MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-381C22
Chromosome	10 (Build37)
Map Location	58,305,351 - 58,305,749
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC211619, LOC668374, Pkib, Ppia-ps10_506.1, Fabp7, Smpdl3a, EG664783, 4933403O03Rik, EG245263, Gcc2, Lims1, Ranbp2, 6230424H07Rik, LOC100038981, Edar, LOC624335, LOC100039099
Downstream gene	Sh3md4, Sept10, Ankrd57, LOC664892, P4ha1, LOC100039174, Pla2g12b, Oit3, Ccdc109a, LOC100039225, Cbara1, EG664907
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC211619 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211619
definition	note : mitochondrial ribosomal protein L48 pseudogene pseudo : _no_value

name	LOC668374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	Pkib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18768 MGI:101937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Ppia-ps10_506.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544698
definition	note : peptidylprolyl isomerase A pseudogene 10_506.1 pseudo : _no_value

name	Fabp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12140 MGI:101916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpdl3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57319 MGI:1931437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664783 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664783 MGI:3704116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins

name	4933403O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74399 MGI:1921649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG245263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245263 MGI:3645498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70297 MGI:1917547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lims1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110829 MGI:1195263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ranbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19386 MGI:894323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6230424H07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76138 MGI:1923388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 2 Proteins

name	LOC100038981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Edar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13608 MGI:1343498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624335 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100039099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Sh3md4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237353 MGI:2444637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103080 MGI:1918110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ankrd57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268301 MGI:3606051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 6 Proteins

name	LOC664892 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	P4ha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18451 MGI:97463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 323 ESTs, 6 Proteins

name	Pla2g12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69836 MGI:1917086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oit3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18302 MGI:1201782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc109a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215999 MGI:3026965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cbara1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216001 MGI:2384909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664907 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664907 MGI:3647495
definition	note : predicted gene, EG664907 pseudo : _no_value

name	LOC668374 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260738 GeneID:668374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : hypothetical LOC668374 transcript_id : XM_001001151.2

name	Pkib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794590 GeneID:18768 MGI:101937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor beta, cAMP dependent, testis specific transcript_id : NM_008863.3

name	Pkib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794588 GeneID:18768 MGI:101937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor beta, cAMP dependent, testis specific transcript_id : NM_001039053.1

name	Pkib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794584 GeneID:18768 MGI:101937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor beta, cAMP dependent, testis specific transcript_id : NM_001039051.1

name	Pkib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794586 GeneID:18768 MGI:101937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor beta, cAMP dependent, testis specific transcript_id : NM_001039052.1

name	Pkib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794582 GeneID:18768 MGI:101937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase inhibitor beta, cAMP dependent, testis specific transcript_id : NM_001039050.1

name	Fabp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94540560 GeneID:12140 MGI:101916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid binding protein 7, brain transcript_id : NM_021272.3

name	Smpdl3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431241 GeneID:57319 MGI:1931437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase, acid-like 3A transcript_id : NM_020561.2

name	EG664783 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388199 GeneID:664783 MGI:3704116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins product : predicted gene, EG664783 transcript_id : XM_972624.1

name	4933403O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260884 GeneID:74399 MGI:1921649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933403O03 gene transcript_id : XM_618764.4

name	EG245263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369154 GeneID:245263 MGI:3645498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG245263 transcript_id : NM_001034869.2

name	Gcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742805 GeneID:70297 MGI:1917547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRIP and coiled-coil domain containing 2 transcript_id : NM_027375.2

name	Lims1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794646 GeneID:110829 MGI:1195263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM and senescent cell antigen-like domains 1 transcript_id : NM_026148.2

name	Ranbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842801 GeneID:19386 MGI:894323
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN binding protein 2 transcript_id : NM_011240.2

name	Edar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803268 GeneID:13608 MGI:1343498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectodysplasin-A receptor transcript_id : NM_010100.2

name	LOC100039099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260891 GeneID:100039099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100039099 transcript_id : XM_001472224.1

name	Sh3md4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254251 GeneID:237353 MGI:2444637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 multiple domains 4 transcript_id : NM_172788.2

name	Sept10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369079 GeneID:103080 MGI:1918110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 10 transcript_id : NM_001024910.2

name	Sept10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906174 GeneID:103080 MGI:1918110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 10 transcript_id : NM_001024911.1

name	Ankrd57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260893 GeneID:268301 MGI:3606051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 6 Proteins product : ankyrin repeat domain 57, transcript variant 1 transcript_id : XM_884335.3

