MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-173F09
Chromosome	11 (Build37)
Map Location	114,930,564 - 115,051,248
singlet/doublet	doublet
Overlap gene	Cd300lf, Rab37, Slc9a3r1, Nat9, Tmem104
Upstream gene	LOC100041739, LOC634710, 4932435O22Rik, Rpl38, Ttyh2, Dnaic2, Kif19a, 1500005I02Rik, Gpr142, Gprc5c, Cd300a, Cd300lb, Cd300c, 4732429D16Rik, Cd300d, LOC629970, LOC100043123, LOC100043125, Clm3, Cd300e
Downstream gene	Grin2c, Fdxr, Fads6, Otop2, Ush1g, Otop3, C630004H02Rik, Cdr2l, Ict1, Atp5h, Kctd2, 4933422H20Rik, Slc16a5, Armc7, Nt5c, Hn1, Sumo2, Nup85, Gga3, Mrps7, Mif4gd, Slc25a19, Grb2, LOC100043184, 2310067B10Rik, Caskin2, Tsen54, Llgl2, Recql5, 2210020M01Rik, Sap30bp, Itgb4, Galk1, H3f3b, Unk, Unc13d, Wbp2, Trim47, Trim65, Mrpl38, Fbf1, Acox1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC634710 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	4932435O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319819 MGI:2442791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rpl38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67671 MGI:1914921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ttyh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117160 MGI:2157091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnaic2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432611 MGI:2685574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif19a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:286942 MGI:2447024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins

name	1500005I02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72014 MGI:1919264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217302 MGI:2668437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprc5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70355 MGI:1917605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217303 MGI:2443411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300lb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217304 MGI:2685099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387565 MGI:3032626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732429D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217305 MGI:2442358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140497 MGI:2153249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100043123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 Proteins

name	LOC100043125 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 Proteins

name	Clm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382551 MGI:2687214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217306 MGI:2387602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300lf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246746 MGI:2442359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58222 MGI:1929945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a3r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26941 MGI:1349482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66176 MGI:1913426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320534 MGI:2444222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14813 MGI:95822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fdxr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14149 MGI:104724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fads6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328035 MGI:3039592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otop2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237987 MGI:2388365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ush1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16470 MGI:2450757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otop3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69602 MGI:1916852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C630004H02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217310 MGI:2445087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdr2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237988 MGI:2684867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ict1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68572 MGI:1915822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71679 MGI:1918929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70382 MGI:1917632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933422H20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432613 MGI:3588186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217316 MGI:2443515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276905 MGI:2679719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50773 MGI:1354954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15374 MGI:1096361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170930 MGI:2158813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup85 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:445007 MGI:3046173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260302 MGI:2384159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50529 MGI:1354367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mif4gd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69674 MGI:1916924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67283 MGI:1914533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14784 MGI:95805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1127 ESTs, 10 Proteins

name	2310067B10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71947 MGI:1919197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Caskin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140721 MGI:2157062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsen54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76265 MGI:1923515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Llgl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217325 MGI:1918843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Recql5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170472 MGI:2156841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210020M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66528 MGI:1913778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sap30bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57230 MGI:1927479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192897 MGI:96613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Galk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14635 MGI:95730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H3f3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15081 MGI:1101768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217331 MGI:2442456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc13d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70450 MGI:1917700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22378 MGI:104709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217333 MGI:1917374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338364 MGI:2442815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60441 MGI:1926269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217335 MGI:1922033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11430 MGI:1330812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041739 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262504 GeneID:100041739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041739 transcript_id : XM_001476930.1

name	Rpl38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205439 GeneID:67671 MGI:1914921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L38 transcript_id : NM_001048058.1

name	Rpl38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205443 GeneID:67671 MGI:1914921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L38 transcript_id : NM_001048057.1

name	Rpl38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205438 GeneID:67671 MGI:1914921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L38 transcript_id : NM_023372.2

name	Ttyh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68989250 GeneID:117160 MGI:2157091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tweety homolog 2 (Drosophila) transcript_id : NM_053273.2

name	Dnaic2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145545 GeneID:432611 MGI:2685574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, intermediate chain 2 transcript_id : NM_001034878.2

name	Kif19a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262559 GeneID:286942 MGI:2447024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 4 Proteins product : kinesin family member 19A transcript_id : XM_988580.2

name	1500005I02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388523 GeneID:72014 MGI:1919264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500005I02 gene transcript_id : NM_028055.2

name	Gpr142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32306533 GeneID:217302 MGI:2668437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 142 transcript_id : NM_181749.1

name	Gprc5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354065 GeneID:70355 MGI:1917605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 5, member C transcript_id : NM_147217.2

name	Cd300a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892370 GeneID:217303 MGI:2443411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300A antigen transcript_id : NM_170758.3

name	Cd300lb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80978940 GeneID:217304 MGI:2685099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300 antigen like family member B transcript_id : NM_199221.2

name	Cd300c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40363810 GeneID:387565 MGI:3032626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300C antigen transcript_id : NM_199225.1

name	4732429D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130119 GeneID:217305 MGI:2442358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732429D16 gene transcript_id : NM_145437.2

name	Cd300d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189345 GeneID:140497 MGI:2153249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd300D antigen transcript_id : NM_134158.1

name	LOC629970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82935461 GeneID:629970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to CLM3 transcript_id : XM_895007.1

name	LOC100043123 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262560 GeneID:100043123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 Proteins product : similar to CLM3 transcript_id : XM_001480255.1

