MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-050H20
Chromosome	11 (Build37)
Map Location	70,316,916 - 70,317,585
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Dnahc2, Efnb3, Wdr79, LOC100043030, Trp53, Atp1b2, Shbg, Sat2, LOC382532, Fxr2, Sox15, Mpdu1, Cd68, Eif4a1, Senp3, Tnfsf12-tnfsf13, Tnfsf13, Tnfsf12, LOC100041994, Polr2a, Amac1, Zbtb4, Chrnb1, Fgf11, Tmem102, 4933402P03Rik, 1700095G12Rik, Nlgn2, 1810027O10Rik, Plscr3, Tnk1, LOC432576, Kctd11, Centb1, 2810408A11Rik, 0610025P10Rik, Gps2, Eif5a, Ybx2, Slc2a4, LOC668442, Cldn7, Rai12, Dullard, Gabarap, Phf23, Dvl2, Acadvl, Dlg4, Asgr1, Asgr2, Mgl2, Mgl1, Slc16a11, Slc16a13, Bcl6b, 0610010K14Rik, D11Bwg0434e, Alox12, Alox12e, Alox15, LOC668466, Pelp1, Arrb2, Med11, Cxcl16, Zmynd15
Downstream gene	Tm4sf5, Vmo1, C730027E14Rik, Psmb6, Pld2, Mink1, Chrne, LOC668433, Gp1ba, Slc25a11, Rnf167, Pfn1, Eno3, Spag7, Camta2, AI842396, Kif1c, LOC668488, Zfp3, A430084P05Rik, Rabep1, LOC668461, Nup88, Rpain, C1qbp, Dhx33, Derl2, Mis12, 6330403K07Rik, LOC382536, Nlrp1a, Nlrp1b, Nlrp1c, LOC100043249
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dnahc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327954 MGI:107731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13643 MGI:109196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216853 MGI:2384933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 241 ESTs

name	Trp53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22059 MGI:98834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11932 MGI:88109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shbg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20415 MGI:98295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69215 MGI:1916465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Fxr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23879 MGI:1346074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20670 MGI:98363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpdu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24070 MGI:1346040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12514 MGI:88342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13681 MGI:95303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Senp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80886 MGI:2158736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf12-tnfsf13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tnfsf13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69583 MGI:1916833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21944 MGI:1196259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Polr2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20020 MGI:98086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56293 MGI:1927128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75580 MGI:1922830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11443 MGI:87890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14166 MGI:109167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380705 MGI:1921591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933402P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108803 MGI:1918293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700095G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74288 MGI:1921538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlgn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216856 MGI:2681835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810027O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69186 MGI:1916436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plscr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70310 MGI:1917560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83813 MGI:1930958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Kctd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216858 MGI:2448712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216859 MGI:2388270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810408A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70419 MGI:1917669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610025P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216860 MGI:1921092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56310 MGI:1891751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276770 MGI:106248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ybx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53422 MGI:1096372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20528 MGI:95758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cldn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53624 MGI:1859285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rai12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54351 MGI:1859017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dullard (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67181 MGI:1914431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabarap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56486 MGI:1861742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78246 MGI:1925496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dvl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13543 MGI:106613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acadvl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11370 MGI:895149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13385 MGI:1277959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asgr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11889 MGI:88081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asgr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11890 MGI:88082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216864 MGI:2385729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17312 MGI:96975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216867 MGI:2663709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69309 MGI:1916559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12029 MGI:1278332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104457 MGI:1915609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Bwg0434e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52898 MGI:106369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11684 MGI:87998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11685 MGI:1274790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11687 MGI:87997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 8 Proteins pseudo : _no_value

name	Pelp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75273 MGI:1922523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216869 MGI:99474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66172 MGI:1913422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxcl16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66102 MGI:1932682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574428 MGI:3603821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm4sf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75604 MGI:1922854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327956 MGI:2685587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730027E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216871 MGI:2444527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19175 MGI:104880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pld2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18806 MGI:892877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mink1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Chrne (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11448 MGI:87894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gp1ba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14723 MGI:1333744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67863 MGI:1915113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70510 MGI:1917760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18643 MGI:97549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eno3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13808 MGI:95395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spag7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216873 MGI:107380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camta2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216874 MGI:2135957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI842396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103844 MGI:2144284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16562 MGI:1098260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Zfp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193043 MGI:99177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A430084P05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327957 MGI:3610314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54189 MGI:1860236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 4 Proteins pseudo : _no_value

name	Nup88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpain (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69723 MGI:1916973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12261 MGI:1194505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216877 MGI:2445102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Derl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116891 MGI:2151483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mis12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67139 MGI:1914389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330403K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103712 MGI:1918001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382536
definition	note : RNA binding motif protein 7 pseudogene pseudo : _no_value

name	Nlrp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195046 MGI:2684861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637515 MGI:3582959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627984 MGI:3582962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein pseudo : _no_value

name	Dnahc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486772 GeneID:327954 MGI:107731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, heavy chain 2 transcript_id : NM_001081330.1

name	Efnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367810 GeneID:13643 MGI:109196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin B3 transcript_id : NM_007911.4

name	Wdr79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130039 GeneID:216853 MGI:2384933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 79 transcript_id : NM_144824.2

name	LOC100043030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261974 GeneID:100043030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 241 ESTs product : similar to ribosomal protein S27 (metallopanstimulin 1) transcript_id : XM_001479913.1

name	Trp53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755880 GeneID:22059 MGI:98834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 transcript_id : NM_011640.1

name	Atp1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802992 GeneID:11932 MGI:88109
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, beta 2 polypeptide transcript_id : NM_013415.4

name	Shbg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755505 GeneID:20415 MGI:98295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sex hormone binding globulin transcript_id : NM_011367.1

name	Sat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362782 GeneID:69215 MGI:1916465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermidine/spermine N1-acetyl transferase 2 transcript_id : NM_026991.2

name	Fxr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921588 GeneID:23879 MGI:1346074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation, autosomal homolog 2 transcript_id : NM_011814.2

name	Sox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094090 GeneID:20670 MGI:98363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 15 transcript_id : NM_009235.1

name	Mpdu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347827 GeneID:24070 MGI:1346040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose-P-dolichol utilization defect 1 transcript_id : NM_011900.3

name	Cd68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753351 GeneID:12514 MGI:88342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD68 antigen transcript_id : NM_009853.1

name	Eif4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366509 GeneID:13681 MGI:95303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A1 transcript_id : NM_144958.3

name	Senp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802397 GeneID:80886 MGI:2158736
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO/sentrin specific peptidase 3 transcript_id : NM_030702.3