name	LOC664892 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94388207 GeneID:664892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to jumonji domain containing 3 transcript_id : XM_973302.1

name	P4ha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859595 GeneID:18451 MGI:97463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide transcript_id : NM_011030.1

name	LOC100039174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260894 GeneID:100039174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 323 ESTs, 6 Proteins product : similar to Translocase of inner mitochondrial membrane 23 homolog (yeast) transcript_id : XM_001472392.1

name	Pla2g12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980795 GeneID:69836 MGI:1917086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group XIIB transcript_id : NM_023530.2

name	Oit3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345064 GeneID:18302 MGI:1201782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oncoprotein induced transcript 3 transcript_id : NM_010959.2

name	Ccdc109a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803154 GeneID:215999 MGI:3026965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 109A transcript_id : NM_001033259.2

name	LOC100039225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260896 GeneID:100039225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039225 transcript_id : XM_001472485.1

name	Cbara1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130037 GeneID:216001 MGI:2384909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding atopy-related autoantigen 1 transcript_id : NM_144822.2

name	LOC668374 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94388081 GeneID:668374
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001151.1

name	Pkib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794591 CCDS:CCDS23854.1 GeneID:18768 MGI:101937
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protein kinase, cAMP-dependent, catalytic, inhibitor 2 product : cAMP-dependent protein kinase inhibitor beta isoform 1 protein_id : NP_032889.3

name	Pkib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794589 GeneID:18768 MGI:101937
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 5; protein kinase, cAMP-dependent, catalytic, inhibitor 2 product : cAMP-dependent protein kinase inhibitor beta isoform 3 protein_id : NP_001034142.1

name	Pkib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794583 CCDS:CCDS23855.1 GeneID:18768 MGI:101937
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; protein kinase, cAMP-dependent, catalytic, inhibitor 2 product : cAMP-dependent protein kinase inhibitor beta isoform 2 protein_id : NP_001034139.1

name	Pkib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794585 CCDS:CCDS23855.1 GeneID:18768 MGI:101937
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; protein kinase, cAMP-dependent, catalytic, inhibitor 2 product : cAMP-dependent protein kinase inhibitor beta isoform 2 protein_id : NP_001034140.1

name	Pkib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794587 CCDS:CCDS23855.1 GeneID:18768 MGI:101937
definition	GO_function : GO:0004862 - cAMP-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 4; protein kinase, cAMP-dependent, catalytic, inhibitor 2 product : cAMP-dependent protein kinase inhibitor beta isoform 2 protein_id : NP_001034141.1

name	Fabp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946572 CCDS:CCDS23856.1 GeneID:12140 MGI:101916
definition	GO_component : GO:0042995 - cell projection [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mammary-derived growth inhibitor-related; brain lipid binding protein product : fatty acid binding protein 7, brain protein_id : NP_067247.1

name	Smpdl3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431242 CCDS:CCDS23857.1 GeneID:57319 MGI:1931437
definition	EC_number : 3.1.4.- GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : ASM-like phosphodiesterase 3a product : acid sphingomyelinase-like phosphodiesterase 3a protein_id : NP_065586.3

name	EG664783 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388200 GeneID:664783 MGI:3704116
definition	codon_start : 1 product : similar to homeobox protein protein_id : XP_977718.1

name	4933403O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260885 GeneID:74399 MGI:1921649
definition	codon_start : 1 product : hypothetical protein LOC74399 protein_id : XP_618764.4

name	EG245263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702209 GeneID:245263 MGI:3645498
definition	codon_start : 1 product : hypothetical protein LOC245263 protein_id : NP_001030041.1

name	Gcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742806 CCDS:CCDS23859.1 GeneID:70297 MGI:1917547
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : GRIP and coiled-coil domain-containing 2 protein_id : NP_081651.2

name	Lims1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794647 CCDS:CCDS23860.1 GeneID:110829 MGI:1195263
definition	GO_component : GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0043009 - embryonic development (sensu Vertebrata) [Evidence IMP]; GO:0007163 - establishment and/or maintenance of cell polarity [Evidence IMP] codon_start : 1 note : LIM and senescent cell antigen-like domains 1-like product : LIM and senescent cell antigen-like domains 1 protein_id : NP_080424.2

name	Ranbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882199 CCDS:CCDS23861.1 GeneID:19386 MGI:894323
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0046907 - intracellular transport [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAN binding protein 2 protein_id : NP_035370.1