name	LOC100043125 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262562 GeneID:100043125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 Proteins product : similar to CLM3 transcript_id : XM_001480256.1

name	Clm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40353229 GeneID:382551 MGI:2687214
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CMRF-35-like molecule 3 transcript_id : NM_199201.1

name	Cd300e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377139 GeneID:217306 MGI:2387602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300e antigen transcript_id : NM_172050.2

name	Cd300lf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83699401 GeneID:246746 MGI:2442359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300 antigen like family member F transcript_id : NM_145634.2

name	Rab37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388742 GeneID:58222 MGI:1929945
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB37, member of RAS oncogene family transcript_id : NM_021411.3

name	Slc9a3r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270973 GeneID:26941 MGI:1349482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1 transcript_id : NM_012030.2

name	Nat9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130325 GeneID:66176 MGI:1913426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAT9 transcript_id : NM_025400.3

name	Tmem104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701884 GeneID:320534 MGI:2444222
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 104 transcript_id : NM_001033393.1

name	Grin2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75709201 GeneID:14813 MGI:95822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA2C (epsilon 3) transcript_id : NM_010350.2

name	Fdxr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679766 GeneID:14149 MGI:104724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferredoxin reductase transcript_id : NM_007997.1

name	Fads6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342383 GeneID:328035 MGI:3039592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase domain family, member 6 transcript_id : NM_178035.3

name	Otop2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063537 GeneID:237987 MGI:2388365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otopetrin 2 transcript_id : NM_172801.2

name	Ush1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893269 GeneID:16470 MGI:2450757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1G homolog (human) transcript_id : NM_176847.3

name	Otop3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037166 GeneID:69602 MGI:1916852
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otopetrin 3 transcript_id : NM_027132.1

name	C630004H02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129878 GeneID:217310 MGI:2445087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C630004H02 gene transcript_id : NM_175454.2

name	Cdr2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286867 GeneID:237988 MGI:2684867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebellar degeneration-related protein 2-like transcript_id : NM_001080929.1

name	Ict1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19387847 GeneID:68572 MGI:1915822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immature colon carcinoma transcript 1 transcript_id : NM_026729.1

name	Atp5h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313678 GeneID:71679 MGI:1918929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d transcript_id : NM_027862.1

name	Kctd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53829371 GeneID:70382 MGI:1917632
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 2 transcript_id : NM_183285.2

name	4933422H20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367885 GeneID:432613 MGI:3588186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933422H20 gene transcript_id : NM_001033775.2

name	Slc16a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286851 GeneID:217316 MGI:2443515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 5 transcript_id : NM_001080934.1

name	Armc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130499 GeneID:276905 MGI:2679719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 7 transcript_id : NM_177778.4

name	Nt5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657030 GeneID:50773 MGI:1354954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5',3'-nucleotidase, cytosolic transcript_id : NM_015807.1

name	Hn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680236 GeneID:15374 MGI:1096361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematological and neurological expressed sequence 1 transcript_id : NM_008258.1

name	Sumo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354907 GeneID:170930 MGI:2158813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMT3 suppressor of mif two 3 homolog 2 (yeast) transcript_id : NM_133354.2

name	Nup85 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108773812 GeneID:445007 MGI:3046173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 85 transcript_id : NM_001002929.3

name	Gga3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089307 GeneID:260302 MGI:2384159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi associated, gamma adaptin ear containing, ARF binding protein 3 transcript_id : NM_173048.2

name	Mrps7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363373 GeneID:50529 MGI:1354367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitchondrial ribosomal protein S7 transcript_id : NM_025305.2

name	Mif4gd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328401 GeneID:69674 MGI:1916924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MIF4G domain containing transcript_id : NM_027162.3

name	Slc25a19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362932 GeneID:67283 MGI:1914533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 transcript_id : NM_026071.2

name	Grb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130949 GeneID:14784 MGI:95805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 2 transcript_id : NM_008163.3

name	LOC100043184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262564 GeneID:100043184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 1126 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 1 transcript_id : XM_001480395.1

name	LOC100043184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262566 GeneID:100043184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 664 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 2 transcript_id : XM_001480398.1

name	2310067B10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421147 GeneID:71947 MGI:1919197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310067B10 gene transcript_id : NM_028014.3

name	Caskin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981529 GeneID:140721 MGI:2157062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cask-interacting protein 2 transcript_id : NM_080643.2

name	Tsen54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108389162 GeneID:76265 MGI:1923515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae) transcript_id : NM_029557.1

name	Llgl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922655 GeneID:217325 MGI:1918843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lethal giant larvae homolog 2 (Drosophila) transcript_id : NM_145438.2

name	Recql5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18485509 GeneID:170472 MGI:2156841
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RecQ protein-like 5 transcript_id : NM_130454.1

name	2210020M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361183 GeneID:66528 MGI:1913778
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210020M01 gene transcript_id : NM_183259.2

name	Sap30bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130518 GeneID:57230 MGI:1927479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAP30 binding protein transcript_id : NM_020483.3

name	Itgb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735427 GeneID:192897 MGI:96613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 4 transcript_id : NM_133663.2

name	Itgb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735425 GeneID:192897 MGI:96613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 4 transcript_id : NM_001005608.2

name	Galk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102412 GeneID:14635 MGI:95730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactokinase 1 transcript_id : NM_016905.2