name	Tnfsf12-tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:77628046 GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12-member 13 transcript_id : NM_001034098.1

name	Tnfsf12-tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:77539771 GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12-member 13 transcript_id : NM_001034097.1

name	Tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77627742 GeneID:69583 MGI:1916833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 13 transcript_id : NM_023517.2

name	Tnfsf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33438583 GeneID:21944 MGI:1196259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12 transcript_id : NM_011614.1

name	Polr2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130551 GeneID:20020 MGI:98086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide A transcript_id : NM_009089.2

name	Amac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145472 GeneID:56293 MGI:1927128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-malonyl condensing enzyme 1 transcript_id : NM_019871.2

name	Zbtb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626059 GeneID:75580 MGI:1922830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 4 transcript_id : NM_029348.1

name	Chrnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981911 GeneID:11443 MGI:87890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) transcript_id : NM_009601.3

name	Fgf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753843 GeneID:14166 MGI:109167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 11 transcript_id : NM_010198.1

name	Tmem102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360242 GeneID:380705 MGI:1921591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 102 transcript_id : NM_001033433.2

name	4933402P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30425069 GeneID:108803 MGI:1918293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933402P03 gene transcript_id : NM_175368.1

name	1700095G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227236 GeneID:74288 MGI:1921538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700095G12 gene transcript_id : NM_028855.1

name	Nlgn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699424 GeneID:216856 MGI:2681835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroligin 2 transcript_id : NM_198862.2

name	1810027O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625729 GeneID:69186 MGI:1916436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810027O10 gene transcript_id : NM_026982.1

name	Plscr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803011 GeneID:70310 MGI:1917560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipid scramblase 3 transcript_id : NM_023564.3

name	Tnk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560012 GeneID:83813 MGI:1930958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase, non-receptor, 1 transcript_id : NM_031880.2

name	LOC432576 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390188 GeneID:432576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to TMEM95 protein transcript_id : XM_484042.3

name	Kctd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353128 GeneID:216858 MGI:2448712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 11 transcript_id : NM_153143.3

name	Centb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130064 GeneID:216859 MGI:2388270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, beta 1 transcript_id : NM_153788.3

name	2810408A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130354 GeneID:70419 MGI:1917669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810408A11 gene transcript_id : NM_027419.3

name	0610025P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61740636 GeneID:216860 MGI:1921092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610025P10 gene transcript_id : NM_001013414.1

name	Gps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130652 GeneID:56310 MGI:1891751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein pathway suppressor 2 transcript_id : NM_019726.3

name	Eif5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380083 GeneID:276770 MGI:106248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 5A transcript_id : NM_181582.3

name	Ybx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956376 GeneID:53422 MGI:1096372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Y box protein 2 transcript_id : NM_016875.2

name	Slc2a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026924 GeneID:20528 MGI:95758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 4 transcript_id : NM_009204.2

name	Cldn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801880 GeneID:53624 MGI:1859285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 7 transcript_id : NM_016887.3

name	Rai12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055319 GeneID:54351 MGI:1859017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid induced 12 transcript_id : NM_018740.1

name	Dullard (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129887 GeneID:67181 MGI:1914431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dullard homolog (Xenopus laevis) transcript_id : NM_026017.2

name	Gabarap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254379 GeneID:56486 MGI:1861742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid receptor associated protein transcript_id : NM_019749.3

name	Phf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364931 GeneID:78246 MGI:1925496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 23 transcript_id : NM_030064.2

name	Dvl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299587 GeneID:13543 MGI:106613
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dishevelled 2, dsh homolog (Drosophila) transcript_id : NM_007888.3

name	Acadvl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892573 GeneID:11370 MGI:895149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase, very long chain transcript_id : NM_017366.2

name	Dlg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803376 GeneID:13385 MGI:1277959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog 4 (Drosophila) transcript_id : NM_007864.2

name	Asgr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256508 GeneID:11889 MGI:88081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asialoglycoprotein receptor 1 transcript_id : NM_009714.2

name	Asgr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131075 GeneID:11890 MGI:88082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asialoglycoprotein receptor 2 transcript_id : NM_007493.3

name	Mgl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311550 GeneID:216864 MGI:2385729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage galactose N-acetyl-galactosamine specific lectin 2 transcript_id : NM_145137.2

name	Mgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130155 GeneID:17312 MGI:96975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage galactose N-acetyl-galactosamine specific lectin 1 transcript_id : NM_010796.2

name	Slc16a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347517 GeneID:216867 MGI:2663709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 11 transcript_id : NM_153081.2

name	Slc16a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803333 GeneID:69309 MGI:1916559
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 13 transcript_id : NM_172371.2

name	Bcl6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891681 GeneID:12029 MGI:1278332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 6, member B transcript_id : NM_007528.2

name	0610010K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21389317 GeneID:104457 MGI:1915609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010K14 gene transcript_id : NM_026757.1

name	D11Bwg0434e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349970 GeneID:52898 MGI:106369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0434 expressed transcript_id : NM_173742.2

name	Alox12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802272 GeneID:11684 MGI:87998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 12-lipoxygenase transcript_id : NM_007440.3

name	Alox12e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729794 GeneID:11685 MGI:1274790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate lipoxygenase, epidermal transcript_id : NM_145684.1

name	Alox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948632 GeneID:11687 MGI:87997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 15-lipoxygenase transcript_id : NM_009660.3

name	Pelp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345821 GeneID:75273 MGI:1922523
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline, glutamic acid and leucine rich protein 1 transcript_id : NM_029231.3

name	Arrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801978 GeneID:216869 MGI:99474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin, beta 2 transcript_id : NM_145429.3

name	Med11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754137 GeneID:66172 MGI:1913422
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 11 homolog (S. cerevisiae) transcript_id : NM_025397.2

name	Cxcl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802996 GeneID:66102 MGI:1932682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 16 transcript_id : NM_023158.6

name	Zmynd15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365130 GeneID:574428 MGI:3603821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYND-type containing 15 transcript_id : NM_001029929.2

name	Tm4sf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802651 GeneID:75604 MGI:1922854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 4 superfamily member 5 transcript_id : NM_029360.2

name	Vmo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888887 GeneID:327956 MGI:2685587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitelline membrane outer layer 1 homolog (chicken) transcript_id : NM_001013607.1

name	C730027E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122496 GeneID:216871 MGI:2444527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730027E14 gene transcript_id : NM_146020.1

name	Psmb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803367 GeneID:19175 MGI:104880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 6 transcript_id : NM_008946.3

name	Pld2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130632 GeneID:18806 MGI:892877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D2 transcript_id : NM_008876.2

