MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-179L16
Chromosome	11 (Build37)
Map Location	58,438,048 - 58,439,048
singlet/doublet	singlet
Overlap gene	Olfr323
Upstream gene	Galnt10, Sap30l, Hand1, LOC624605, Larp1, LOC676527, LOC667947, Cnot8, Gemin5, Mrpl22, Irgb10, Igtp, LOC263305, LOC100041816, EG668249, 4930438A08Rik, Zfp692, Zfp672, 1700047K16Rik, Sh3bp5l, 2210415F13Rik, LOC624814, 1810065E05Rik, OTTMUSG00000005737, 4930504O13Rik, Olfr30, Olfr333-ps1, Olfr332, Olfr331, Olfr330, Olfr329, Olfr328, Olfr327-ps1, Olfr325, Olfr324, 2210407C18Rik
Downstream gene	Trim58, Olfr216, OTTMUSG00000005755, Olfr320, LOC668058, Olfr319, Olfr318, Olfr317, Olfr316, Olfr315, Olfr314, 3100002J23Rik, Olfr313, Olfr312, GA_x5J8B7W3UM0-1747565-1747342, Olfr311, 2810021J22Rik, Zfp39, Butr1, Rnf187, LOC676691, Hist3h2ba, Hist3h2bb, Hist3h2a, LOC382523, Trim17, Trim11, Obscn, A230051G13Rik, 4930543L23Rik, Gja12, Guk1, Mrpl55, 2310033P09Rik, Arf1, Wnt3a, Wnt9a, Gm249, 1110031B06Rik, Jmjd4, BC050078, LOC432565, Zkscan17, Nlrp3, Olfr222, LOC668157, Olfr223, GA_x5J8B7W3UM0-970645-971221, Olfr225
Link	Open Mouse BAC browser

Click to get alignment info.

name	Galnt10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171212 MGI:1890480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sap30l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50724 MGI:1354709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hand1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15110 MGI:103577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624605
definition	note : brain expressed X-linked 4 pseudogene pseudo : _no_value

name	Larp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73158 MGI:1890165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 276 ESTs, 1 Protein

name	LOC676527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC667947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 ESTs, 3 Proteins pseudo : _no_value

name	Cnot8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69125 MGI:1916375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gemin5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216766 MGI:2449311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216767 MGI:1333794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irgb10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 23 Proteins

name	Igtp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16145 MGI:107729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC263305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:263305
definition	note : piggyBac transposable element derived 2 (Pgbd2) pseudogene pseudo : _no_value

name	LOC100041816 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG668249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668249 MGI:3647636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4930438A08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73988 MGI:1921238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins

name	Zfp692 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103836 MGI:2144276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319475 MGI:2442105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700047K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73335 MGI:1920585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bp5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79566 MGI:1933124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210415F13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70163 MGI:1917413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC624814 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624814
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 277 ESTs, 6 Proteins

name	1810065E05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69864 MGI:1917114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000005737 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624860 MGI:3651568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930504O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403200 MGI:2685370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18329 MGI:109305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr333-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258044 MGI:3030167
definition	gene_synonym : MOR284-1P note : olfactory receptor 333, pseudogene 1 pseudo : _no_value

name	Olfr332 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257932 MGI:3030166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258179 MGI:3030165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr330 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258879 MGI:3030164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr329 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259148 MGI:3030163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258495 MGI:3030162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr327-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258198 MGI:3030161
definition	gene_synonym : MOR275-3 note : olfactory receptor 327, pseudogene 1 pseudo : _no_value

name	Olfr325 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258261 MGI:3030159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257892 MGI:3030158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210407C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78354 MGI:1925604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr323 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258373 MGI:3030157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216781 MGI:2684862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404346 MGI:3030050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000005755 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257857 MGI:3651771
definition	gene_synonym : GA_x5J8B7U1E65-1-838 note : predicted gene, OTTMUSG00000005755 pseudo : _no_value

name	Olfr320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216783 MGI:3030154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr319 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258493 MGI:3030153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258494 MGI:3030152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr317 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257931 MGI:3030151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr316 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258064 MGI:3030150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr315 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258531 MGI:3030149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr314 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257917 MGI:3030148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3100002J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75429 MGI:1922679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 1 Protein

name	Olfr313 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258529 MGI:3030147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258065 MGI:3030146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3UM0-1747565-1747342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257735
definition	note : olfactory receptor GA_x5J8B7W3UM0-1747565-1747342 pseudo : _no_value

name	Olfr311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258530 MGI:3030145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810021J22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69944 MGI:1917194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22698 MGI:99183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Butr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192194 MGI:2182073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108660 MGI:1914224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 343 ESTs, 3 Proteins

name	LOC676691 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 223 ESTs

name	Hist3h2ba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78303 MGI:1925553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist3h2bb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382522 MGI:1922442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist3h2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319162 MGI:2448458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382523 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins

name	Trim17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56631 MGI:1861440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94091 MGI:2137355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Obscn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380698 MGI:2681862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230051G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216792 MGI:3041174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930543L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75171 MGI:1922421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Gja12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118454 MGI:2153060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Guk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14923 MGI:95871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67212 MGI:1914462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310033P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67862 MGI:1915112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11840 MGI:99431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22416 MGI:98956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216795 MGI:2446084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216797 MGI:2685095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110031B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67826 MGI:1915076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194952 MGI:2144404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC050078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237775 MGI:2681848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 11 Proteins pseudo : _no_value

name	Zkscan17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268417 MGI:2679270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216799 MGI:2653833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257962 MGI:3030056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668157 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins pseudo : _no_value

name	Olfr223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258421 MGI:3030057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3UM0-970645-971221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257835
definition	note : olfactory receptor GA_x5J8B7W3UM0-970645-971221 pseudo : _no_value

name	Olfr225 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257886 MGI:3030059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galnt10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877106 GeneID:171212 MGI:1890480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 transcript_id : NM_134189.2