name	H3f3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089277 GeneID:15081 MGI:1101768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H3 histone, family 3B transcript_id : NM_008211.3

name	Unk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376628 GeneID:217331 MGI:2442456
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unkempt homolog (Drosophila) transcript_id : NM_172569.2

name	Unc13d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62243587 GeneID:70450 MGI:1917700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-13 homolog D (C. elegans) transcript_id : NM_001009573.2

name	Wbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131203 GeneID:22378 MGI:104709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 2 transcript_id : NM_016852.2

name	Trim47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387213 GeneID:217333 MGI:1917374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 47 transcript_id : NM_172570.3

name	Trim65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892171 GeneID:338364 MGI:2442815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 65 transcript_id : NM_178802.3

name	Mrpl38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430534 GeneID:60441 MGI:1926269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L38 transcript_id : NM_024177.3

name	Fbf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922652 GeneID:217335 MGI:1922033
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas (TNFRSF6) binding factor 1 transcript_id : NM_172571.3

name	Acox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793428 GeneID:11430 MGI:1330812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A oxidase 1, palmitoyl transcript_id : NM_015729.2

name	LOC100041739 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262505 GeneID:100041739
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476980.1

name	Rpl38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205444 GeneID:67671 MGI:1914921
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L38 protein_id : NP_001041522.1

name	Rpl38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205440 GeneID:67671 MGI:1914921
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L38 protein_id : NP_001041523.1

name	Rpl38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963655 GeneID:67671 MGI:1914921
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L38 protein_id : NP_075861.1

name	Ttyh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68989251 CCDS:CCDS25608.1 GeneID:117160 MGI:2157091
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : tweety 2 protein_id : NP_444503.2

name	Dnaic2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145546 GeneID:432611 MGI:2685574
definition	GO_component : GO:0005858 - axonemal dynein complex [Evidence ISS]; GO:0035085 - cilium axoneme [Evidence ISS] GO_function : GO:0003777 - microtubule motor activity [Evidence ISS] GO_process : GO:0042384 - cilium biogenesis [Evidence ISS] codon_start : 1 product : dynein, axonemal, intermediate polypeptide 2 protein_id : NP_001030050.2

name	Kif19a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390924 GeneID:286942 MGI:2447024
definition	codon_start : 1 product : kinesin family member 19A protein_id : XP_993674.1

name	1500005I02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037273 CCDS:CCDS25610.1 GeneID:72014 MGI:1919264
definition	codon_start : 1 product : hypothetical protein LOC72014 protein_id : NP_082331.1

name	Gpr142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32306534 CCDS:CCDS25611.1 GeneID:217302 MGI:2668437
definition	GO_component : GO:0016021 - integral to membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor PGR2 product : G protein-coupled receptor 142 protein_id : NP_861414.1

name	Gprc5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267464 CCDS:CCDS25612.1 GeneID:70355 MGI:1917605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005118 - sevenless binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 exception : mismatches in translation product : retinoic acid inducible protein 3 protein_id : NP_671750.1

name	Cd300a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092741 CCDS:CCDS25613.1 GeneID:217303 MGI:2443411
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0019902 - phosphatase binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : mast cell-derived paired immunoglobulin-like receptor 1; polymeric immunoglobulin receptor 4 product : CD300A antigen protein_id : NP_739564.1

name	Cd300lb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80978941 CCDS:CCDS25614.1 GeneID:217304 MGI:2685099
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : CMRF-35-like molecule-7 product : CD300 antigen like family member B protein_id : NP_954691.2

name	Cd300c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363811 GeneID:387565 MGI:3032626
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : CMRF-35-like molecule 6 product : CD300C antigen protein_id : NP_954695.1

name	4732429D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703872 CCDS:CCDS25615.1 GeneID:217305 MGI:2442358
definition	codon_start : 1 note : novel immunoglobulin V-set protein (Clm5) product : leukocyte mono-Ig-like receptor 4 protein_id : NP_663412.1

name	Cd300d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189346 CCDS:CCDS25616.1 GeneID:140497 MGI:2153249
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : leukocyte mono-Ig-like receptor 2; dendritic cell-derived immunoglobulin receptor 1; myeloid-associated immunoglobulin-like receptor II; immunoglobulin superfamily, member 7; Cd300C antigen product : Cd300D antigen protein_id : NP_598919.1

name	LOC629970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82935462 GeneID:629970
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900100.1

name	LOC100043123 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262561 GeneID:100043123
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480305.1

name	LOC100043125 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262563 GeneID:100043125
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480306.1

name	Clm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40353230 CCDS:CCDS25617.1 GeneID:382551 MGI:2687214
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CLM3 protein_id : NP_954671.1

name	Cd300e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25286711 CCDS:CCDS25618.1 GeneID:217306 MGI:2387602
definition	codon_start : 1 note : CMRF-35-like molecule-1; CD300 antigen like family member E product : immune receptor expressed on myeloid cells 2 protein_id : NP_742047.1

name	Cd300lf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699402 CCDS:CCDS25619.1 GeneID:246746 MGI:2442359
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030316 - osteoclast differentiation [Evidence IDA] codon_start : 1 note : DC-derived Ig-like receptor 2; CMRF-35-like molecule 1 product : polymeric immunoglobulin receptor 3 precursor protein_id : NP_663609.2

name	Rab37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543568 CCDS:CCDS25620.1 GeneID:58222 MGI:1929945
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GTPase Rab37 product : RAB37, member of RAS oncogene family protein_id : NP_067386.2