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052103 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_001045964.1

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052521 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_001045959.1

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052415 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_176893.2

name	Mink1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052441 GeneID:50932 MGI:1355329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : misshapen-like kinase 1 (zebrafish) transcript_id : NM_016713.2

name	Chrne (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752949 GeneID:11448 MGI:87894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, epsilon polypeptide transcript_id : NM_009603.1

name	LOC668433 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390186 GeneID:668433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC668433 transcript_id : XM_001004767.1

name	Gp1ba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754037 GeneID:14723 MGI:1333744
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein 1b, alpha polypeptide transcript_id : NM_010326.1

name	Slc25a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980956 GeneID:67863 MGI:1915113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11 transcript_id : NM_024211.2

name	Rnf167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076962 GeneID:70510 MGI:1917760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 167 transcript_id : NM_027445.1

name	Pfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803120 GeneID:18643 MGI:97549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : profilin 1 transcript_id : NM_011072.3

name	Eno3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982848 GeneID:13808 MGI:95395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enolase 3, beta muscle transcript_id : NM_007933.2

name	Spag7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388082 GeneID:216873 MGI:107380
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 7 transcript_id : NM_172561.2

name	Camta2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130545 GeneID:216874 MGI:2135957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin binding transcription activator 2 transcript_id : NM_178116.3

name	AI842396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523978 GeneID:103844 MGI:2144284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI842396 transcript_id : NM_213729.1

name	Kif1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23821039 GeneID:16562 MGI:1098260
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1C transcript_id : NM_153103.1

name	LOC668488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390191 GeneID:668488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC668488 transcript_id : XM_001001755.1

name	Zfp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83423531 GeneID:193043 MGI:99177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 3 transcript_id : NM_177565.3

name	A430084P05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382084 GeneID:327957 MGI:3610314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430084P05 gene transcript_id : NM_001045526.2

name	Rabep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507020 GeneID:54189 MGI:1860236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabaptin, RAB GTPase binding effector protein 1 transcript_id : NM_019400.1

name	Nup88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955408 GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 88 transcript_id : NM_172394.2

name	Nup88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053893 GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 88 transcript_id : NM_001083331.1

name	Rpain (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037172 GeneID:69723 MGI:1916973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RPA interacting protein transcript_id : NM_027186.1

name	C1qbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181166 GeneID:12261 MGI:1194505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent binding protein transcript_id : NM_007573.2

name	Dhx33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109637749 GeneID:216877 MGI:2445102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 33 transcript_id : NM_178367.4

name	Derl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130773 GeneID:116891 MGI:2151483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Der1-like domain family, member 2 transcript_id : NM_033562.3

name	Mis12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356584 GeneID:67139 MGI:1914389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MIS12 homolog (yeast) transcript_id : NM_025993.2

name	6330403K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21624634 GeneID:103712 MGI:1918001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330403K07 gene transcript_id : NM_134022.1

name	Nlrp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921280 GeneID:195046 MGI:2684861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1A transcript_id : NM_001004142.1

name	Nlrp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665739 GeneID:637515 MGI:3582959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1B transcript_id : NM_001040696.1

name	Nlrp1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986636 GeneID:627984 MGI:3582962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1C transcript_id : NM_001039234.1

name	Dnahc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486773 GeneID:327954 MGI:107731
definition	codon_start : 1 note : dynein heavy chain domain 3; dynein, axon, heavy chain 2; region surrounding P-loop 1; axonemal dynein heavy chain product : dynein, axonemal, heavy chain 2 protein_id : NP_001074799.1

name	Efnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681281 CCDS:CCDS24896.1 GeneID:13643 MGI:109196
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007628 - adult walking behavior [Evidence IMP]; GO:0016198 - axon choice point recognition [Evidence IMP]; GO:0007411 - axon guidance [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : ephrin B3 protein_id : NP_031937.1

name	Wdr79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450205 CCDS:CCDS24897.1 GeneID:216853 MGI:2384933
definition	codon_start : 1 product : WD repeat domain 79 protein_id : NP_659073.1

name	LOC100043030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261975 GeneID:100043030
definition	codon_start : 1 product : similar to ribosomal protein S27 (metallopanstimulin 1) protein_id : XP_001479963.1

name	Trp53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755881 GeneID:22059 MGI:98834
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] [Evidence IGI]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030330 - DNA damage response, signal transduction by p53 class mediator [Evidence IDA] [Evidence IGI]; GO:0042771 - DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis [Evidence ISS] [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0009792 - embryonic development (sensu Metazoa) [Evidence IGI]; GO:0031571 - G1 DNA damage checkpoint [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008156 - negative regulation of DNA replication [Evidence IMP] [Evidence IDA]; GO:0048147 - negative regulation of fibroblast proliferation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI] [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0000060 - protein import into nucleus, translocation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] [Evidence IDA]; GO:0009411 - response to UV [Evidence IMP]; GO:0010165 - response to X-ray [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : p53 cellular tumor antigen; p53 tumor suppressor; tumor supressor p53 product : transformation related protein 53 protein_id : NP_035770.1

name	Atp1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242138 CCDS:CCDS24898.1 GeneID:11932 MGI:88109
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : snoRNA MBI-85 product : Na+/K+ -ATPase beta 2 subunit protein_id : NP_038201.1

name	Shbg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755506 CCDS:CCDS24899.1 GeneID:20415 MGI:98295
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 product : sex hormone binding globulin protein_id : NP_035497.1

name	Sat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249210 GeneID:69215 MGI:1916465
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004145 - diamine N-acetyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008216 - spermidine metabolism [Evidence ISS]; GO:0008215 - spermine metabolism [Evidence ISS] codon_start : 1 product : spermidine/spermine N1-acetyl transferase 2 protein_id : NP_081267.1

name	Fxr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921589 CCDS:CCDS24901.1 GeneID:23879 MGI:1346074
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : fragile X mental retardation gene 2, autosomal homolog product : fragile X mental retardation-related protein 2 protein_id : NP_035944.2

name	Sox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094091 CCDS:CCDS24902.1 GeneID:20670 MGI:98363
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IGI] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IGI] [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IGI]; GO:0048627 - myoblast development [Evidence IMP]; GO:0045843 - negative regulation of striated muscle development [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0043403 - skeletal muscle regeneration [Evidence IMP] codon_start : 1 product : SRY-box 15 protein_id : NP_033261.1

name	Mpdu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981340 CCDS:CCDS24903.1 GeneID:24070 MGI:1346040
definition	codon_start : 1 note : suppressor of Lec15 homolog (C.griseus) product : mannose-P-dolichol utilization defect 1 protein_id : NP_036030.2