name	Edar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753714 CCDS:CCDS23862.1 GeneID:13608 MGI:1343498
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0042346 - positive regulation of NF-kappaB import into nucleus [Evidence IDA]; GO:0007431 - salivary gland development [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : ectodysplasin-A receptor protein_id : NP_034230.1

name	LOC100039099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260892 GeneID:100039099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472274.1

name	Sh3md4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370164 GeneID:237353 MGI:2444637
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : SH3 multiple domains 4 protein_id : NP_766376.1

name	Sept10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906193 GeneID:103080 MGI:1918110
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : septin 10 isoform 1 protein_id : NP_001020081.1

name	Sept10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906175 GeneID:103080 MGI:1918110
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : septin 10 isoform 2 protein_id : NP_001020082.1

name	Ankrd57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933041 GeneID:268301 MGI:3606051
definition	codon_start : 1 product : ankyrin repeat domain 57 isoform 1 protein_id : XP_889428.1

name	LOC664892 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94388208 GeneID:664892
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978396.1

name	P4ha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859596 CCDS:CCDS23863.1 GeneID:18451 MGI:97463
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0004656 - procollagen-proline 4-dioxygenase activity [Evidence IDA] GO_process : GO:0018401 - peptidyl-proline hydroxylation to 4-hydroxy-L-proline [Evidence IDA]; GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 product : procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide protein_id : NP_035160.1

name	LOC100039174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260895 GeneID:100039174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472442.1

name	Pla2g12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980796 CCDS:CCDS23864.1 GeneID:69836 MGI:1917086
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006644 - phospholipid metabolism [Evidence IEA] codon_start : 1 note : group XIIB phospholipase A2; phospholipase A2, group XIII product : phospholipase A2, group XIIB protein_id : NP_076019.2

name	Oit3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27545185 CCDS:CCDS23865.1 GeneID:18302 MGI:1201782
definition	codon_start : 1 product : oncoprotein-induced transcript 3 protein_id : NP_035089.1

name	Ccdc109a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701766 CCDS:CCDS23866.1 GeneID:215999 MGI:3026965
definition	codon_start : 1 product : coiled-coil domain containing 109A protein_id : NP_001028431.1

name	LOC100039225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260897 GeneID:100039225
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472535.1

name	Cbara1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450201 GeneID:216001 MGI:2384909
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calcium binding atopy-related autoantigen 1 protein_id : NP_659071.1

name	LOC100038981 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038981
definition	number : 1 pseudo : _no_value

name	LOC100038981 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038981
definition	number : 2 pseudo : _no_value

name	LOC100038981 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038981
definition	number : 3 pseudo : _no_value

name	LOC624335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624335
definition	number : 1 pseudo : _no_value

name	LOC624335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624335
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	repeat_region
link
xref
definition	rpt_family : (TG)n

name	(CDS detail)
type	repeat_region
link
xref
definition	rpt_family : B1F

name	(CDS detail)
type	repeat_region
link
xref
definition	rpt_family : (CAAAA)n

name	6230424H07Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260889 GeneID:76138 MGI:1923388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 2 Proteins product : RIKEN cDNA 6230424H07 gene transcript_id : XR_001535.2