name	Sap30l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487192 GeneID:50724 MGI:1354709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAP30-like transcript_id : NM_001081168.1

name	Hand1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130896 GeneID:15110 MGI:103577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heart and neural crest derivatives expressed transcript 1 transcript_id : NM_008213.2

name	Larp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261893 GeneID:73158 MGI:1890165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 276 ESTs, 1 Protein product : La ribonucleoprotein domain family, member 1 transcript_id : XM_126172.8

name	Cnot8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130316 GeneID:69125 MGI:1916375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 8 transcript_id : NM_026949.3

name	Gemin5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350379 GeneID:216766 MGI:2449311
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gem (nuclear organelle) associated protein 5 transcript_id : NM_172558.2

name	Mrpl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364233 GeneID:216767 MGI:1333794
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L22 transcript_id : NM_175001.2

name	Irgb10 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261922 GeneID:631323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 23 Proteins product : interferon-gamma-inducible p47 GTPase transcript_id : XM_905096.3

name	Igtp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801713 GeneID:16145 MGI:107729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon gamma induced GTPase transcript_id : NM_018738.3

name	LOC100041816 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261923 GeneID:100041816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041816 transcript_id : XM_001477459.1

name	EG668249 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261895 GeneID:668249 MGI:3647636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668249 transcript_id : XM_001000346.2

name	4930438A08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261925 GeneID:73988 MGI:1921238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : RIKEN cDNA 4930438A08 gene transcript_id : XM_001477470.1

name	Zfp692 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817089 GeneID:103836 MGI:2144276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 692 transcript_id : NM_182996.3

name	Zfp692 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817069 GeneID:103836 MGI:2144276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 692 transcript_id : NM_001040686.1

name	Zfp672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382632 GeneID:319475 MGI:2442105
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 672 transcript_id : NM_178761.3

name	1700047K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261897 GeneID:73335 MGI:1920585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700047K16 gene transcript_id : XM_001475609.1

name	Sh3bp5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363838 GeneID:79566 MGI:1933124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 binding domain protein 5 like transcript_id : NM_024480.3

name	2210415F13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949232 GeneID:70163 MGI:1917413
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210415F13 gene transcript_id : NM_001083884.1

name	2210415F13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948225 GeneID:70163 MGI:1917413
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210415F13 gene transcript_id : NM_027339.2

name	LOC624814 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261927 GeneID:624814
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 275 ESTs, 6 Proteins product : similar to NADH dehydrogenase (ubiquinone) Fe-S protein 3 transcript_id : XM_889356.3

name	1810065E05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312451 GeneID:69864 MGI:1917114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810065E05 gene transcript_id : NM_027239.1

name	OTTMUSG00000005737 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865924 GeneID:624860 MGI:3651568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000005737 transcript_id : NM_001045542.1

name	4930504O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349047 GeneID:403200 MGI:2685370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930504O13 gene transcript_id : NM_207527.2

name	Olfr30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203796 GeneID:18329 MGI:109305
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 30 transcript_id : NM_146878.1

name	Olfr332 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801317 GeneID:257932 MGI:3030166
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 332 transcript_id : NM_001011770.1

name	Olfr331 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801479 GeneID:258179 MGI:3030165
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 331 transcript_id : NM_001011861.1

name	Olfr330 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129126 GeneID:258879 MGI:3030164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 330 transcript_id : NM_146879.1

name	Olfr329 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372141 GeneID:259148 MGI:3030163
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 329 transcript_id : NM_001011531.1

name	Olfr328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238895 GeneID:258495 MGI:3030162
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 328 transcript_id : NM_146502.1

name	Olfr325 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391068 GeneID:258261 MGI:3030159
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 325 transcript_id : NM_207153.1

name	Olfr324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801279 GeneID:257892 MGI:3030158
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 324 transcript_id : NM_001011743.1

name	2210407C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362344 GeneID:78354 MGI:1925604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210407C18 gene transcript_id : NM_144544.1

name	Olfr323 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129552 GeneID:258373 MGI:3030157
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 323 transcript_id : NM_146376.1

name	Trim58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794598 GeneID:216781 MGI:2684862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 58 transcript_id : NM_001039047.1

name	Olfr216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125991241 GeneID:404346 MGI:3030050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 216 transcript_id : NM_207693.1

name	Olfr320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402210 GeneID:216783 MGI:3030154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 320 transcript_id : NM_207230.1

name	Olfr319 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238879 GeneID:258493 MGI:3030153
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 319 transcript_id : NM_146500.1

name	Olfr318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238885 GeneID:258494 MGI:3030152
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 318 transcript_id : NM_146501.1

name	Olfr317 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801315 GeneID:257931 MGI:3030151
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 317 transcript_id : NM_001011769.1

name	Olfr316 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374163 GeneID:258064 MGI:3030150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 316 transcript_id : NM_001011818.2

name	Olfr315 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238897 GeneID:258531 MGI:3030149
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 315 transcript_id : NM_146538.1

name	Olfr314 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801307 GeneID:257917 MGI:3030148
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 314 transcript_id : NM_001011760.1

name	3100002J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390085 GeneID:75429 MGI:1922679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 1 Protein product : RIKEN cDNA 3100002J23 gene, transcript variant 2 transcript_id : XM_001002726.1

name	3100002J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390087 GeneID:75429 MGI:1922679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA 3100002J23 gene, transcript variant 1 transcript_id : XM_001002721.1

name	Olfr313 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239057 GeneID:258529 MGI:3030147
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 313 transcript_id : NM_146536.1

name	Olfr312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801401 GeneID:258065 MGI:3030146
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 312 transcript_id : NM_001011819.1

name	Olfr311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239063 GeneID:258530 MGI:3030145
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 311 transcript_id : NM_146537.1

name	2810021J22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254208 GeneID:69944 MGI:1917194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810021J22 gene transcript_id : NM_172403.2

name	Zfp39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816961 GeneID:22698 MGI:99183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 39 transcript_id : NM_011758.2