name	Cd68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753352 GeneID:12514 MGI:88342
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 note : macrosialin product : CD68 antigen protein_id : NP_033983.1

name	Eif4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450625 CCDS:CCDS24904.1 GeneID:13681 MGI:95303
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : initiation factor eIF-4A long form product : eukaryotic translation initiation factor 4A1 protein_id : NP_659207.1

name	Senp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981408 CCDS:CCDS24905.1 GeneID:80886 MGI:2158736
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0019538 - protein metabolism [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sentrin/SUMO-specific protease; SUMO/sentrin specific protease 3 product : smt3-specific isopeptidase 1 protein_id : NP_109627.2

name	Tnfsf12-tnfsf13 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:77628047 GeneID:619441
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : tumor necrosis factor (ligand) superfamily, member 12-member 13 isoform b protein_id : NP_001029270.1

name	Tnfsf12-tnfsf13 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:77539772 CCDS:CCDS24906.1 GeneID:619441
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : tumor necrosis factor (ligand) superfamily, member 12-member 13 isoform a protein_id : NP_001029269.1

name	Tnfsf13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77627743 GeneID:69583 MGI:1916833
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0048298 - positive regulation of isotype switching to IgA isotypes [Evidence ISS] [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP] codon_start : 1 note : tumor necrosis factor (ligand) superfamily, member 12 product : tumor necrosis factor (ligand) superfamily, member 13 protein_id : NP_076006.2

name	Tnfsf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33438584 CCDS:CCDS24907.1 GeneID:21944 MGI:1196259
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0008219 - cell death [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : tumor necrosis factor (ligand) superfamily, member 12 protein_id : NP_035744.1

name	Polr2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677795 GeneID:20020 MGI:98086
definition	GO_component : GO:0005665 - DNA-directed RNA polymerase II, core complex [Evidence IEA]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IEA] [Evidence ISS] codon_start : 1 note : RNA polymerase II 1 product : polymerase (RNA) II (DNA directed) polypeptide A protein_id : NP_033115.1

name	Amac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145473 CCDS:CCDS24908.1 GeneID:56293 MGI:1927128
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : testicular condensing enzyme product : acyl-malonyl condensing enzyme 1 protein_id : NP_063924.2

name	Zbtb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626060 GeneID:75580 MGI:1922830
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger and BTB domain containing 4 protein_id : NP_083624.1

name	Chrnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981912 CCDS:CCDS24910.1 GeneID:11443 MGI:87890
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : acetylcholine receptor beta product : cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) protein_id : NP_033731.2

name	Fgf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753844 CCDS:CCDS24911.1 GeneID:14166 MGI:109167
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : fibroblast growth factor 11 protein_id : NP_034328.1

name	Tmem102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701935 GeneID:380705 MGI:1921591
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC380705 protein_id : NP_001028605.1

name	4933402P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425070 CCDS:CCDS24912.1 GeneID:108803 MGI:1918293
definition	codon_start : 1 product : hypothetical protein LOC108803 protein_id : NP_780577.1

name	1700095G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144227237 GeneID:74288 MGI:1921538
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA] codon_start : 1 product : spermatid maturation 1 protein_id : NP_083131.1

name	Nlgn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699425 CCDS:CCDS24914.1 GeneID:216856 MGI:2681835
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence ISS] codon_start : 1 note : ortholog of human and rat neuroligin 2 NLGN2 product : neuroligin 2 protein_id : NP_942562.2

name	1810027O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625730 CCDS:CCDS24915.1 GeneID:69186 MGI:1916436
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 product : hypothetical protein LOC69186 protein_id : NP_081258.1

name	Plscr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963735 CCDS:CCDS24916.1 GeneID:70310 MGI:1917560
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP] codon_start : 1 product : phospholipid scramblase 3 protein_id : NP_076053.1

name	Tnk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560013 CCDS:CCDS24917.1 GeneID:83813 MGI:1930958
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004715 - non-membrane spanning protein tyrosine kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence IMP]; GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : non-receptor tyrosine kinase product : tyrosine kinase, non-receptor, 1 protein_id : NP_114086.2

name	LOC432576 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390189 GeneID:432576
definition	codon_start : 1 product : similar to TMEM95 protein protein_id : XP_484042.3

name	Kctd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346589 CCDS:CCDS24918.1 GeneID:216858 MGI:2448712
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0007399 - nervous system development [Evidence IDA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IDA] codon_start : 1 product : retinoic acid, EGF, and NGF upregulated protein_id : NP_694783.1

name	Centb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27881415 CCDS:CCDS24919.1 GeneID:216859 MGI:2388270
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004629 - phospholipase C activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : centaurin, beta 1 protein_id : NP_722483.2

name	2810408A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271515 CCDS:CCDS24920.1 GeneID:70419 MGI:1917669
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] GO_process : GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70419 protein_id : NP_081695.2

name	0610025P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61740637 CCDS:CCDS24921.1 GeneID:216860 MGI:1921092
definition	codon_start : 1 product : hypothetical protein LOC216860 protein_id : NP_001013432.1

name	Gps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980980 CCDS:CCDS24922.1 GeneID:56310 MGI:1891751
definition	codon_start : 1 product : G protein pathway suppressor 2 protein_id : NP_062700.2

name	Eif5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712036 CCDS:CCDS24923.1 GeneID:276770 MGI:106248
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 5A protein_id : NP_853613.1

name	Ybx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956377 GeneID:53422 MGI:1096372
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA]; GO:0045285 - ubiquinol-cytochrome-c reductase complex [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IDA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0045182 - translation regulator activity [Evidence IDA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0016478 - negative regulation of translation [Evidence IDA]; GO:0048157 - oogenesis (sensu Mammalia) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007286 - spermatid development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Y-box protein MSY2 product : Y box protein 2 protein_id : NP_058571.2

name	Slc2a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026925 GeneID:20528 MGI:95758
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence TAS] [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0000299 - integral to membrane of membrane fraction [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0048471 - perinuclear region [Evidence ISS] [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0012506 - vesicle membrane [Evidence ISS] GO_function : GO:0005355 - glucose transporter activity [Evidence TAS] [Evidence IDA]; GO:0005360 - insulin-responsive hydrogen:glucose transporter activity [Evidence TAS]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0042593 - glucose homeostasis [Evidence ISS]; GO:0015758 - glucose transport [Evidence TAS] [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 2 (facilitated glucose transporter), member 4 protein_id : NP_033230.2

name	Cldn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393144 CCDS:CCDS24925.1 GeneID:53624 MGI:1859285
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : claudin-7 product : claudin 7 protein_id : NP_058583.1