name	Slc9a3r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755566 GeneID:26941 MGI:1349482
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0016324 - apical plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0019933 - cAMP-mediated signaling [Evidence ISS]; GO:0030643 - phosphate ion homeostasis [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : sodium-hydrogen exchanger regulatory factor product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1 protein_id : NP_036160.1

name	Nat9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384782 CCDS:CCDS25622.1 GeneID:66176 MGI:1913426
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel acetyltransferase protein product : NAT9 protein_id : NP_079676.1

name	Tmem104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701885 CCDS:CCDS25623.1 GeneID:320534 MGI:2444222
definition	codon_start : 1 note : novel transmembrane amino acid transporter protein product : hypothetical protein LOC320534 protein_id : NP_001028565.1

name	Grin2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75709202 CCDS:CCDS25624.1 GeneID:14813 MGI:95822
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence TAS]; GO:0048167 - regulation of synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GluRepsilon3 product : glutamate receptor, ionotropic, NMDA2C (epsilon 3) protein_id : NP_034480.2

name	Fdxr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679767 CCDS:CCDS25625.1 GeneID:14149 MGI:104724
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004324 - ferredoxin-NADP+ reductase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ferredoxin reductase protein_id : NP_032023.1

name	Fads6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017470 CCDS:CCDS25626.1 GeneID:328035 MGI:3039592
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : high expressed gene during embryogenisis product : fatty acid desaturase domain family, member 6 protein_id : NP_828874.2

name	Ush1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849903 CCDS:CCDS25627.1 GeneID:16470 MGI:2450757
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : Jackson shaker; scaffold protein, amkyrin repeats and SAM domain containing; scaffold protein, ankyrin repeats and SAM domain containing product : Usher syndrome 1G homolog protein_id : NP_789817.1

name	Otop2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063538 CCDS:CCDS25628.1 GeneID:237987 MGI:2388365
definition	codon_start : 1 note : otopetrin 2 (Otop2) product : otopetrin 2 protein_id : NP_766389.2

name	Otop3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037167 CCDS:CCDS25629.1 GeneID:69602 MGI:1916852
definition	GO_component : GO:0016020 - membrane [Evidence ISS] codon_start : 1 exception : mismatches in translation product : otopetrin 3 protein_id : NP_081408.1

name	C630004H02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29825825 CCDS:CCDS25630.1 GeneID:217310 MGI:2445087
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217310 protein_id : NP_780663.1

name	Cdr2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286868 GeneID:237988 MGI:2684867
definition	codon_start : 1 product : cerebellar degeneration-related protein 2-like protein_id : NP_001074398.1

name	Ict1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19387848 CCDS:CCDS25632.1 GeneID:68572 MGI:1915822
definition	GO_function : GO:0003747 - translation release factor activity [Evidence IEA] GO_process : GO:0006415 - translational termination [Evidence IEA] codon_start : 1 product : immature colon carcinoma transcript 1 protein_id : NP_081005.1

name	Atp5h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313679 CCDS:CCDS25633.1 GeneID:71679 MGI:1918929
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] [Evidence IEA]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d protein_id : NP_082138.1

name	Kctd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53829372 CCDS:CCDS25634.1 GeneID:70382 MGI:1917632
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium channel tetramerisation domain containing 2 protein_id : NP_899108.2

name	4933422H20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702085 GeneID:432613 MGI:3588186
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel zinc finger, C3HC4 type (RING finger) and SPRY domain containing protein product : hypothetical protein LOC432613 protein_id : NP_001028947.1

name	Slc16a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286852 GeneID:217316 MGI:2443515
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 16 (monocarboxylic acid transporters), member 5 protein_id : NP_001074403.1

name	Armc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244300 CCDS:CCDS25636.1 GeneID:276905 MGI:2679719
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : A630084C13rik product : armadillo repeat containing 7 protein_id : NP_808446.1

name	Nt5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657031 CCDS:CCDS25637.1 GeneID:50773 MGI:1354954
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IDA] GO_process : GO:0009264 - deoxyribonucleotide catabolism [Evidence IDA]; GO:0009117 - nucleotide metabolism [Evidence IEA] codon_start : 1 note : uridine monophosphatase 2; 5'(3')-deoxyribonucleotidase; 5' nucleotidase, deoxy (pyrimidine), cytosolic type C; 5',3' nucleotidase, cytosolic product : 5',3'-nucleotidase, cytosolic protein_id : NP_056622.1

name	Hn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680237 CCDS:CCDS25638.1 GeneID:15374 MGI:1096361
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hematological and neurological expressed sequence 1 protein_id : NP_032284.1

name	Sumo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111164 GeneID:170930 MGI:2158813
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0019949 - SUMO conjugating enzyme activity [Evidence IDA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : SMT3 supressor of mif two 3 homolog 2 protein_id : NP_579932.1

name	Nup85 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:108773813 CCDS:CCDS25640.1 GeneID:445007 MGI:3046173
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0031727 - CCR2 chemokine receptor binding [Evidence ISS]; GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0030032 - lamellipodium biogenesis [Evidence IDA]; GO:0048246 - macrophage chemotaxis [Evidence IDA] codon_start : 1 product : nucleoporin 85 protein_id : NP_001002929.3

name	Gga3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089308 CCDS:CCDS25641.1 GeneID:260302 MGI:2384159
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030306 - ADP-ribosylation factor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi associated, gamma adaptin ear containing, ARF binding protein 3 protein_id : NP_766636.2