clone name	MSMg01-280G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415G18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308E16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-381C22.T7 (MSMg01no381_c22.b1)	MSMg01-381C22.TJ (MSMg01no381_c22.g1)
ACC	AG485383	AG485384
length	756	790
length of high quality (start - end)	293 (40 - 332)	399 (66 - 464)
definition	CHROMAT_FILE: MSMg01no381_c22.b1 PHD_FILE: MSMg01no381_c22.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:22:30 2005	CHROMAT_FILE: MSMg01no381_c22.g1 PHD_FILE: MSMg01no381_c22.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:22:30 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCA CTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCTCCTGCCTCTGTCT CCCAAGTGCTGGGATTAAAGGCGTGTGCCACCACCTTCATCCAAAGAAAG CCAGGAGCAGACTGTCCTCAGACAGCTAGAAGGAGGGTCTCAAAGCCCAC ACCCACAGTGACATATTTCAACAAGGCCACACCCCCTTATAGTGCCACTC CCTGGGCCAAGCATATTCAAACTACCATAGGAAGATACTCAGCAATGACC TCTGGGCCATCATAACATATGTGTGTATGNGNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNN NNNNNNNNNNNTNNTTNNNNNNNNNNNNNNTNNNNNNNTNNNNNNNNNNN NNNNTNTTTTTTTTTTNNNNTTTTTTTTTTNTTTNNTTTTTTTTNNTNNT TTTTNNTTTTTTTTTTTTTTTTTTTNNNTTTTTTTTTTNTTTNNTTTTTT NNNTTTTNTTTTTTTTTTTTTTTTTTTNNNNNNTCTTTNNTTTTTTTTNT NTNTTTTTTTTTTTTTTTTTTTNTTTTNNTTTTTTTTTTTTTNNTTCCCC TTTTTTTTTTTTTCCNTTTTTCTTTTCCTTTTTTTCTTCCTTTTCCCCTT CTCCTC	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXTAAGAACTGTGACTCAGTATGTATTAAATTTCCAT GAAACAGAGGGAAGCGATGCTTAGACTCTAGAAAACTAGAAATTTCCTAA ATCTGGGTAATACCCATGAGAAAGAGAGTGAGGGGGAGACTTAAAACATT AAAGGTCCCATTAAATCCTACCACCCCAGGATAATCCACTCAACGTGCTG AAGGCCTGTTGACATCCATGTAAATATAAACACAAACAATATGTGTTATG GTCAAAGTTACCAGTCACACAATAGTCACGCTCACAGGCAAGACAAAACC TAGAGTTTGCAGATTCTTCTTCAAAAGGAAATGCTGTGCTCAACAAATGC ATTATGCCAACTGAGCTCCCACGCTGGGACAGAAGCTGGGGAGGCCATTT TTCTAATCCACGGGGGACTTGGTTTTAGTAAGGACAGAATCCCAGCCTCC AAGCCACTGCTCTATGTGAGCAGCCACACCTCACACACCAAGAAAAAGAG GGAAATGCATCTCCCAGCACACGGAATGGCTTAAAGGNTTCAAAACAGTT GCCATACGGCCATGAACTCCCGGAAGCAAGGGCTGCAGCTTATGGTCCAC CTGGAGGGATAAGTTGCCTAAAAGGGAGGGGGATGTAAAATAAGACCAAA AGGTGGGTGCTCTCCCTTCCTTCCCCCTTTTTTTTTTTTTTTTCCCTCCA ACCTTTTCTTCTTTCTCCCTCCCGCTTATTCTCTTTTCTG
quality values	Open. Hide. 24 24 24 27 19 12 12 9 9 15 22 10 10 13 15 15 34 34 59 26 19 11 11 12 21 21 12 10 9 9 11 15 25 32 24 20 19 16 14 25 34 50 50 31 31 36 35 31 31 28 28 27 36 28 23 16 11 11 17 21 28 30 33 33 47 48 59 59 59 53 53 50 50 50 53 42 42 40 40 40 47 53 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 68 68 68 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 68 59 59 52 52 52 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 54 52 52 57 57 68 68 68 68 68 68 68 68 68 57 59 59 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 54 54 54 57 57 68 68 68 59 59 57 57 57 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 59 59 57 57 57 57 48 48 57 57 57 57 57 59 59 59 59 47 50 47 41 41 39 32 23 23 23 23 22 37 37 47 47 50 59 59 39 59 27 27 3 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 3 12 8 8 7 7 7 7 7 3 0 0 0 0 3 17 13 7 7 6 6 6 6 3 0 3 18 3 0 0 3 9 10 10 18 20 18 3 0 0 3 0 0 3 9 11 9 3 0 0 3 8 6 7 9 9 14 9 11 11 10 10 10 16 13 19 11 10 3 0 0 0 3 6 6 6 6 8 6 9 9 3 0 3 9 3 0 0 3 8 8 9 13 3 0 0 0 3 9 9 3 0 3 9 9 13 10 10 10 10 10 7 9 7 7 6 8 9 18 17 3 0 0 0 0 0 0 3 8 8 8 3 0 0 3 6 9 13 11 8 8 3 0 3 0 3 0 3 6 8 8 10 8 8 8 8 8 12 12 21 13 14 11 15 10 3 0 3 8 8 3 0 0 3 9 9 8 11 11 9 8 8 8 8 8 3 0 0 3 6 7 7 9 8 10 8 6 6 9 6 6 6 12 12 12 11 10 10 3 0 3 8 8 6 6 8 8 8 13 7 7 6 6 6 9 10 13 13 14 9 9 9 9 9 14 10 10 11 11 19 17 30 30 29 22 23 16 11 11 11	Open. Hide. 9 9 6 6 9 9 12 33 32 37 39 39 37 37 44 39 37 43 59 41 34 21 10 9 9 9 10 10 11 11 11 19 21 37 41 42 50 43 36 33 33 33 42 42 48 50 50 57 57 44 42 31 31 28 28 28 37 37 46 36 40 36 36 41 42 59 68 68 68 68 68 68 68 68 68 68 68 50 50 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 51 51 47 47 47 50 59 51 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 68 68 68 68 51 50 50 57 57 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 52 52 52 52 52 52 52 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 48 48 47 47 47 47 59 59 59 59 59 59 57 57 57 57 50 53 50 48 47 41 41 39 39 39 41 37 41 43 59 44 41 41 41 44 39 39 41 37 37 41 43 59 59 59 44 44 44 37 37 34 34 24 28 13 9 9 9 9 19 16 30 25 21 16 17 17 17 23 31 36 36 39 31 35 27 30 28 28 28 34 31 17 18 11 12 11 16 18 30 22 18 15 15 14 12 12 15 14 17 18 26 17 17 18 29 24 21 21 12 12 12 18 15 29 29 23 20 11 11 11 10 10 11 14 12 11 11 11 11 14 14 22 22 25 22 19 18 19 16 16 12 14 12 14 14 14 16 16 18 11 9 9 11 17 12 11 12 10 10 11 12 12 11 11 11 8 8 8 11 9 9 10 10 9 12 12 12 10 10 3 0 3 9 7 7 7 9 8 8 8 8 8 8 8 9 9 9 9 10 16 17 17 11 9 9 9 11 11 13 11 12 14 9 9 10 9 9 11 11 11 11 11 12 10 9 10 9 9 9 9 9 12 11 11 11 10 9 8 8 8 8 8 9 10 10 14 18 12 10 8 9 9 9 9 9 6 6 6 6 6 6 6 6 6 9 9 10 10 14 9 8 8 10 10 8 10 12 9 9 12 15 19 24 11 9 8 8 8 11 10 10 11 23 10 8 8 8 8 8 8 8 9 9 9 11 11 18 27 11 9 9 11 12 12 15 8 10 9 9 12 9 9 9 12 15 22 21 10 10 10 10 10 10 13 10 13 8 8 6 7 7 10 8 10 10 9 9 8 8 6 6 8 6 8 10 10 11 8 8 8 8 6 7 10 10 9 7 7 8 7 8 8 13 12 9 9 9 9 13 9 9 10 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no381_c22.g1 MSMg01no381_c22.g1 CHROMAT_FILE:
MSMg01no381_c22.g1 PHD_FILE: MSMg01no381_c22.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:22:30 2005
         (399 letters)