name	Butr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149769 GeneID:192194 MGI:2182073
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin related 1 transcript_id : NM_138678.1

name	Rnf187 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390125 GeneID:108660 MGI:1914224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 343 ESTs, 3 Proteins product : ring finger protein 187 transcript_id : XM_905766.2

name	LOC676691 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261899 GeneID:676691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 223 ESTs product : hypothetical LOC676691 transcript_id : XM_001476054.1

name	Hist3h2ba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347259 GeneID:78303 MGI:1925553
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 3, H2ba transcript_id : NM_030082.2

name	Hist3h2bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46049028 GeneID:382522 MGI:1922442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 3, H2bb transcript_id : NM_206882.1

name	Hist3h2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376228 GeneID:319162 MGI:2448458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 3, H2a transcript_id : NM_178218.3

name	LOC382523 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390129 GeneID:382523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to histone H3 transcript_id : XM_356549.3

name	Trim17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802118 GeneID:56631 MGI:1861440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 17 transcript_id : NM_031172.2

name	Trim11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716454 GeneID:94091 MGI:2137355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 11 transcript_id : NM_053168.1

name	Obscn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491853 GeneID:380698 MGI:2681862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF transcript_id : NM_001003914.1

name	A230051G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802558 GeneID:216792 MGI:3041174
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230051G13 gene transcript_id : NM_173785.4

name	Gja12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803307 GeneID:118454 MGI:2153060
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 12 transcript_id : NM_080454.3

name	Gja12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802174 GeneID:118454 MGI:2153060
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 12 transcript_id : NM_175452.3

name	Guk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982306 GeneID:14923 MGI:95871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate kinase 1 transcript_id : NM_008193.2

name	Mrpl55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356932 GeneID:67212 MGI:1914462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L55 transcript_id : NM_026035.2

name	2310033P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129814 GeneID:67862 MGI:1915112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310033P09 gene transcript_id : NM_024210.2

name	Arf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560734 GeneID:11840 MGI:99431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor 1 transcript_id : NM_007476.2

name	Wnt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106446 GeneID:22416 MGI:98956
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 3A transcript_id : NM_009522.1

name	Wnt9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778750 GeneID:216795 MGI:2446084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-type MMTV integration site 9A transcript_id : NM_139298.2

name	Gm249 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865888 GeneID:216797 MGI:2685095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 249, (NCBI) transcript_id : NM_001045521.1

name	1110031B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130016 GeneID:67826 MGI:1915076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110031B06 gene transcript_id : NM_144521.2

name	Jmjd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345585 GeneID:194952 MGI:2144404
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 4 transcript_id : NM_178659.4

name	BC050078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364725 GeneID:237775 MGI:2681848
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050078 transcript_id : NM_178417.2

name	Zkscan17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982134 GeneID:268417 MGI:2679270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 17 transcript_id : NM_172941.2

name	Nlrp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130221 GeneID:216799 MGI:2653833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 3 transcript_id : NM_145827.3

name	Olfr222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801343 GeneID:257962 MGI:3030056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 222 transcript_id : NM_001011789.1

name	Olfr223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238927 GeneID:258421 MGI:3030057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 223 transcript_id : NM_146429.1

name	Olfr225 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801273 GeneID:257886 MGI:3030059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 225 transcript_id : NM_001011740.1

name	Galnt10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877107 CCDS:CCDS24719.1 GeneID:171212 MGI:1890480
definition	EC_number : 2.4.1.41 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence IDA] codon_start : 1 note : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9; UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 9 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 protein_id : NP_598950.2

name	Sap30l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487193 GeneID:50724 MGI:1354709
definition	codon_start : 1 product : SAP30-like protein_id : NP_001074637.1

name	Hand1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680165 CCDS:CCDS24721.1 GeneID:15110 MGI:103577
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IGI] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IMP] [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : heart and neural crest derivatives expressed transcript 1 protein_id : NP_032239.1

name	Larp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261894 GeneID:73158 MGI:1890165
definition	codon_start : 1 product : la related protein protein_id : XP_126172.6

name	Cnot8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386186 CCDS:CCDS24722.1 GeneID:69125 MGI:1916375
definition	GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016564 - transcriptional repressor activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCR4-NOT transcription complex, subunit 8 protein_id : NP_081225.1

name	Gemin5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369782 CCDS:CCDS24723.1 GeneID:216766 MGI:2449311
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 exception : mismatches in translation product : gem (nuclear organelle) associated protein 5 protein_id : NP_766146.1

name	Mrpl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239387 CCDS:CCDS24724.1 GeneID:216767 MGI:1333794
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein L22 protein_id : NP_778166.1

name	Irgb10 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390113 GeneID:631323
definition	codon_start : 1 product : similar to interferon-gamma-inducible p47 GTPase protein_id : XP_910189.2

name	Igtp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980875 CCDS:CCDS24725.1 GeneID:16145 MGI:107729
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0003924 - GTPase activity [Evidence IDA] codon_start : 1 exception : mismatches in translation product : interferon gamma induced GTPase protein_id : NP_061208.2

name	LOC100041816 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261924 GeneID:100041816
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477509.1

name	EG668249 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261896 GeneID:668249 MGI:3647636
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000346.2

name	4930438A08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261926 GeneID:73988 MGI:1921238
definition	codon_start : 1 product : hypothetical protein LOC73988 protein_id : XP_001477520.1

name	Zfp692 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817070 GeneID:103836 MGI:2144276
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 692 protein_id : NP_001035776.1

name	Zfp692 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817090 GeneID:103836 MGI:2144276
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 692 protein_id : NP_892041.2

name	Zfp672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520221 CCDS:CCDS24727.1 GeneID:319475 MGI:2442105
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 672 protein_id : NP_848876.1

name	1700047K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261898 GeneID:73335 MGI:1920585
definition	codon_start : 1 product : hypothetical protein LOC73335 protein_id : XP_001475659.1