name	Mrps7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794474 CCDS:CCDS25642.1 GeneID:50529 MGI:1354367
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, S7 product : mitchondrial ribosomal protein S7 protein_id : NP_079581.1

name	Mif4gd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328402 CCDS:CCDS25643.1 GeneID:69674 MGI:1916924
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MIF4G domain containing protein_id : NP_081438.3

name	Slc25a19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313024 CCDS:CCDS25644.1 GeneID:67283 MGI:1914533
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 product : solute carrier family 25, member 19 protein_id : NP_080347.1

name	Grb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680083 CCDS:CCDS25645.1 GeneID:14784 MGI:95805
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IDA]; GO:0012506 - vesicle membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005070 - SH3/SH2 adaptor activity [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0000165 - MAPKKK cascade [Evidence IGI]; GO:0007265 - Ras protein signal transduction [Evidence TAS] codon_start : 1 product : growth factor receptor bound protein 2 protein_id : NP_032189.1

name	LOC100043184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262565 GeneID:100043184
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480445.1

name	LOC100043184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262567 GeneID:100043184
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480448.1

name	2310067B10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328308 CCDS:CCDS25646.1 GeneID:71947 MGI:1919197
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71947 protein_id : NP_082290.2

name	Caskin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981530 CCDS:CCDS25647.1 GeneID:140721 MGI:2157062
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cask-interacting protein 2 protein_id : NP_542374.2

name	Tsen54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:108389163 CCDS:CCDS25648.1 GeneID:76265 MGI:1923515
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 note : likely ortholog of H. sapiens SEN54L product : tRNA splicing endonuclease 54 homolog protein_id : NP_083833.1

name	Llgl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922656 CCDS:CCDS25649.1 GeneID:217325 MGI:1918843
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : lethal giant larvae-like protein 2 product : lethal giant larvae homolog 2 protein_id : NP_663413.2

name	Recql5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485510 CCDS:CCDS25650.1 GeneID:170472 MGI:2156841
definition	GO_function : GO:0004386 - helicase activity [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA] codon_start : 1 product : RecQ protein-like 5 protein_id : NP_569721.1

name	2210020M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304038 GeneID:66528 MGI:1913778
definition	codon_start : 1 product : hypothetical protein LOC66528 protein_id : NP_899082.1

name	Sap30bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560336 CCDS:CCDS25651.1 GeneID:57230 MGI:1927479
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcriptional regulator protein (Hcngp) product : transcriptional regulator protein protein_id : NP_065229.2

name	Itgb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735428 GeneID:192897 MGI:96613
definition	GO_component : GO:0009925 - basal plasma membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0046847 - filopodium formation [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : integrin beta 4 isoform 2 protein_id : NP_598424.2

name	Itgb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735426 GeneID:192897 MGI:96613
definition	GO_component : GO:0009925 - basal plasma membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0046847 - filopodium formation [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : integrin beta 4 isoform 1 protein_id : NP_001005608.2

name	Galk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93102413 CCDS:CCDS25654.1 GeneID:14635 MGI:95730
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004335 - galactokinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0046835 - carbohydrate phosphorylation [Evidence IEA]; GO:0019402 - galactitol metabolism [Evidence IMP]; GO:0006012 - galactose metabolism [Evidence IDA] [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA] codon_start : 1 product : galactokinase 1 protein_id : NP_058601.2

name	H3f3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680161 GeneID:15081 MGI:1101768
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : H3L-like histone product : H3 histone, family 3B protein_id : NP_032237.1

name	Unk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369808 CCDS:CCDS25655.1 GeneID:217331 MGI:2442456
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003711 - transcriptional elongation regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger CCCH type domain containing 5 product : zinc finger CCCH type containing 5 protein_id : NP_766157.1

name	Unc13d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62243588 CCDS:CCDS25656.1 GeneID:70450 MGI:1917700
definition	codon_start : 1 product : unc-13 homolog D protein_id : NP_001009573.2

name	Wbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394539 CCDS:CCDS25657.1 GeneID:22378 MGI:104709
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WW domain binding protein 2 protein_id : NP_058548.1

name	Trim47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559881 GeneID:217333 MGI:1917374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 47 protein_id : NP_766158.2

name	Trim65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520291 GeneID:338364 MGI:2442815
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : tripartite motif-containing 65 protein_id : NP_848917.1

name	Mrpl38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430535 CCDS:CCDS25658.1 GeneID:60441 MGI:1926269
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence ISS] codon_start : 1 note : ribosomal protein, mitochondrial, L3 product : mitochondrial ribosomal protein L38 protein_id : NP_077139.2

name	Fbf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922653 CCDS:CCDS25659.1 GeneID:217335 MGI:1922033
definition	codon_start : 1 note : likely ortholog of H. sapiens Fas (TNFRSF6) binding factor 1 (FBF1) product : Fas (TNFRSF6) binding factor 1 protein_id : NP_766159.3

name	Acox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793429 CCDS:CCDS25660.1 GeneID:11430 MGI:1330812
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005778 - peroxisomal membrane [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0003997 - acyl-CoA oxidase activity [Evidence TAS]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : Acyl-CoA oxidase product : acyl-Coenzyme A oxidase 1, palmitoyl protein_id : NP_056544.2

name	LOC634710 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634710
definition	number : 1 pseudo : _no_value