name	Rai12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055320 CCDS:CCDS24926.1 GeneID:54351 MGI:1859017
definition	codon_start : 1 exception : mismatches in translation note : Clone 13u product : S-phase 2 protein protein_id : NP_061210.1

name	Dullard (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956160 CCDS:CCDS24927.1 GeneID:67181 MGI:1914431
definition	GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Dullard homolog protein_id : NP_080293.1

name	Gabarap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789961 CCDS:CCDS24928.1 GeneID:56486 MGI:1861742
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IDA]; GO:0005790 - smooth endoplasmic reticulum [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GABA-A receptor-associated protein; gamma-aminobutyric acid reseptor associated protein product : gamma-aminobutyric acid receptor associated protein protein_id : NP_062723.1

name	Phf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313418 CCDS:CCDS24929.1 GeneID:78246 MGI:1925496
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PHD zinc finger containing protein JUNE1; novel PHD-finger protein JUNE1 product : PHD finger protein 23 protein_id : NP_084340.1

name	Dvl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299588 CCDS:CCDS24930.1 GeneID:13543 MGI:106613
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IMP]; GO:0007379 - segment specification [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence TAS] [Evidence IDA] codon_start : 1 note : dishevelled 2, dsh homolog (Drosophila) (MGD\|MGI:106613 GB\|NM_007888, evidence: BLASTN, 99%, match=2936); putative product : dishevelled 2, dsh homolog protein_id : NP_031914.3

name	Acadvl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956084 CCDS:CCDS24931.1 GeneID:11370 MGI:895149
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A dehydrogenase, very long chain protein_id : NP_059062.1

name	Dlg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681195 GeneID:13385 MGI:1277959
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence NAS]; GO:0031234 - extrinsic to internal side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence IDA] [Evidence ISS]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0042043 - neurexin binding [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0008022 - protein C-terminus binding [Evidence NAS]; GO:0005102 - receptor binding [Evidence NAS]; GO:0005198 - structural molecule activity [Evidence NAS] GO_process : GO:0007626 - locomotory behavior [Evidence NAS]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IGI]; GO:0042220 - response to cocaine [Evidence NAS]; GO:0016188 - synaptic vesicle maturation [Evidence IGI] [Evidence IDA]; GO:0007416 - synaptogenesis [Evidence NAS] codon_start : 1 function : guanylate kinase note : discs large homolog 4; synapse-associated protein 90; PSD-95 alpha; PSD-95 beta; PSD-95 alpha 2b product : postsynaptic density protein 95 protein_id : NP_031890.1

name	Asgr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753126 CCDS:CCDS24933.1 GeneID:11889 MGI:88081
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : asialoglycoprotein receptor 1 protein_id : NP_033844.1

name	Asgr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680734 CCDS:CCDS24934.1 GeneID:11890 MGI:88082
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : asialoglycoprotein receptor 2 protein_id : NP_031519.1

name	Mgl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553093 CCDS:CCDS24935.1 GeneID:216864 MGI:2385729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030246 - carbohydrate binding [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : macrophage galactose-type C-type lectin 2 product : macrophage galactose N-acetyl-galactosamine specific lectin 2 protein_id : NP_660119.1

name	Mgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754688 CCDS:CCDS24936.1 GeneID:17312 MGI:96975
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : macrophage galactose N-acetyl-galactosamine specific lectin 1 protein_id : NP_034926.1

name	Slc16a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346495 GeneID:216867 MGI:2663709
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel RNA polymerase Rpb1 C-terminal repeat domain containing protein product : solute carrier family 16, member 11 protein_id : NP_694721.1

name	Slc16a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336097 CCDS:CCDS24938.1 GeneID:69309 MGI:1916559
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 16 (monocarboxylic acid transporters), member 13 protein_id : NP_758959.1

name	Bcl6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671616 CCDS:CCDS24939.1 GeneID:12029 MGI:1278332
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : BcL6-associated zinc finger protein product : B-cell CLL/lymphoma 6, member B protein_id : NP_031554.1

name	0610010K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21389318 CCDS:CCDS24940.1 GeneID:104457 MGI:1915609
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC104457 protein_id : NP_081033.1

name	D11Bwg0434e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239393 GeneID:52898 MGI:106369
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC52898 protein_id : NP_776103.1

name	Alox12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542127 CCDS:CCDS24942.1 GeneID:11684 MGI:87998
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence ISS] [Evidence IEA]; GO:0047977 - hepoxilin-epoxide hydrolase activity [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019870 - potassium channel inhibitor activity [Evidence ISS] GO_process : GO:0019369 - arachidonic acid metabolism [Evidence ISS]; GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA]; GO:0045794 - negative regulation of cell volume [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0042391 - regulation of membrane potential [Evidence ISS] codon_start : 1 product : arachidonate 12-lipoxygenase protein_id : NP_031466.2

name	Alox12e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729795 CCDS:CCDS24943.1 GeneID:11685 MGI:1274790
definition	GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA] codon_start : 1 product : arachidonate lipoxygenase, epidermal protein_id : NP_663717.1

name	Alox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948633 CCDS:CCDS24944.1 GeneID:11687 MGI:87997
definition	GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : arachidonate 15-lipoxygenase protein_id : NP_033790.3

name	Pelp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38230105 CCDS:CCDS24945.1 GeneID:75273 MGI:1922523
definition	codon_start : 1 exception : mismatches in translation product : proline-, glutamic acid-, leucine-rich protein 1 protein_id : NP_083507.2

name	Arrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703856 CCDS:CCDS24946.1 GeneID:216869 MGI:99474
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IGI] [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : beta arr2; beta-arrestin-2; beta-arrestin2 product : arrestin, beta 2 protein_id : NP_663404.1

name	Med11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754138 CCDS:CCDS24947.1 GeneID:66172 MGI:1913422
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 11 homolog protein_id : NP_079673.2

name	Cxcl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745124 CCDS:CCDS24948.1 GeneID:66102 MGI:1932682
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA]; GO:0005044 - scavenger receptor activity [Evidence IDA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : Cxc chemokine ligand 16; SR-PSOX/CXCL16; Scavenger Receptor; zinc finger, MYND-type containing 15 product : chemokine (C-X-C motif) ligand 16 protein_id : NP_075647.3

name	Zmynd15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480094 CCDS:CCDS24949.1 GeneID:574428 MGI:3603821
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, MYND domain containing 15 protein_id : NP_001025100.1

name	Tm4sf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312990 CCDS:CCDS24950.1 GeneID:75604 MGI:1922854
definition	codon_start : 1 exception : mismatches in translation product : transmembrane 4 superfamily member 5 protein_id : NP_083636.1

name	Vmo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888888 CCDS:CCDS24951.1 GeneID:327956 MGI:2685587
definition	codon_start : 1 product : vitelline membrane outer layer 1 homolog protein_id : NP_001013625.1

name	C730027E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122497 CCDS:CCDS24952.1 GeneID:216871 MGI:2444527
definition	codon_start : 1 product : hypothetical protein LOC216871 protein_id : NP_666132.1

name	Psmb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982099 GeneID:19175 MGI:104880
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : subunit 2 product : proteasome (prosome, macropain) subunit, beta type 6 protein_id : NP_032972.2

name	Pld2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679379 CCDS:CCDS24953.1 GeneID:18806 MGI:892877
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0004630 - phospholipase D activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0002031 - G-protein coupled receptor internalization [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence IDA] codon_start : 1 product : phospholipase D2 protein_id : NP_032902.1