name	Sh3bp5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981394 CCDS:CCDS24728.1 GeneID:79566 MGI:1933124
definition	codon_start : 1 exception : mismatches in translation product : SH3 binding domain protein 5 like protein_id : NP_077800.2

name	2210415F13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949233 GeneID:70163 MGI:1917413
definition	codon_start : 1 product : RIKEN cDNA 2210415F13 protein_id : NP_001077353.1

name	2210415F13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948226 GeneID:70163 MGI:1917413
definition	codon_start : 1 product : RIKEN cDNA 2210415F13 protein_id : NP_081615.2

name	LOC624814 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82934613 GeneID:624814
definition	codon_start : 1 product : similar to NADH dehydrogenase (ubiquinone) Fe-S protein 3 protein_id : XP_894449.1

name	1810065E05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312452 CCDS:CCDS24730.1 GeneID:69864 MGI:1917114
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69864 protein_id : NP_081515.1

name	OTTMUSG00000005737 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865925 GeneID:624860 MGI:3651568
definition	codon_start : 1 product : hypothetical protein LOC624860 protein_id : NP_001039007.1

name	4930504O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430514 CCDS:CCDS24731.1 GeneID:403200 MGI:2685370
definition	codon_start : 1 product : hypothetical protein LOC403200 protein_id : NP_997410.1

name	Olfr30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203797 CCDS:CCDS24732.1 GeneID:18329 MGI:109305
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NKPP-957001-957948; olfactory receptor MOR281-1 product : olfactory receptor 30 protein_id : NP_667089.1

name	Olfr332 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801318 GeneID:257932 MGI:3030166
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2NKPP-926908-927915; olfactory receptor MOR284-2 product : olfactory receptor 332 protein_id : NP_001011770.1

name	Olfr331 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801480 GeneID:258179 MGI:3030165
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2NKPP-912840-913784; olfactory receptor MOR275-4 product : olfactory receptor 331 protein_id : NP_001011861.1

name	Olfr330 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129127 CCDS:CCDS24733.1 GeneID:258879 MGI:3030164
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NKPP-895420-896349; olfactory receptor MOR275-1 product : olfactory receptor 330 protein_id : NP_667090.1

name	Olfr329 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372142 GeneID:259148 MGI:3030163
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-882068-883006; olfactory receptor MOR275-6P product : olfactory receptor 329 protein_id : NP_001011531.1

name	Olfr328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238896 CCDS:CCDS24734.1 GeneID:258495 MGI:3030162
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-873285-874217; olfactory receptor MOR275-2 product : olfactory receptor 328 protein_id : NP_666713.1

name	Olfr325 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391069 GeneID:258261 MGI:3030159
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-844642-843680; MOR275-11_p; olfactory receptor MOR275-5 product : olfactory receptor 325 protein_id : NP_997036.1

name	Olfr324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801280 CCDS:CCDS24735.1 GeneID:257892 MGI:3030158
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-822947-822000; olfactory receptor MOR102-2 product : olfactory receptor 324 protein_id : NP_001011743.1

name	2210407C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362345 CCDS:CCDS24736.1 GeneID:78354 MGI:1925604
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC78354 protein_id : NP_653127.1

name	Olfr323 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129553 CCDS:CCDS24737.1 GeneID:258373 MGI:3030157
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-794386-795357; olfactory receptor MOR107-1 product : olfactory receptor 323 protein_id : NP_666488.1

name	Trim58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794599 CCDS:CCDS24738.1 GeneID:216781 MGI:2684862
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif-containing 58 protein_id : NP_001034136.1

name	Olfr216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125991242 GeneID:404346 MGI:3030050
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02SYUPNB-557-3 product : olfactory receptor 216 protein_id : NP_997576.1

name	Olfr320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402211 CCDS:CCDS24739.1 GeneID:216783 MGI:3030154
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2NKPP-730312-729392 product : olfactory receptor 320 protein_id : NP_997113.1

name	Olfr319 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238880 CCDS:CCDS24740.1 GeneID:258493 MGI:3030153
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-708319-707399; olfactory receptor MOR285-2 product : olfactory receptor 319 protein_id : NP_666711.1

name	Olfr318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238886 CCDS:CCDS24741.1 GeneID:258494 MGI:3030152
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-692816-693736; olfactory receptor MOR285-1 product : olfactory receptor 318 protein_id : NP_666712.1

name	Olfr317 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801316 CCDS:CCDS24742.1 GeneID:257931 MGI:3030151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-680866-681849; olfactory receptor MOR256-47; GA_x5J8B7W3KVV-2795544-2795410 product : olfactory receptor 317 protein_id : NP_001011769.1

name	Olfr316 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374164 CCDS:CCDS24743.1 GeneID:258064 MGI:3030150
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NKPP-648708-647788; olfactory receptor MOR285-3P product : olfactory receptor 316 protein_id : NP_001011818.2

name	Olfr315 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238898 CCDS:CCDS24744.1 GeneID:258531 MGI:3030149
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NKPP-630272-629343; olfactory receptor MOR278-1 product : olfactory receptor 315 protein_id : NP_666749.1

name	Olfr314 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801308 CCDS:CCDS24745.1 GeneID:257917 MGI:3030148
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NKPP-622179-621244; olfactory receptor MOR278-2 product : olfactory receptor 314 protein_id : NP_001011760.1

name	3100002J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390088 GeneID:75429 MGI:1922679
definition	codon_start : 1 product : hypothetical protein LOC75429 isoform 1 protein_id : XP_001002721.1

name	3100002J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390086 GeneID:75429 MGI:1922679
definition	codon_start : 1 product : hypothetical protein LOC75429 isoform 2 protein_id : XP_001002726.1

name	Olfr313 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239058 CCDS:CCDS24748.1 GeneID:258529 MGI:3030147
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-590035-589109; olfactory receptor MOR222-2 product : olfactory receptor 313 protein_id : NP_666747.1