name	LOC634710 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634710
definition	number : 2 pseudo : _no_value

name	LOC634710 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634710
definition	number : 3 pseudo : _no_value

name	LOC634710 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634710
definition	number : 4 pseudo : _no_value

name	4932435O22Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262558 GeneID:319819 MGI:2442791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 4932435O22 gene transcript_id : XR_035417.1

clone name	MSMg01-272H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347L19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-482G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-279O14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-090P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531K13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-303L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-354H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532D21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-173F09.b	B6Ng01-173F09.g
ACC	GA001706	GA001707
length	763	991
definition	B6Ng01-173F09.b	B6Ng01-173F09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,930,564 - 114,931,325)	(115,050,270 - 115,051,248)
sequence	gaattcagcacacacaaacacacaacagacacacacacacacatatgcac aacacatattatatatgcctataattccagcattggggaggttgagacag gaagaccttgggttcaagaccagcctggactacacaagtcactagctcaa acacagagagctgggagtactcacacactttaaccccatcacttcagggg cagaggcaggtggatctctttgagtttgaggtcagtctggtctatgtatt aagttccaggccagtcagggccacataggaagactttgtctcaaatctca aataacagtagcaatgataatagttgtaattataataaggacccctgttt gctgagagactgctactgtatctattatctcatcccatgcagacaatcac cttaaagcaggtttttctttttttctaaatgagtacactgtagctgtctt taaacacactggaggagagcattggattccattacagatgggctgccatg tggttgctgggaattgaactcaggacctttggaagaggagccagtgttct taaccgctgagccatctctgtagtccctgacaaccaccttgaaagaagga ccaattattatccccattttgcacaggagaaagctatactcttgagggag ctgctgatcacactggaataagagccaatagccaccacccttcagtagtg gtgcacacctttaatcctagcacttgggaggcagaggcaggcagaatttc tgagtttgaggct	gaattccatacatttgtacacacaaaaattaaatatttaaaagaaaacaa agacctataagaagaagagggctgctttcctcagaaccctgaccaccacc tgattaacacccccctgtcgccaccagcacccatctttctcatctctctt ccttcacaattaagataaaaacaaaatcacagtgcttgtttatggcaaag tgcaaagaccccagataaagcacacagaagatgggaaggagaaaaggggg aggtgtgtgaagcggagctcctgaggcacacaggcctaactgtccaggcg gctgtggcatcacaaggtggcctgagtggatgattacatggtgaaggcac aaggaatggggacataaggtactttctttctaaaacacagtcacagcaat aactcacttcctcgtctccaagtctgtagtgagtgtcagaaaaagcagga actgtggcaacgtgtagggacagtgcagacatcttcttgctgacagggga ttctaagaactatcacatgattgcatggacagggtaaccatccactccag cactttccctggtgagctgcagcggtgaagtgtgcatgcgtgtgtgtgtg tctgtgtgtgtgtctgtgtgtgtctgtgtgtgctctgtggctgcctatga acagcagggcactgctgagactagaaaaatcctaaaaaggcggcttgtgg agaagagccgcttttcctggtgacagcaggtaccaatgtgagtcaaccca ggtaactcacgatttacctccaacgacttacccagtgaaggccccgtgat gcaataaccacataaccacaaccaactgggatacagcaccgagagaagat aaactgagtgtgtgtgggggggagtgcaggggccacggagccgagacaga gggaatcaatcgctcctaattgtcataattgctatgctctaccaaactgc aattgggaagacttctgcagttcaccaccctctttccacta
quality values	Open. Hide. 58 16 41 30 58 28 21 38 62 54 43 42 62 47 47 32 62 62 47 32 47 47 54 62 43 44 44 62 49 62 62 62 59 34 26 34 17 38 19 23 22 24 21 28 28 32 34 38 56 62 59 54 54 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 59 62 51 41 51 50 35 28 32 32 54 40 38 36 36 49 49 54 59 62 62 62 62 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 54 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 54 54 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 47 62 62 54 62 62 62 62 62 62 62 62 62 52 62 43 62 62 52 62 47 47 62 62 62 62 62 62 62 62 62 62 49 62 58 58 58 58 58 35 58 54 48 58 58 58 58 58 58 54 52 52 58 58 58 58 58 54 42 49 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 54 42 58 45 35 54 54 58 58 54 52 54 58 54 54 54 52 41 54 52 58 58 58 58 58 52 52 54 48 29 58 58 20 49 58 58 51 49 51 52 46 50 58 58 58 46 42 46 46 25 49 50 51 39 50 58 58 50 52 53 46 53 53 52 50 50 54 54 49 48 58 41 46 53 58 42 58 46 51 58 37 51 52 52 51 58 49 46 52 53 46 50 58 58 46 58 39 31 46 50 46 37 52 53 54 52 52 50 50 50 50 47 50 51 50 49 50 26 31 50 58 32 34 41 39 50 34 53 52 51 58 40 51 41 50 29 47 35 32 18 35 16 16 11 26 35 36 10 10 13 22 40 38 22 15 25 28 10 50 49 7 16 25 11 7 7 6	Open. Hide. 62 59 59 59 62 62 59 30 62 62 59 49 24 13 13 18 11 10 18 17 21 21 21 21 25 23 28 34 56 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 31 56 34 27 33 28 34 54 36 56 56 40 43 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 54 62 62 62 62 62 54 62 62 59 54 54 54 42 54 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 56 62 56 54 56 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 56 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 56 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 59 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 43 37 62 62 62 62 56 62 62 62 56 62 62 62 62 62 47 62 62 62 62 62 62 62 26 32 14 16 17 31 56 62 62 30 15 21 9 22 17 62 62 54 62 62 62 62 62 62 56 47 54 62 42 62 62 62 62 62 47 54 47 46 62 35 54 38 38 42 52 43 54 54 42 52 52 62 42 52 42 34 25 30 17 52 38 35 50 50 62 43 62 62 52 28 8 54 42 49 48 34 48 52 52 54 18 41 37 54 39 32 52 46 47 28 30 54 40 41 45 30 52 40 36 12 31 33 54 46 52 54 33 54 26 39 46 33 42 52 47 45 29 22 38 42 26 40 19 46 39 41 25 37 42 30 12 28 26 14 37 28 14 28 37 37 46 41 23 19 39 50 41 33 49 41 41 33 50 48 50 26 26 27 20 23 25 50 37 30 13 52 12 17 28 32 19 19 44 26 30 37 26 29 26 25 24 29 39 51 44 26 40 25 34 37 28 26 30 26 48 50 40 32 14 39 34 15 32 24 23 33 41 29 26 23 22 25 28 40 42 13 21 26 58 23 39 21 18 25 18 17 37 26 39 29 15 7 15 13 9 23 25 40 37 34 32 35 21 39 18 49 34 28 23 24 19 18 49 53 10 30 37 38 31 16 28 34 15 32 18 32 32 25 51 47 51 44 39 21 37 15 9 20 21 21 34 42 34 10 29 21 19 33 23 29 38 10 21 14 6 24 6 18 29 15 18 30 27 33 13 19 18 12 9 10 6 32 19 9 18 32 26 7 13 9 32 27 28 52 28 32 17 21 15 9 10 13 16 11 7 11 10 11 15 9 6 17 20 12 40 9 30 27 14 11 31 23 25 13 11 10 43 23 18 19 10 7 32 19 16 20 20 13 10 16 18 10 16 27 13 4 7 15 9 16 23 6 20 13 42 46 46 10 9 42 19 13 24