>mm_chr10_58305151_58305949
          Length = 799

 Score =  710 bits (367), Expect = 0.0
 Identities = 391/399 (97%)
 Strand = Plus / Minus

                                                                       
Query: 1   taagaactgtgactcagtatgtattaaatttccatgaaacagagggaagcgatgcttaga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 599 taagaactgtgactcagtatgtattaaatttccatgaaacagagggaagtgatgcttaga 540

                                                                       
Query: 61  ctctagaaaactagaaatttcctaaatctgggtaatacccatgagaaagagagtgagggg 120
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 539 ctctagaaaactagaaatttcttaaatctgggtaatacccatgagaaagagagtgagggg 480

                                                                       
Query: 121 gagacttaaaacattaaaggtcccattaaatcctaccaccccaggataatccactcaacg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 gagacttaaaacattaaaggtcccattaaatcctaccaccccaggataatccactcaacg 420

                                                                       
Query: 181 tgctgaaggcctgttgacatccatgtaaatataaacacaaacaatatgtgttatggtcaa 240
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 tgctgaaggcctgttgacaaccatgtaaatataaacacaaacaatatgtgttatggtcaa 360

                                                                       
Query: 241 agttaccagtcacacaatagtcacgctcacaggcaagacaaaacctagagtttgcagatt 300
           ||||||||||||||||||| |||||||||||||||||| || |||||||||||||||| |
Sbjct: 359 agttaccagtcacacaataatcacgctcacaggcaagagaagacctagagtttgcagagt 300

                                                                       
Query: 301 cttcttcaaaaggaaatgctgtgctcaacaaatgcattatgccaactgagctcccacgct 360
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 299 cttcttcaaaaggaaatgctgtgctcaacaaatgcattatgccaactgagctcccaagct 240

                                                  
Query: 361 gggacagaagctggggaggccatttttctaatccacggg 399
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 239 gggacagaagctggggaggccatttttctaatccacggg 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 399
Length of database: 799
Length adjustment: 9
Effective length of query: 390
Effective length of database: 790
Effective search space:   308100
Effective search space used:   308100
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information