name	Olfr312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801402 CCDS:CCDS24749.1 GeneID:258065 MGI:3030146
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NKPP-575829-574903; olfactory receptor MOR222-4P product : olfactory receptor 312 protein_id : NP_001011819.1

name	Olfr311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239064 CCDS:CCDS24750.1 GeneID:258530 MGI:3030145
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NKPP-565870-564944; olfactory receptor MOR222-1 product : olfactory receptor 311 protein_id : NP_666748.1

name	2810021J22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369519 CCDS:CCDS24751.1 GeneID:69944 MGI:1917194
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69944 protein_id : NP_765991.1

name	Zfp39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816962 CCDS:CCDS24752.1 GeneID:22698 MGI:99183
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 39 protein_id : NP_035888.2

name	Butr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149770 CCDS:CCDS24753.1 GeneID:192194 MGI:2182073
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : butyrophilin-like protein BUTR-1 product : butyrophilin related 1 protein_id : NP_619619.1

name	LOC676691 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261900 GeneID:676691
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476104.1

name	Rnf187 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390126 GeneID:108660 MGI:1914224
definition	codon_start : 1 product : ring finger protein 187 protein_id : XP_910859.2

name	Hist3h2ba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386452 CCDS:CCDS24754.1 GeneID:78303 MGI:1925553
definition	codon_start : 1 product : histone 3, H2ba protein_id : NP_084358.1

name	Hist3h2bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46049029 GeneID:382522 MGI:1922442
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 3, H2bb protein_id : NP_996765.1

name	Hist3h2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061353 CCDS:CCDS24755.1 GeneID:319162 MGI:2448458
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 3, H2a protein_id : NP_835736.1

name	LOC382523 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38091641 GeneID:382523
definition	codon_start : 1 product : similar to histone H3 protein_id : XP_356549.1

name	Trim17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859757 CCDS:CCDS24756.1 GeneID:56631 MGI:1861440
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : tripartite motif protein TRIM17; ring finger protein 16 product : tripartite motif protein 17 protein_id : NP_112449.1

name	Trim11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716455 GeneID:94091 MGI:2137355
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : tripartite motif protein 11 protein_id : NP_444398.1

name	Obscn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491854 CCDS:CCDS24757.1 GeneID:380698 MGI:2681862
definition	GO_component : GO:0005863 - striated muscle thick filament [Evidence ISS]; GO:0030018 - Z disc [Evidence ISS] GO_function : GO:0030506 - ankyrin binding [Evidence ISS]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : obscurin-MLCK product : obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF protein_id : NP_001003914.1

name	A230051G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424663 CCDS:CCDS24758.1 GeneID:216792 MGI:3041174
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004047 - aminomethyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006546 - glycine catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC216792 protein_id : NP_776146.1

name	Gja12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425188 CCDS:CCDS24760.1 GeneID:118454 MGI:2153060
definition	GO_component : GO:0005921 - gap junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005243 - gap-junction forming channel activity [Evidence IDA] GO_process : GO:0007267 - cell-cell signaling [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; connexin 47; connexin 47 type A; gap junction protein; connexin 47 type C; connexin 47 type D product : gap junction membrane channel protein alpha 12 isoform 2 protein_id : NP_780661.1

name	Gja12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28565279 CCDS:CCDS24761.1 GeneID:118454 MGI:2153060
definition	GO_component : GO:0005921 - gap junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005243 - gap-junction forming channel activity [Evidence IDA] GO_process : GO:0007267 - cell-cell signaling [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; connexin 47; connexin 47 type A; gap junction protein; connexin 47 type C; connexin 47 type D product : gap junction membrane channel protein alpha 12 isoform 1 protein_id : NP_536702.2

name	Guk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680137 CCDS:CCDS24762.1 GeneID:14923 MGI:95871
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004385 - guanylate kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : guanylate kinase 1 protein_id : NP_032219.1

name	Mrpl55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313400 CCDS:CCDS24763.1 GeneID:67212 MGI:1914462
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : mitochondrial ribosomal protein L55 protein_id : NP_080311.1

name	2310033P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13259376 CCDS:CCDS24764.1 GeneID:67862 MGI:1915112
definition	codon_start : 1 product : hypothetical protein LOC67862 protein_id : NP_077172.1

name	Arf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680716 CCDS:CCDS24765.1 GeneID:11840 MGI:99431
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0012505 - endomembrane system [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030017 - sarcomere [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 product : ADP-ribosylation factor 1 protein_id : NP_031502.1

name	Wnt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106447 CCDS:CCDS24766.1 GeneID:22416 MGI:98956
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IDA]; GO:0007409 - axonogenesis [Evidence IGI] [Evidence IDA]; GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0001947 - heart looping [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IDA]; GO:0042472 - inner ear morphogenesis [Evidence IGI]; GO:0030879 - mammary gland development [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0045595 - regulation of cell differentiation [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS]; GO:0048103 - somatic stem cell division [Evidence IDA]; GO:0001756 - somitogenesis [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : vestigial tail product : wingless-related MMTV integration site 3A protein_id : NP_033548.1

name	Wnt9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314846 GeneID:216795 MGI:2446084
definition	GO_process : GO:0035117 - embryonic arm morphogenesis [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : wingless-type MMTV integration site 14 product : wingless-type MMTV integration site 9A protein_id : NP_647459.1

name	Gm249 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865889 GeneID:216797 MGI:2685095
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : marapsin 2 protein_id : NP_001038986.1

name	1110031B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362303 CCDS:CCDS24767.1 GeneID:67826 MGI:1915076
definition	codon_start : 1 product : hypothetical protein LOC67826 protein_id : NP_653104.1

name	Jmjd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520031 CCDS:CCDS24768.1 GeneID:194952 MGI:2144404
definition	codon_start : 1 product : jumonji domain containing 4 protein_id : NP_848774.1

name	BC050078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626173 CCDS:CCDS24769.1 GeneID:237775 MGI:2681848
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : novel zinc finger domain-containing protein product : hypothetical protein LOC237775 protein_id : NP_848504.1

