019949 - SUMO conjugating enzyme activity [Evidence IDA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : SMT3 (supressor of mif two, 3) homolog 1 protein_id : NP_064313.1

name	Ube2g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806111 GeneID:22213 MGI:1343188
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme 7 homolog product : ubiquitin-conjugating enzyme E2G 2 protein_id : NP_062777.2

name	LOC670895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260933 GeneID:670895
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001474452.1

name	Krtap12-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754490 CCDS:CCDS23959.1 GeneID:16694 MGI:1328315
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 product : keratin associated protein 12-1 protein_id : NP_034800.1

name	A030009A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260975 GeneID:77763 MGI:1925013
definition	codon_start : 1 product : hypothetical protein LOC77763 protein_id : XP_001477771.1

name	LOC100041250 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260977 GeneID:100041250
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477780.1

name	LOC100041261 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260979 GeneID:100041261
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477794.1

name	LOC634517 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260981 GeneID:634517
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477810.1

name	LOC100041281 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260983 GeneID:100041281
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477827.1

name	LOC634504 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260985 GeneID:634504
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477836.1

name	LOC675294 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260935 GeneID:675294
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001474492.1

name	LOC670880 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260987 GeneID:670880
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477849.1

name	LOC100040299 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260937 GeneID:100040299
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001474511.1

name	LOC675238 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260989 GeneID:675238
definition	codon_start : 1 product : similar to hCG2043579 protein_id : XP_001477864.1

name	C330046G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003908 GeneID:252974 MGI:2671932
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : thrombospondin N-terminal domain/EPTP protein 1 product : RIKEN cDNA C330046G03 protein_id : NP_665854.1

name	EG544710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701540 GeneID:544710 MGI:3645300
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC544710 protein_id : NP_001019880.1

name	LOC100041351 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260993 GeneID:100041351
definition	codon_start : 1 product : similar to A030009A09Rik protein protein_id : XP_001477887.1

name	Lrrc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553121 CCDS:CCDS23960.1 GeneID:237387 MGI:2447899
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine-rich repeat-containing 3 product : leucine rich repeat containing 3 protein_id : NP_660134.1

name	Trpm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31083376 GeneID:28240 MGI:1351901
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047631 - ADP-ribose diphosphatase activity [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : transient receptor potential channel 7; transient receptor protein 7; transient receptor potential cation channel, subfamily M, member 2 (Trpm2) product : transient receptor potential cation channel, subfamily M, member 2 protein_id : NP_612174.1

name	1810043G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778945 GeneID:67884 MGI:1915134
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC67884 protein_id : NP_080707.2

name	Pfkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560653 GeneID:18641 MGI:97547
definition	GO_component : GO:0005945 - 6-phosphofructokinase complex [Evidence IEA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003872 - 6-phosphofructokinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006002 - fructose 6-phosphate metabolism [Evidence ISS]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : phosphofructokinase, liver, B-type protein_id : NP_032852.2

name	Aire (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753020 CCDS:CCDS23961.1 GeneID:11634 MGI:1338803
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0045182 - translation regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006959 - humoral immune response [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) protein_id : NP_033776.1

name	Dnmt3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126158899 GeneID:54427 MGI:1859287
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008047 - enzyme activator activity [Evidence IDA] [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI] [Evidence ISS]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006349 - imprinting [Evidence ISS] [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IMP] codon_start : 1 product : DNA (cytosine-5-)-methyltransferase 3-like protein_id : NP_001075164.1

name	Dnmt3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956092 CCDS:CCDS23962.1 GeneID:54427 MGI:1859287
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008047 - enzyme activator activity [Evidence IDA] [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence IGI] [Evidence ISS]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006349 - imprinting [Evidence ISS] [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IMP] codon_start : 1 product : DNA (cytosine-5-)-methyltransferase 3-like protein_id : NP_062321.1

name	Icosl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657220 GeneID:50723 MGI:1354701
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005102 - receptor binding [Evidence TAS] [Evidence IDA] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0006952 - defense response [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0045190 - isotype switching [Evidence NAS]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence TAS]; GO:0045404 - positive regulation of interleukin-4 biosynthesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence NAS]; GO:0042110 - T cell activation [Evidence NAS] codon_start : 1 product : icos ligand protein_id : NP_056605.1