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_114930564_114931325
seq2: B6Ng01-173F09.b_41_803

seq1  GAATTCAGCACACACAAACACACAACAGACACACACACACACATATGCAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCACACACAAACACACAACAGACACACACACACACATATGCAC  50

seq1  AACACATATTATATATGCCTATAATTCCAGCATTGGGGAGGTTGAGACAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACATATTATATATGCCTATAATTCCAGCATTGGGGAGGTTGAGACAG  100

seq1  GAAGACCTTGGGTTCAAGACCAGCCTGGACTACACAAGTCACTAGCTCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGACCTTGGGTTCAAGACCAGCCTGGACTACACAAGTCACTAGCTCAA  150

seq1  ACACAGAGAGCTGGGAGTACTCACACACTTTAACCCCATCACTTCAGGGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGAGAGCTGGGAGTACTCACACACTTTAACCCCATCACTTCAGGGG  200

seq1  CAGAGGCAGGTGGATCTCTTTGAGTTTGAGGTCAGTCTGGTCTATGTATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGCAGGTGGATCTCTTTGAGTTTGAGGTCAGTCTGGTCTATGTATT  250

seq1  AAGTTCCAGGCCAGTCAGGGCCACATAGGAAGACTTTGTCTCAAATCTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTCCAGGCCAGTCAGGGCCACATAGGAAGACTTTGTCTCAAATCTCA  300

seq1  AATAACAGTAGCAATGATAATAGTTGTAATTATAATAAGGACCCCTGTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAACAGTAGCAATGATAATAGTTGTAATTATAATAAGGACCCCTGTTT  350

seq1  GCTGAGAGACTGCTACTGTATCTATTATCTCATCCCATGCAGACAATCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGAGAGACTGCTACTGTATCTATTATCTCATCCCATGCAGACAATCAC  400

seq1  CTTAAAGCAGGTTTTTCTTTTTTTCTAAATGAGTACACTGTAGCTGTCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAAGCAGGTTTTTCTTTTTTTCTAAATGAGTACACTGTAGCTGTCTT  450

seq1  TAAACACACTGGAGGAGAGCATTGGATTCCATTACAGATGGGCTGCCATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACACACTGGAGGAGAGCATTGGATTCCATTACAGATGGGCTGCCATG  500

seq1  TGGTTGCTGGGAATTGAACTCAGGACCTTTGGAAGAGGAGCCAGTGTTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTGCTGGGAATTGAACTCAGGACCTTTGGAAGAGGAGCCAGTGTTCT  550

seq1  TAACCGCTGAGCCATCTCTGTAGTCCCTGACAACCACCTTGAAAGAAGGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCGCTGAGCCATCTCTGTAGTCCCTGACAACCACCTTGAAAGAAGGA  600

seq1  CCAATTATTATCCCCATTTTGCACAGGAGAAAGCTATACTCTTGAGGGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATTATTATCCCCATTTTGCACAGGAGAAAGCTATACTCTTGAGGGAG  650

seq1  CTGCTGATCACACTGGAATAAGAGCCAATAGCCACCACCCTTCAGTAGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGATCACACTGGAATAAGAGCCAATAGCCACCACCCTTCAGTAGTG  700