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052104 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 4 protein_id : NP_001039429.1

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052522 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 3 protein_id : NP_001039424.1

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052416 CCDS:CCDS24955.1 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 2 protein_id : NP_795712.2

name	Mink1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052442 CCDS:CCDS24954.1 GeneID:50932 MGI:1355329
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; GCK family kinase; Yeast Sps1/Ste20-related kinase 2; Misshapen/NIKs-related kinase; mitogen-activated protein kinase kinase kinase kinase 6; mitogen-activated protein kinase kinase kinase kinase 6 (Map4k6-pending) product : misshapen-like kinase 1 isoform 1 protein_id : NP_057922.2

name	Chrne (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752950 CCDS:CCDS24956.1 GeneID:11448 MGI:87894
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor epsilon; AChrepsilon; AchR epsilon subunit; acetylcholine receptor epsilon subunit product : cholinergic receptor, nicotinic, epsilon polypeptide protein_id : NP_033733.1

name	LOC668433 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390187 GeneID:668433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004767.1

name	Gp1ba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754038 CCDS:CCDS24957.1 GeneID:14723 MGI:1333744
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0000902 - cell morphogenesis [Evidence IMP]; GO:0007599 - hemostasis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : glycoprotein 1b, alpha polypeptide protein_id : NP_034456.1

name	Slc25a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312994 CCDS:CCDS24958.1 GeneID:67863 MGI:1915113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 product : solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11 protein_id : NP_077173.1

name	Rnf167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076963 CCDS:CCDS24959.1 GeneID:70510 MGI:1917760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : novel PA domain and C3HC4 type zinc finger (RING finger) containing protein product : ring finger protein 167 protein_id : NP_081721.1

name	Pfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755040 CCDS:CCDS24960.1 GeneID:18643 MGI:97549
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IGI]; GO:0008064 - regulation of actin polymerization and/or depolymerization [Evidence TAS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0042989 - sequestering of actin monomers [Evidence TAS] codon_start : 1 note : actin binding protein product : profilin 1 protein_id : NP_035202.1

name	Eno3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679651 CCDS:CCDS24961.1 GeneID:13808 MGI:95395
definition	GO_component : GO:0000015 - phosphopyruvate hydratase complex [Evidence IEA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004634 - phosphopyruvate hydratase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : enolase 3, beta muscle protein_id : NP_031959.1

name	Spag7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369786 CCDS:CCDS24962.1 GeneID:216873 MGI:107380
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sperm associated antigen 7 protein_id : NP_766149.1

name	Camta2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017453 CCDS:CCDS24963.1 GeneID:216874 MGI:2135957
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : calmodulin binding transcription activator 2 protein_id : NP_835217.1

name	AI842396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523979 CCDS:CCDS24964.1 GeneID:103844 MGI:2144284
definition	codon_start : 1 product : inhibitor of CDK interacting with cyclin A1 protein_id : NP_998894.1

name	Kif1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821040 CCDS:CCDS24965.1 GeneID:16562 MGI:1098260
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence IDA] codon_start : 1 exception : mismatches in translation note : kinesin superfamily protein 1C; kinesin 1C; lethal factor toxin susceptibility 1; N-3 kinsin product : kinesin family member 1C protein_id : NP_694743.1

name	LOC668488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390192 GeneID:668488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001755.1

name	Zfp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243904 CCDS:CCDS24966.1 GeneID:193043 MGI:99177
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 3 protein_id : NP_808233.1

name	A430084P05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865879 CCDS:CCDS24967.1 GeneID:327957 MGI:3610314
definition	codon_start : 1 product : hypothetical protein LOC327957 protein_id : NP_001038991.1

name	Rabep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507021 CCDS:CCDS24968.1 GeneID:54189 MGI:1860236
definition	GO_component : GO:0005768 - endosome [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : rabaptin 5; neurocrescin; RAB5 effector protein product : rabaptin, RAB GTPase binding effector protein 1 protein_id : NP_062273.1

name	Nup88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955409 GeneID:19069 MGI:104900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; preimplantation protein 2; nucleoporin 88kDa product : nucleoporin 88 isoform 1 protein_id : NP_765982.2

name	Nup88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053894 GeneID:19069 MGI:104900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; preimplantation protein 2; nucleoporin 88kDa product : nucleoporin 88 isoform 2 protein_id : NP_001076800.1

name	Rpain (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037173 CCDS:CCDS24969.1 GeneID:69723 MGI:1916973
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : RPA interacting protein delta 2; RPA interacting protein epsilon product : RPA interacting protein protein_id : NP_081462.1

name	C1qbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181167 CCDS:CCDS24970.1 GeneID:12261 MGI:1194505
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006956 - complement activation [Evidence IEA] codon_start : 1 product : complement component 1, q subcomponent binding protein protein_id : NP_031599.2

name	Dhx33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560585 CCDS:CCDS24971.1 GeneID:216877 MGI:2445102
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33 product : DEAH (Asp-Glu-Ala-His) box polypeptide 33 protein_id : NP_848144.3

name	Derl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15808990 CCDS:CCDS24972.1 GeneID:116891 MGI:2151483
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0030307 - positive regulation of cell growth [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0030970 - retrograde protein transport, ER to cytosol [Evidence ISS]; GO:0030968 - unfolded protein response [Evidence ISS] codon_start : 1 note : derlin 2; carcinoma related product : Der1-like domain family, member 2 protein_id : NP_291040.1

name	Mis12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313120 CCDS:CCDS24973.1 GeneID:67139 MGI:1914389
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA] [Evidence ISS]; GO:0000778 - condensed nuclear chromosome kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0051382 - kinetochore assembly [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : MIS12 homolog protein_id : NP_080269.1