name	LOC100040150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040150
definition	number : 2 pseudo : _no_value

name	LOC100040150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040150
definition	number : 1 pseudo : _no_value

name	LOC665762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665762
definition	number : 1 pseudo : _no_value

name	LOC674243 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260971 GeneID:674243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 908 ESTs product : hypothetical LOC674243 pseudo : _no_value transcript_id : XR_033366.1

name	1700009J07Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260994 GeneID:75188 MGI:1914938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 1 Protein product : RIKEN cDNA 1700009J07 gene transcript_id : XR_035305.1

clone name	MSMg01-462N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162P24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-201F14.T7 (MSMg01no201_f14.b1)	MSMg01-201F14.TJ (MSMg01no201_f14.g1)
ACC	AG386944	AG386945
length	755	726
length of high quality (start - end)	---	242 (77 - 318)
definition	CHROMAT_FILE: MSMg01no201_f14.b1 PHD_FILE: MSMg01no201_f14.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:21:26 2005	CHROMAT_FILE: MSMg01no201_f14.g1 PHD_FILE: MSMg01no201_f14.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:21:26 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GGGGGATGGTGGGGGGGGATNNANNCCCCCCANTACTGCCGGCGGGNNNN NNNCCATCTAXXXXXXXXXXXXXXXXXXXXXXXXXXATCGGAACCNGNAG NNGAGGAANNNNGNTTCCCAACAGAGAGAGAAGAGNNGAAANAAAAAAAA AAGGNNGNANGAAAGGAGGGAAGNCCCCAAGAAAGGAAAAAAGAGNANAG AAGAAAGNAANANGGANAAAGGGGGNNNNAGANGNGAGGGAGGGNANANN GGAAAGCGCACACGGAGGAGACAGAGGCNAGAAGANNACAGGGAGGGGNA AGAGTTTTTCCGCCACANAAGGAGAGCACGGCCCGAAAAAAGACAAAGGA AAAAAGAAAGAAGAGAGGGATTTTTTTTTTAAGAAGAGACGGNCNGGGCC CCGACACAATGTTTTTTTTCCCCCCCCCCCCCCCCAGANGAACGNANTGA AAGGGGAGAGAAGAGGTNNAGAAAAAAAAAAAAAAAGACCCGGGGGGGGG GGGTGGCCTTCACCACAGATTCCTACTACGCTGTGCAGTGATATCAGGGG AGCAAAGCGAGGAAGCAATCAGATTTGGGGACGGAAGCCCCGAAAACACG TCAAGAAAAAGAAACCACTATCGGCGCAGAGCTAAAAGGGCAGGGGGTTA TGGCACAGATATAGGAGTAAACTATGCGAAGAAGGGGGCACAAAATTTTT TTTTTTTTTTTAAGGCCGGTAATCGGCACGAGACGGCACACACGCTTTAA TTTTT	CGATGACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXTCTGAGACCCCAGGTTGTATAAGA GAGCTGCTAGAGGCTGTTTCTACCCAGGCTCCCATTCTGAGTTGATCCAG ACCACCTTCTCAGGCATGAAGCTTTCTTTGGAAACCTGGAGGCACCAAAC GTAAGATGAGGAGAATGTGGGGTTTAGTCAGGAGGGCTCAGTTATTCCTT CTGGAAAATGGACACTCAGACATCGAATGAAAAAGTTAGCAAGACAGGCA TGGAGATATACATCTGGTTAGTGTATGAAAGACCTAGAGTTCCAGGTCCA TTTGGATTTTTTTGTTCCAAAACANTCCCCCAATTTACTCATTTAAAGCT AGCCAGAGTAGGCCCCCACAAAAAAAAGAACACAGTGGGGGGGGGGGCCT GCTGGCCATGGGGACAGGGATGTCGCACAGCAGCTCTGCTTATGTCTGTT ATTTTAATGAAGACTTTGTGACAGGCCTGTGTTGCTCTCCCAGGTGTTGT ACGAAAGTTATTAATCTTGCCGCACTTTCTATTTTTTACTTGTGCTCCTT TTTGTGGATCCCACCCCCCCCGGCTACCCAGCGTTGTTTTATTTGTAGGG CGTGTCCTGTTCGCTTCCCAATTCGTNCCCGAATAGAGATTTATATTACC CATGCTTTGCCCCCCGTACTTGTCCN