name	Zkscan17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982135 CCDS:CCDS24770.1 GeneID:268417 MGI:2679270
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 496 protein_id : NP_766529.2

name	Nlrp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003870 CCDS:CCDS24771.1 GeneID:216799 MGI:2653833
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0042834 - peptidoglycan binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006952 - defense response [Evidence ISS]; GO:0009595 - detection of biotic stimulus [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS]; GO:0032088 - inhibition of NF-kappaB transcription factor [Evidence ISS]; GO:0042347 - negative regulation of NF-kappaB import into nucleus [Evidence ISS]; GO:0043280 - positive regulation of caspase activity [Evidence ISS]; GO:0050718 - positive regulation of interleukin-1 beta secretion [Evidence ISS]; GO:0051259 - protein oligomerization [Evidence ISS] codon_start : 1 note : cryopyrin; mast cell maturation inducible protein 1; NACHT/LRR/pyrin domain-containing protein 3 product : cold autoinflammatory syndrome 1 homolog protein_id : NP_665826.1

name	Olfr222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801344 CCDS:CCDS24772.1 GeneID:257962 MGI:3030056
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02SYYHDF-1415-2371; olfactory receptor MOR256-45P product : olfactory receptor 222 protein_id : NP_001011789.1

name	Olfr223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238928 CCDS:CCDS24773.1 GeneID:258421 MGI:3030057
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T000SA-78-1037; olfactory receptor MOR256-30; novel 7 transmembrane receptor (rhodopsin family) domain-containing protein product : olfactory receptor 223 protein_id : NP_666640.1

name	Olfr225 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801274 GeneID:257886 MGI:3030059
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T0073K-490-1545; olfactory receptor MOR256-51 product : olfactory receptor 225 protein_id : NP_001011740.1

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 9 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 8 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 7 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 6 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 5 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 4 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 3 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 2 pseudo : _no_value

name	LOC676527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676527
definition	number : 1 pseudo : _no_value

name	LOC668058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668058
definition	number : 3 pseudo : _no_value

name	LOC668058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668058
definition	number : 2 pseudo : _no_value

name	LOC668058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668058
definition	number : 1 pseudo : _no_value

name	LOC667947 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261921 GeneID:667947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 ESTs, 3 Proteins product : similar to RIKEN cDNA A430005L14 gene pseudo : _no_value transcript_id : XR_033143.1

name	4930543L23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261930 GeneID:75171 MGI:1922421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930543L23 gene transcript_id : XR_035351.1

name	LOC432565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261931 GeneID:432565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 11 Proteins product : similar to Ariadne-2 protein (ARI2) pseudo : _no_value transcript_id : XR_033605.1

name	LOC668157 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261905 GeneID:668157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_032580.1