name	6330403K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624635 GeneID:103712 MGI:1918001
definition	codon_start : 1 product : hypothetical protein LOC103712 protein_id : NP_598783.1

name	Nlrp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921281 GeneID:195046 MGI:2684861
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006919 - caspase activation [Evidence ISS]; GO:0008219 - cell death [Evidence IDA]; GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0051402 - neuron apoptosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : death effector filament-forming Ced-4-like apoptosis protein; NACHT/LRR/pyrin domain-containing protein 1; caspase recruitment domain protein; NACHT, LRR and PYD containing protein 1; NLR family, pyrin domain containing 1 product : NACHT, leucine rich repeat and PYD containing 1 protein_id : NP_001004142.1

name	Nlrp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665740 GeneID:637515 MGI:3582959
definition	codon_start : 1 product : NACHT-, LRR-, and PYD-containing protein 1 paralog b protein_id : NP_001035786.1

name	Nlrp1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986637 GeneID:627984 MGI:3582962
definition	codon_start : 1 product : NACHT-, LRR-, and PYD-containing 1 paralog c protein_id : NP_001034323.1

name	LOC382532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382532
definition	number : 1 pseudo : _no_value

name	LOC100041994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041994
definition	number : 2 pseudo : _no_value

name	LOC100041994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041994
definition	number : 1 pseudo : _no_value

name	LOC668442 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668442
definition	number : 1 pseudo : _no_value

name	LOC668466 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261976 GeneID:668466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 8 Proteins product : similar to Fgfr1op2 protein pseudo : _no_value transcript_id : XR_034580.1

name	LOC668461 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261977 GeneID:668461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 4 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034654.1

name	LOC100043249 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261978 GeneID:100043249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein product : hypothetical protein LOC100043249 pseudo : _no_value transcript_id : XR_034671.1

clone name	MSMg01-231I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-297L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098B04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490M13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-487O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512K03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520P01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-097L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-050H20.b	B6Ng01-050H20.g
ACC	DH874416	DH874417
length	1,280	331
definition	DH874416\|Mus musculus domesticus DNA, BAC clone: B6Ng01-050H20, 5' end.	DH874417\|Mus musculus domesticus DNA, BAC clone: B6Ng01-050H20, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccagagataagccaccacacctgaatttatgtattgtcagcaact gaacccagtttctgctgtttgcttgttggaactcagcctcctctttcagt tatgtttgcatcagctttctgttgttgatggtctccttcactgcgttggc ctccttgaactcattttcacaagttggaagccttgctgggtggggtcttg ctccctttactccatttagcactaggtttttctgtaaattttttatctcc ttgagcactggactcagctccatgacacttcttggtgctccttttctcct cacactgtacagcttgtacttctctttggccagcttgctctttttcatta cagagctgcagaaagtgattactaacaaccatctggcagtcagtgcgaag ctgttttaaaatcttctctgccaacgccattaatctaaaactcttcaatt tagcctgcagcagacttttaggacaagatcaaaaagcagccacatccccc cccccaatatcattagaatgctctatagatcatttgttaatattcttccc ctctgaaacatcttaagccaggcttacattgctctcagtactaccagctt ccaagcttctatcaggatggatcagtaagaatcaataagccatgcttaaa gtattcaactactttcccaatctaatgttcacactccatgaacaaacatt atggtcatacccgccacaatactctagtccctggtaccatgttggtactt ccagtgatgtgaaaagacactatgaccaagcaatttatataaaagaaagg atttaattgtggacttgcttacagttttaaaaggttagtccattatcatt tctgggagaaatggtggcaggcatctgctgaagatttctatattcctgat cctcaggcagcagaaagagaaagagaaaagactagacctggcatgtttta gtgaaatacctctccaacaagacataccccttaatccttcccaaacactt ccactaactgggaacaagtatgcaatatgaacaaatggaagccagactca ttccaaccagacggccagggctttgtgcacaaataggaatctgccactgg gccttatattcttgtcctctcaaagatggcaatggtcctctgtgaacaaa ggtatcaacaacacacttggaaaagcgacttggctgctgtcatgttataa catgaaatcggccaaactggatccaagaccgtaacagtatagagaggact tcatgtagagtaagtagaatacacggtgta	actttgtaaaccatgctggcctctaactcacagaaatctgcctgcttctg cctcctgagtgctgggattaaaggcatgcaccaccatgcacggcctagtt ctagaccttatttataatcatctctggaaataaaagaaattgaaattacc accccactcttatccaaaccaaacggggcaatatattatttccacttctt cctcttccctcttcctcttcctctcctcctcctcctcctccttcttcttt tttaaagacagtgtttctctgtatagccctggctgtcctggaacttactt tgtagaccaggctggcctcgaactcagaaat
quality values	Open. Hide. 61 43 27 38 61 61 38 21 40 61 47 21 18 55 47 47 61 43 49 61 49 49 61 49 55 55 18 27 17 13 19 33 31 27 23 23 59 52 59 61 59 59 59 59 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 44 61 61 61 61 61 59 59 52 43 36 44 45 49 61 61 59 59 61 61 61 59 49 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 53 53 61 53 42 52 61 61 61 61 61 61 61 61 61 61 47 61 52 61 52 61 61 61 57 57 57 57 57 57 57 57 42 53 52 53 53 53 47 53 47 57 53 57 53 53 57 45 57 57 52 57 53 57 57 53 53 41 47 47 57 57 40 42 50 53 53 52 53 57 57 57 57 53 57 57 57 57 53 53 53 53 53 47 38 50 42 57 53 38 27 45 46 53 57 52 42 39 52 50 57 50 45 45 28 47 39 57 50 53 53 53 50 50 45 52 45 45 53 42 52 38 31 50 45 57 52 39 45 27 50 46 38 52 53 50 45 39 38 37 24 8 34 37 42 52 46 31 38 42 31 30 42 42 33 33 57 17 23 40 29 53 39 33 57 19 19 43 28 37 53 36 39 39 42 57 38 40 34 37 37 38 38 24 47 44 42 40 42 36 57 31 44 57 39 28 48 34 37 29 31 42 37 25 12 34 44 29 42 35 37 41 32 34 24 34 36 45 22 30 15 53 33 20 29 44 37 35 30 30 37 27 40 22 37 22 33 57 40 34 36 40 24 40 26 30 34 25 37 29 40 29 37 40 28 39 57 33 25 40 40 31 37 21 30 18 30 46 21 39 34 30 22 26 32 25 48 30 30 24 27 29 40 29 28 34 27 30 25 46 46 31 24 35 24 14 29 32 29 35 29 29 25 31 14 31 20 29 24 29 31 46 33 28 26 8 34 30 47 46 26 8 19 39 29 26 29 29 31 51 31 24 18 25 30 38 25 29 22 28 21 22 36 31 13 8 28 23 27 12 29 41 51 46 11 7 43 46 29 26 31 18 27 24 26 21 20 38 14 27 29 25 14 14 19 21 46 29 18 27 28 51 32 23 12 14 43 14 14 22 26 7 20 31 17 28 14 38 15 22 30 23 18 11 13 34 13 12 6 7 14 5 12 9 13 22 23 12 6 7 23 33 19 20 33 20 21 28 13 10 12 8 15 29 16 15 12 16 11 7 21 8 5 6 12 10 12 44 19 21 29 12 31 36 41 33 12 29 15 31 12 6 20 10 28 25 19 28 10 17 18 13 6 30 41 23 33 17 14 14 12 5 6 15 19 25 22 24 36 19 16 17 9 10 17 14 19 21 28 38 9 23 15 15 30 32 19 13 28 16 24 13 16 16 33 27 22 38 15 19 38 19 18 11 27 19 28 22 21 12 23 17 23 28 17 15 25 38 23 24 8 6 9 29 19 7 8 9 15 10 32 22 9 13 12 27 18 19 16 9 6 5 4 4 6 23 25 12 18 30 5 7 17 5 5 13 5 6 6 9 9 19 14 6 19 14 11 6 4 5 9 18 26 8 27 42 23 18 19 31 12 7 10 21 16 4 8 5 26 7 4 7 17 13 24 9 5 6 20 3 3 4 21 12 9 17 21 27 7 7 5 29 6 20 9 15 17 13 9 4 3 5 3 4 17 4 4 5 11 21 9 5 11 10 4 4 6 6 9 11 11 14 5 4 8 5 7 6 6 9 10 8 11 11 9 25 10 9 19 6 6 18 7 4 4 4 4 9 6 17 5 3 4 4 7 8 9 2 3 7 5 4 9 5 1 3 1 6 15 4 4 6 6 11 8 4 2 4 7 2 5 3 3 4 5 6 6 5 4 12 9 4 3 4 4 1 3 5 5 11 5 6 5 3 4 15 5 4 6 11 11 6 6 4 3 1 6 3 7 4 6 5 4 3 4 1 1 5 5 8 4 7 7 7 18 4 4 13 3 15 3 3 5 19 6 18 4 4 7 17 3 20 11 4 16 7 3 5 5 8 4 10 7 3 5 3 3	Open. Hide. 14 21 21 26 24 15 22 12 19 55 55 40 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 59 52 49 30 41 41 37 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 34 55 59 59 61 55 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 59 59 61 61 61 59 61 59 61 61 59 61 61 61 61 59 59 61 59 59 59 59 59 59 59 59 59 55 59 59 59 59 59 55 43 59 59 59 61 61 61 61 61 59 59 59 44 59 59 59 61 61 61 61 61 61 61 61 61 61 59 55 55 61 61 61 61 61 61 59 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 44 44 59 61 59 59 59 59 61 61 59 61 61 59 61 59 59 59 44 25 36 59 44 13 29 12 13 13 13 61 59 61 59 61 59 59 59 59 59 59 43 12 13 12 12 8 10 13 15 13 24 20 10 15 18 14 18 10 13 8 12 19 26 19 11 15 15 8 12 8 11 11 10 11 12 5 4 10 12 12 10 13 8 7 8 6 5 11 12 10 15 18 8 10 7 5 8 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_70316916_70317585
seq2: B6Ng01-050H20.g_115_405 (reverse)