quality values	Open. Hide. 8 11 11 8 9 8 6 6 6 7 15 24 22 19 9 8 8 8 8 3 0 0 3 0 0 3 7 7 7 8 8 3 0 3 6 6 8 6 8 10 6 6 6 6 8 3 0 0 0 0 0 0 0 3 9 9 9 10 8 8 8 8 8 8 8 22 25 39 30 19 10 9 9 9 9 12 15 14 14 14 28 21 21 8 6 6 6 6 6 6 6 6 6 6 3 0 3 0 3 3 0 0 3 10 6 8 17 3 0 0 0 0 3 0 3 8 11 11 7 7 7 7 6 6 6 6 6 6 9 9 11 11 21 22 3 0 0 3 14 14 3 0 3 27 27 34 32 32 34 28 27 11 9 3 0 0 3 0 3 0 3 17 10 9 9 9 9 9 9 7 7 6 3 0 3 8 8 8 9 9 9 14 13 15 9 9 9 15 11 13 13 17 21 9 3 0 3 0 3 12 23 15 9 7 7 6 3 0 3 3 0 3 0 3 9 3 0 3 6 6 8 8 6 6 3 0 0 0 0 3 16 3 0 3 0 3 8 6 6 6 6 6 7 3 0 3 0 3 0 0 3 7 7 15 13 8 8 8 8 13 11 17 9 9 9 9 18 41 41 25 22 8 8 8 17 19 22 3 0 3 27 25 25 9 3 0 0 3 17 14 9 9 9 9 19 7 7 3 0 3 21 9 9 7 8 8 8 9 9 15 15 16 9 9 9 17 3 0 3 7 7 9 9 18 9 7 13 6 6 6 7 7 10 8 9 9 9 18 15 8 8 8 8 19 21 36 36 39 39 32 30 30 32 39 47 43 43 43 43 43 32 32 23 26 32 31 27 10 8 8 8 8 10 30 22 14 14 9 9 7 9 10 13 8 10 10 13 13 8 8 8 3 0 3 0 3 13 17 28 29 22 10 10 10 15 14 9 7 7 6 6 9 12 10 9 10 10 15 12 10 10 10 14 17 14 15 14 19 28 28 37 36 27 21 12 12 12 3 0 3 8 6 6 3 0 3 0 3 23 20 30 18 14 9 9 9 9 19 36 29 10 8 8 8 8 8 3 0 0 3 9 9 11 11 16 21 18 22 22 21 21 17 22 10 10 8 10 8 13 11 9 8 8 10 10 11 12 15 19 15 12 12 8 8 6 8 10 18 18 30 19 18 18 12 12 12 10 9 10 10 15 15 23 23 23 17 18 11 11 13 11 19 15 10 10 10 8 10 9 9 10 10 13 19 11 11 11 8 7 6 6 8 10 13 8 10 11 21 11 11 11 11 11 10 11 11 11 15 10 10 10 16 15 19 16 13 10 9 8 8 8 8 13 15 24 19 18 15 14 17 19 21 21 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 9 9 10 13 10 9 9 10 10 10 10 10 8 8 6 6 8 8 12 8 8 8 6 8 8 10 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 8 8 6 6 10 14 13 19 15 10 8 8 8 8 8 8 16 16 15 13 12 8 8 8 6 10 6 6 6 6 8 10 8 8 8 8 8 8 11 21 25 24 14 11 9 8 9 9 10 11 11 11 10 13 8 8 8 10 8 8 8 8 8 8 8 8 10 8 8 8 6 6 8 8 8 7 6 8 8 8 9 9 9 8 8 6 6 8 8 10 10 10 9	Open. Hide. 9 9 8 14 15 8 11 10 11 23 21 26 25 25 37 33 33 47 39 44 48 48 48 48 48 57 57 57 43 47 47 42 42 39 43 43 43 43 42 36 36 36 36 36 44 44 57 68 54 54 54 54 54 48 53 54 68 68 68 54 57 48 50 41 41 46 50 59 68 68 51 51 50 48 50 47 48 48 48 44 37 23 23 41 41 42 43 44 44 54 47 59 43 43 43 43 43 39 59 43 43 35 43 43 44 43 43 50 43 52 32 38 16 18 18 38 38 52 52 52 52 52 52 50 50 37 37 37 50 43 43 43 35 35 35 43 42 43 42 44 43 52 47 57 57 45 39 39 43 43 52 52 52 52 52 57 57 57 57 57 57 39 36 35 23 22 24 36 39 52 43 44 33 39 41 57 57 57 57 43 45 27 28 9 9 9 27 27 43 43 43 32 33 27 27 28 44 44 57 57 52 42 42 32 32 28 43 32 28 31 44 44 42 35 32 32 36 36 52 52 52 43 50 35 42 35 41 43 28 27 27 35 32 32 34 32 17 18 28 27 27 32 35 42 42 42 37 42 41 41 16 16 14 14 32 32 42 32 26 26 13 13 13 19 19 28 36 36 43 37 29 30 28 36 18 18 14 21 21 28 28 28 34 24 23 20 20 20 20 20 24 25 30 37 30 28 28 35 35 35 39 39 39 35 35 39 39 37 47 