clone name	MSMg01-486D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-418M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235O06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-490C12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-494H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-326D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-061F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-481N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-179L16.b	B6Ng01-179L16.g
ACC	GA006369	GA006370
length	1,001	1,013
definition	B6Ng01-179L16.b	B6Ng01-179L16.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaactgaggaatacagaagggcggagaaacacctgtaaaaaat gttcaacatctgtactggttagttttgtgtcaacttgacacagctggagt tatagagaaaggagcttcagttgaggaaatgcctccatgagatccaactg taaggcattttctcaattagagatcaagggggaaaggccccttgtgggtc ggaccatctctgggctggtaatcttggattctataagagagcaggttgaa caagccaggagaagcaagccagtaatgaacatccctccatgacctctgca tcagctcctgctttctgacctgcttgagttccagtcctgacttccttggt gatgaacagcagtatggaagtgtaagctgaataaaccctttcctccccaa cttgcttcttggtcataatgtttgtgcaggaatagaaaccctaactaaga caaattggtaccagaagtggggtattcctgtgacactctgatcatgtttt ggggaggactttggaagaactttggaactttgggccagaagatccattct gtgttaagagctctgttgaatgttgtgtaggagcttcgaatataatgttg agaacagtgcagaagatggaggcctggcttatgaaatttctgagggaaga ttaaagacttttctcagggccattgatagttttgattgtgaagatttctg tggttctggttagctggggctgaagaatcagctgtgattaacaagatacc agaactactaaagcaaaaactttgcattactgggactattgattgctggt tagttgggatctaaggaattagcgatgattaaagaagagatcagcatcat tgagatgacatctttctgggaagtgttttctgaagcacagaggcttgtgt ttccagagatagccaaggttgtaaacttggtgttgtggctggaacttggt taatgtgtagaagttaccccaggtatgtactgtgttttagaaaggcatga a	gaattcaaggccagcctggtctacagaggaggcttcaggacagtcagggt tacacagataaccctgtctcaaacagaacaaaacacacaaatgaagaaga agagggagaggagatagaaaaaggggaaacagaggaggaaaggaaggaaa gcaagcaaggaaggaaacaagcaaattggacaataagtgaagcctcgaat cccaagacggaaagatctctggatccccttttcctccctgtctcttttgt ttgtttgtttcttttttagaaagtccataattaaaccaccttaaaattcc aggttataagagaagaaatgcttggcaccgcagacgcttttacttattcg ttcttaccgcgagggcacttcagacttatctttttccattcattctttgt acggctattggataacatcaaactctgggtctaaaaggccagcttagcag tgctttagaggaacttctgtgcccaagttcaaactaaaccagatcctagt gcttgaggcactgtgtgtgcagggtccctacgtagtgagggcacttcctt tcactctggctctgtagaccccacacttggttctcacgatttttctcaca gcttctttgaagtctttgtttcctcaggctgtagataactggggttcagc agtggagtgaccacggtgtagaagacagaaatgaccttgttgagttccgg tgacagatgtgcatttgggcgcacatacatggagatcatggtcccgtagt agatggtgaccacagccaggtgggaaccacatgtagaaaacgtcttcatc ctgccggaagtggaggggattctcagaatggaggacactatgaaaacgta ggacaccagggttaggaggaaacagatacatagcacagcgatgggacagg acaaagattgtccattttctgtcacttagacactgggagcaggacagctg gattaacggagggaaggtcacagaaggatatgtgttgatgcctgtttggg tcccacagaagtc
quality values	Open. Hide. 42 25 18 28 48 49 50 32 19 36 52 47 47 45 33 43 45 39 32 47 54 38 48 62 62 48 62 47 54 56 62 47 11 12 11 8 13 8 8 8 10 10 7 8 8 10 12 11 51 39 47 59 62 59 44 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 46 59 16 24 10 10 21 23 25 18 21 18 18 18 11 18 28 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 50 62 62 59 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 56 62 59 54 54 62 62 56 62 62 62 62 62 62 62 59 54 54 62 62 59 54 62 62 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 59 50 59 59 62 62 62 62 54 54 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 48 48 48 45 56 51 62 62 62 62 62 62 62 62 62 62 59 56 62 62 59 62 59 59 62 59 56 46 38 38 59 51 32 33 35 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 56 56 62 62 62 62 62 62 62 62 62 62 47 56 43 43 56 56 62 62 43 62 56 56 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 47 47 62 62 56 62 56 56 54 47 56 62 56 47 54 62 56 62 62 56 56 56 56 56 46 62 62 62 62 62 62 62 62 62 62 62 62 42 62 54 48 62 62 62 62 62 52 62 62 52 62 62 62 62 41 62 62 62 62 42 31 47 47 62 62 45 52 62 35 52 52 43 33 31 52 58 54 44 33 54 52 28 52 40 42 54 58 41 42 41 54 58 54 54 54 58 42 49 42 37 31 52 31 52 54 54 54 58 47 54 24 58 52 58 58 32 28 22 21 21 19 19 42 58 50 41 58 58 38 41 52 38 26 6 24 34 28 37 30 54 58 58 39 52 42 39 31 52 52 33 45 28 12 44 58 52 53 41 45 39 23 8 58 13 36 54 58 35 50 34 11 27 32 36 54 58 51 39 50 40 52 49 37 58 58 48 40 53 39 38 31 21 53 29 39 53 33 33 42 51 51 35 52 50 50 54 31 52 53 31 40 30 47 50 31 25 22 18 46 58 24 48 35 33 42 40 32 32 35 37 37 31 50 58 48 31 32 54 58 41 37 39 40 32 13 9 32 32 39 29 40 28 31 35 41 46 32 35 21 10 7 21 27 14 22 26 7 21 9 15 21 37 35 50 23 41 33 45 17 41 21 12 22 28 29 20 58 58 19 19 21 24 16 24 33 18 52 26 37 22 8 46 35 24 51 22 22 50 32 16 14 21 12 7 17 15 32 34 37 52 26 49 40 23 39 29 19 13 15 8 32 13 16 23 54 54 18 20 32 9 9 14 18 32 25 25 24 18 17 24 15 9 9 9 25 33 23 31 6 18 15 29 7 9 20 21 6 47 8 14 18 7 6 28 9 16 14 9 9 23 17 13 34 29 25 22 19 34 12 24 40 15 11 13 27 16 6 13 16 6 10 10 9 21 23 6 32 26 32 20 9 11 21 19 17 25 10 17 21 30 11 21 9 12 14 33 6 15 24 7 22 19 23 33 26 41 21 23 18 12 9 6 13 9 6 16 26 14 16 7 18 29 30 25 27 7 6 23 19 7 10 23 12 31 6 25 11 13	Open. Hide. 62 47 41 41 62 38 30 47 62 62 62 47 26 11 35 20 10 6 8 10 8 6 10 7 6 12 11 47 62 43 44 62 59 62 62 62 51 59 62 59 59 59 62 62 62 62 62 62 59 62 49 62 62 62 62 59 56 28 24 13 18 34 34 27 23 24 21 18 17 17 18 18 39 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 56 56 62 56 56 59 56 50 54 48 49 54 46 56 54 54 54 59 62 54 48 48 49 54 56 56 50 50 43 43 49 43 34 37 46 56 46 51 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 54 62 56 62 62 59 62 59 59 62 59 62 59 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 56 62 56 62 62 59 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 48 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 49 50 51 51 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 50 34 29 45 34 32 28 46 59 62 62 62 62 62 59 62 59 62 56 62 51 59 59 56 59 62 59 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 56 56 56 56 47 56 18 10 14 9 10 12 62 62 62 62 56 51 47 47 56 42 51 56 36 50 62 62 56 62 62 62 62 62 62 62 62 56 62 62 56 56 42 47 62 62 62 62 56 62 62 62 62 62 62 47 37 47 56 56 56 56 43 38 47 37 62 56 62 62 62 56 62 56 56 56 46 56 56 56 54 37 62 62 62 62 62 52 62 62 54 62 22 41 8 52 33 62 52 43 48 35 47 54 25 35 42 26 27 21 27 39 52 52 62 62 62 52 47 43 41 52 52 42 43 42 43 43 38 62 46 52 40 42 49 21 12 22 37 50 32 52 32 52 52 43 22 48 41 10 42 19 28 47 34 49 32 43 48 48 39 50 52 48 37 18 25 25 42 23 25 17 25 58 33 52 32 44 34 33 31 32 41 35 30 32 32 42 28 58 54 52 54 52 52 33 30 39 22 41 29 52 42 45 39 52 54 38 45 27 50 35 40 30 26 32 30 9 23 30 35 31 36 23 9 12 21 16 40 30 34 25 9 34 46 31 42 41 46 31 31 26 37 27 30 26 21 50 46 24 22 36 19 47 24 25 16 27 25 15 10 14 24 42 27 38 27 23 25 31 36 24 27 7 27 28 24 18 24 16 40 24 12 27 25 27 17 40 29 32 7 40 16 13 16 10 9 14 23 24 9 5 16 25 16 29 6 19 22 18 32 23 32 26 26 15 17 17 26 23 49 6 20 21 40 33 22 20 41 24 35 28 22 12 14 14 27 14 37 25 19 36 28 13 42 32 40 16 18 10 10 18 13 14 23 10 31 29 27 23 31 42 32 23 33 27 27 38 34 35 10 15 16 12 13 16 19 21 23 18 23 10 11 10 8 35 7 34 22 16 19 54 54 20 26 14 22 16 22 11 14 6 10 9 8 15 11 18 29 28 28 27 9 40 21 34 12 9 14 18 20 10 11 12 27 22 12 7 23 29 19 22 29 11 20 19 11 39 29 12 10 21 24 27 11 11 16 13 11 9 23 6 6 33 10 31 29 25 8 29 30 14 17 9 5 9 6 19 16 31 14 31 16 31 18 9 6 31 42 7 6 20 9 5 15 8 7 27 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_58438048_58439048
seq2: B6Ng01-179L16.g_71_1083