seq1  GTGCACACCTTTAATCCTAGCACTTGGGAGGCAGAGGCAGGCAG-ATTTC  749
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GTGCACACCTTTAATCCTAGCACTTGGGAGGCAGAGGCAGGCAGAATTTC  750

seq1  TGAGTTTGAGGCT  762
      |||||||||||||
seq2  TGAGTTTGAGGCT  763

seq1: chr11_115050270_115051248
seq2: B6Ng01-173F09.g_69_1054 (reverse)

seq1  GAAAGA-GGTGGTGAACTGCAG-AGTC-TCCCAATTGCAGTTTGGTAGAG  47
      |||||| ||||||||||||||| |||| ||||||||||||||||||||||
seq2  GAAAGAGGGTGGTGAACTGCAGAAGTCTTCCCAATTGCAGTTTGGTAGAG  50

seq1  CAT-GCAATTATGACAATTA-GAGCGATTGATTCCCCTCTGTCTCGGCTC  95
      ||| |||||||||||||||| |||||||||||| ||||||||||||||||
seq2  CATAGCAATTATGACAATTAGGAGCGATTGATT-CCCTCTGTCTCGGCTC  99

seq1  CGTGGCCCCTGCACT-CCCCCCACACACACTCAGTTTATCTTCTCTCGGT  144
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  CGTGGCCCCTGCACTCCCCCCCACACACACTCAGTTTATCTTCTCTCGGT  149

seq1  GCTGTAT-CCAGTTGGTTGTGGTTATGTGGTTATTGCATCACGGGGCCTT  193
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTATCCCAGTTGGTTGTGGTTATGTGGTTATTGCATCACGGGGCCTT  199

seq1  CACTGGGTAAGTCGTTGGAGGT-AATCGTGAGTTACCTGGGTTGACTCAC  242
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  CACTGGGTAAGTCGTTGGAGGTAAATCGTGAGTTACCTGGGTTGACTCAC  249

seq1  ATTGGTACCTGCTGTCACCAGGAAAAGCGGCTCTTCTCCACAAGCCGCCT  292
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGTACCTGCTGTCACCAGGAAAAGCGGCTCTTCTCCACAAGCCGCCT  299

seq1  TTTTAGGATTTTTCTAGTCTCAGCAGTGCCCTGCTGTTCATAGGCAGCCA  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAGGATTTTTCTAGTCTCAGCAGTGCCCTGCTGTTCATAGGCAGCCA  349

seq1  CAGAGCACACACAGACACACACAGACACACACACAGACACACACACACGC  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCACACACAGACACACACAGACACACACACAGACACACACACACGC  399

seq1  ATGCACACTTCACCGCTGCAGCTCACCAGGGAAAGTGCTGGAGTGGATGG  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCACACTTCACCGCTGCAGCTCACCAGGGAAAGTGCTGGAGTGGATGG  449

seq1  TTACCCTGTCCATGCAATCATGTGATAGTTCTTAGAATCCCCTGTCAGCA  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCTGTCCATGCAATCATGTGATAGTTCTTAGAATCCCCTGTCAGCA  499

seq1  AGAAGATGTCTGCACTGTCCCTACACGTTGCCACAGTTCCTGCTTTTTCT  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGATGTCTGCACTGTCCCTACACGTTGCCACAGTTCCTGCTTTTTCT  549

seq1  GACACTCACTACAGACTTGGAGACGAGGAAGTGAGTTATTGCTGTGACTG  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACTCACTACAGACTTGGAGACGAGGAAGTGAGTTATTGCTGTGACTG  599

seq1  TGTTTTAGAAAGAAAGTACCTTATGTCCCCATTCCTTGTGCCTTCACCAT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTAGAAAGAAAGTACCTTATGTCCCCATTCCTTGTGCCTTCACCAT  649

seq1  GTAATCATCCACTCAGGCCACCTTGTGATGCCACAGCCGCCTGGACAGTT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATCATCCACTCAGGCCACCTTGTGATGCCACAGCCGCCTGGACAGTT  699

seq1  AGGCCTGTGTGCCTCAGGAGCTCCGCTTCACACACCTCCCCCTTTTCTCC  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTGTGTGCCTCAGGAGCTCCGCTTCACACACCTCCCCCTTTTCTCC  749

seq1  TTCCCATCTTCTGTGTGCTTTATCTGGGGTCTTTGCACTTTGCCATAAAC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCATCTTCTGTGTGCTTTATCTGGGGTCTTTGCACTTTGCCATAAAC  799

seq1  AAGCACTGTGATTTTGTTTTTATCTTAATTGTGAAGGAAGAGAGATGAGA  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCACTGTGATTTTGTTTTTATCTTAATTGTGAAGGAAGAGAGATGAGA  849

seq1  AAGATGGGTGCTGGTGGCGACAGGGGGGTGTTAATCAGGTGGTGGTCAGG  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATGGGTGCTGGTGGCGACAGGGGGGTGTTAATCAGGTGGTGGTCAGG  899

seq1  GTTCTGAGGAAAGCAGCCCTCTTCTTCTTATAGGTCTTTGTTTTCTTTTA  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGAGGAAAGCAGCCCTCTTCTTCTTATAGGTCTTTGTTTTCTTTTA  949

seq1  AATATTTAATTTTTGTGTGTACAAATGTATGGAATTC  979
      |||||||||||||||||||||||||||||||||||||
seq2  AATATTTAATTTTTGTGTGTACAAATGTATGGAATTC  986

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information