39 35 35 31 31 26 19 15 12 11 11 11 11 10 8 13 13 8 10 8 14 14 19 24 21 24 13 13 13 13 18 18 18 26 26 29 19 28 32 37 34 39 32 28 28 20 15 16 11 18 18 24 24 12 9 8 8 8 7 7 9 9 8 7 3 0 3 7 10 8 8 8 10 8 12 20 20 28 28 25 28 28 37 28 28 23 20 20 20 20 20 32 23 23 21 23 15 15 12 24 24 26 13 14 12 20 13 13 9 9 9 9 12 10 16 13 9 9 8 10 8 17 17 12 12 9 9 9 14 22 24 32 22 16 10 11 10 10 10 17 22 17 24 18 20 12 11 11 12 25 23 28 22 22 24 28 23 25 13 13 14 28 27 37 31 30 30 28 19 19 13 23 21 18 21 12 26 25 39 33 31 25 18 11 11 12 11 12 13 10 9 8 13 10 15 15 17 17 16 15 12 10 10 10 11 11 16 12 11 12 12 12 18 11 13 10 10 10 12 9 9 9 12 13 13 10 10 8 8 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 12 8 8 8 8 10 9 10 15 16 16 11 10 10 8 8 8 8 11 8 8 8 8 8 8 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 13 12 8 8 8 8 8 10 8 10 8 8 8 8 18 16 19 10 9 9 9 8 8 10 8 8 10 11 11 11 12 10 8 8 8 8 12 15 11 10 10 8 8 8 8 7 9 8 8 10 10 9 6 8 8 9 9 9 9 9 9 9 11 10 10 8 10 6 6 8 8 9 9 9 3 0 3 8 6 6 8 6 7 8 8 8 8 6 8 8 9 9 10 12 8 8 8 8 10 8 8 8 8 15 12 8 8 8 8 9 12 8 10 8 6 8 8 8 8 8 8 10 10 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no201_f14.g1 MSMg01no201_f14.g1 CHROMAT_FILE:
MSMg01no201_f14.g1 PHD_FILE: MSMg01no201_f14.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:21:26 2005
         (242 letters)



>mm_chr10_76558098_76558739
          Length = 642

 Score =  443 bits (229), Expect = e-129
 Identities = 238/241 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   tctgagaccccaggttgtataagagagctgctagaggctgtttctacccaggctcccatt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 tctgagaccccaggttgtataagagagctgctagaggctgtttctacccaggctcccatt 382

                                                                       
Query: 61  ctgagttgatccagaccaccttctcaggcatgaagctttctttggaaacctggaggcacc 120
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 381 ctgagttgatccagaccaccttctcaggcatgaagctttctttggaaagctggaggcacc 322

                                                                       
Query: 121 aaacgtaagatgaggagaatgtggggtttagtcaggagggctcagttattccttctggaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 aaacgtaagatgaggagaatgtggggtttagtcaggagggctcagttattccttctggaa 262

                                                                       
Query: 181 aatggacactcagacatcgaatgaaaaagttagcaagacaggcatggagatatacatctg 240
           ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 aatggccactcagacatcgtatgaaaaagttagcaagacaggcatggagatatacatctg 202

            
Query: 241 g 241
           |
Sbjct: 201 g 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 242
Length of database: 642
Length adjustment: 9
Effective length of query: 233
Effective length of database: 633
Effective search space:   147489
Effective search space used:   147489
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information