seq1  GAATTCAAGGCCAGCCTGGTCTACAGAGGAGGCTTCAGGACAGTCAGGGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGGCCAGCCTGGTCTACAGAGGAGGCTTCAGGACAGTCAGGGT  50

seq1  TACACAGATAACCCTGTCTCAAACAGAACAAAACACACAAATGAAGAAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACAGATAACCCTGTCTCAAACAGAACAAAACACACAAATGAAGAAGA  100

seq1  AGAGGGAGAGGAGATAGAAAAAGGGGAAACAGAGGAGGAAAGGAAGGAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGGAGAGGAGATAGAAAAAGGGGAAACAGAGGAGGAAAGGAAGGAAA  150

seq1  GCAAGCAAGGAAGGAAACAAGCAAATTGGACAATAAGTGAAGCCTCGAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGCAAGGAAGGAAACAAGCAAATTGGACAATAAGTGAAGCCTCGAAT  200

seq1  CCCAAGACGGAAAGATCTCTGGATCCCCTTTTCCTCCCTGTCTCTTTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGACGGAAAGATCTCTGGATCCCCTTTTCCTCCCTGTCTCTTTTGT  250

seq1  TTGTTTGTTTCTTTTTTAGAAAGTCCATAATTAAACCACCTTAAAATTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTGTTTCTTTTTTAGAAAGTCCATAATTAAACCACCTTAAAATTCC  300

seq1  AGGTTATAAGAGAAGAAATGCTTGGCACCGCAGACGCTTTTACTTATTCG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTATAAGAGAAGAAATGCTTGGCACCGCAGACGCTTTTACTTATTCG  350

seq1  TTCTTACCGCGAGGGCACTTCAGACTTATCTTTTTCCATTCATTCTTTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTACCGCGAGGGCACTTCAGACTTATCTTTTTCCATTCATTCTTTGT  400

seq1  ACGGCTATTGGATAACATCAAACTCTGGGTCTAAAAGGCCAGCTTAGCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGCTATTGGATAACATCAAACTCTGGGTCTAAAAGGCCAGCTTAGCAG  450

seq1  TGCTTTAGAGGAACTTCTGTGCCCAAGTTCAAACTAAACCAGATCCTAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTTAGAGGAACTTCTGTGCCCAAGTTCAAACTAAACCAGATCCTAGT  500

seq1  GCTTGAGGCACTGTGTGTGCAGGGTCCCTACGTAGTGAGGGCACTTCCTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGAGGCACTGTGTGTGCAGGGTCCCTACGTAGTGAGGGCACTTCCTT  550

seq1  TCACTCTGGCTCTGTAGACCCCACACTTGGTTCTCACGATTTTTCTCACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCTGGCTCTGTAGACCCCACACTTGGTTCTCACGATTTTTCTCACA  600

seq1  GCTTCTTTGAAGTCTTTG-TTCCTCAGGCTGTAGATAACT-GGGTTCAGC  648
      |||||||||||||||||| ||||||||||||||||||||| |||||||||
seq2  GCTTCTTTGAAGTCTTTGTTTCCTCAGGCTGTAGATAACTGGGGTTCAGC  650

seq1  AGTGGAGTGACCACGGTGTAGAAGACAGAAATGACCTTGTTGAGTTCCGG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGAGTGACCACGGTGTAGAAGACAGAAATGACCTTGTTGAGTTCCGG  700

seq1  TGACAGATGTGCATTTGGGCGCACATACATGGAGATCATGGTCCCGTAGT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGATGTGCATTTGGGCGCACATACATGGAGATCATGGTCCCGTAGT  750

seq1  AGATGGTGACCACAGCCAGGTGGGAACCACATGTAGAAAACGTCTTCATC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGTGACCACAGCCAGGTGGGAACCACATGTAGAAAACGTCTTCATC  800

seq1  CTGCCGGAAGTGGAGGGGATTCTCAGAATGGAGGACACTATGAAAACGTA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCGGAAGTGGAGGGGATTCTCAGAATGGAGGACACTATGAAAACGTA  850

seq1  GGACACCAGGGTTAGGAGGAAACAGATACATAGCACAGCGAT-GGACAGG  897
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GGACACCAGGGTTAGGAGGAAACAGATACATAGCACAGCGATGGGACAGG  900

seq1  ACAAAGA-TGGCCA-TTTCTGTCACATAGACACT-GGAGCAGGACAGCTG  944
      ||||||| || ||| |||||||||| |||||||| |||||||||||||||
seq2  ACAAAGATTGTCCATTTTCTGTCACTTAGACACTGGGAGCAGGACAGCTG  950

seq1  GATTAACGGAGGG-AGGTCACAGAA-GAAATG-GTTGATGC--GGTTGGG  989
      ||||||||||||| ||||||||||| || ||| ||||||||  | |||||
seq2  GATTAACGGAGGGAAGGTCACAGAAGGATATGTGTTGATGCCTGTTTGGG  1000

seq1  -CCCACAGAAGTC  1001
       ||||||||||||
seq2  TCCCACAGAAGTC  1013

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information