seq1  ATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGC  50
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  ATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTAAGTTCCAGGACAGC  50

seq1  CAGGGCTACACAGAGAAACCCTGTCTCGGAAAAAAAAAAAAGAGAGAGAG  100
      |||||||| |||||||||| ||||||   |||                  
seq2  CAGGGCTATACAGAGAAACACTGTCTTTAAAA------------------  82

seq1  AGAGAAAGAAAAGAAAAATGAGTCGGGGGCAGGTGAATCTTTGTGAGTTT  150
                                                        
seq2  --------------------------------------------------  82

seq1  GAAGCCAGCCTGGTGTCCATAGCAAGTCCCAGGCCATCTGTGTCTACATA  200
                                                        
seq2  --------------------------------------------------  82

seq1  CTAAGACTCTGCCAAGAAGAAGGAGGAGGAGGACAAATGAAGAAAGAAAG  250
                   |||||||||||||||||||                  
seq2  -------------AAGAAGAAGGAGGAGGAGG------------------  101

seq1  AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA  300
                                || | || || |||  || |||| 
seq2  --------------------------AGGAGGAGAGGAAG--AGGAAGAG  123

seq1  GGAAAGAAGAGAGTGTGAGAGAAAGAGAGAAAGAAAAGGAAGAAAAAGCA  350
      |||                      |||| |||||  ||||         
seq2  GGA----------------------AGAGGAAGAAGTGGAA---------  142

seq1  AAAGAAAGAAAAAAAGCAAGCCCCCACTGTTAAATCACCTGTAATATCAA  400
                                               ||||||   
seq2  ----------------------------------------ATAATAT---  149

seq1  TCCTATGGGATCTAATTTCCTCCTTTAGCTTTTGCAGACCTGAGGCACAC  450
                    ||| || | ||| |  ||||                
seq2  --------------ATTGCCCCGTTTGG--TTTG----------------  167

seq1  AAGTGCTTCACAGATATGCATGTGGGCAAAATACTCACACACATAAAACT  500
                  |||| |  || ||    |||                  
seq2  ------------GATAAGAGTGGGGTGGTAAT------------------  187

seq1  GAAATTAAATAGAAAGAAAATGGGACCATCTTGGCTCATATAGCCATCAC  550
          || |||                  |||                   
seq2  ----TTCAAT-----------------TTCT-------------------  197

seq1  TGTATCACCAGAGACAGAGTCCACTCTGAGAAACAGAAAAGGGCGCGCAG  600
      | |||  |||||||            |||   | | | |||| |  |   
seq2  TTTATTTCCAGAGA------------TGA-TTATAAATAAGGTCTAG---  231

seq1  AAACAAAATTTAAGAGCTGGGCAGTGGTGGCACATACCTTTAATCCCAGC  650
       ||| |         || | ||| ||||||  ||| ||||||||||||||
seq2  -AACTA--------GGCCGTGCA-TGGTGGTGCATGCCTTTAATCCCAGC  271

seq1  ACTCAGGAGGCAGAGGCAGG  670
      |||||||||||||| |||||
seq2  ACTCAGGAGGCAGAAGCAGG  291

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information