MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-214N12
Chromosome	11 (Build37)
Map Location	71,735,424 - 71,916,801
singlet/doublet	doublet
Overlap gene	Aipl1, 6720460F02Rik, Pitpnm3
Upstream gene	Rabep1, Nup88, Rpain, C1qbp, Dhx33, Derl2, Mis12, 6330403K07Rik, LOC382536, Nlrp1a, Nlrp1b, Nlrp1c, LOC100043249, 9230020A06Rik, Wscd1
Downstream gene	4933427D14Rik, Txnl5, Med31, 4930563E22Rik, Slc13a5, Fbxo39, LOC628100, Tekt1, D130058I21Rik, Ggt6, Mybbp1a, 9830002I17Rik, LOC432577, Ube2g1, Ankfy1, Cyb5d2, Zzef1, LOC627119, Atp2a3, P2rx1, LOC100043309, Camkk1, 1200014J11Rik, Itgae
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rabep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54189 MGI:1860236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpain (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69723 MGI:1916973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12261 MGI:1194505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216877 MGI:2445102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Derl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116891 MGI:2151483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mis12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67139 MGI:1914389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330403K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103712 MGI:1918001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382536
definition	note : RNA binding motif protein 7 pseudogene pseudo : _no_value

name	Nlrp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195046 MGI:2684861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637515 MGI:3582959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627984 MGI:3582962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein pseudo : _no_value

name	9230020A06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619299 MGI:3588244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Wscd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216881 MGI:2448493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aipl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114230 MGI:2148800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6720460F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109212 MGI:1924434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitpnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327958 MGI:2685726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933427D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74477 MGI:1921727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52700 MGI:1289248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67279 MGI:1914529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930563E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75304 MGI:1922554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs

name	Slc13a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237831 MGI:3037150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327959 MGI:3505735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins

name	Tekt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21689 MGI:1333819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D130058I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276829 MGI:2442764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71522 MGI:1918772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybbp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18432 MGI:106181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830002I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77577 MGI:1924827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 607 ESTs, 13 Proteins pseudo : _no_value

name	Ube2g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67128 MGI:1914378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankfy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11736 MGI:1337008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192986 MGI:2684848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zzef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195018 MGI:2444286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 292 ESTs, 7 Proteins pseudo : _no_value

name	Atp2a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53313 MGI:1194503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18436 MGI:1098235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043309 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Camkk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55984 MGI:1891766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200014J11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66874 MGI:1914124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rabep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507020 GeneID:54189 MGI:1860236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabaptin, RAB GTPase binding effector protein 1 transcript_id : NM_019400.1

name	Nup88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955408 GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 88 transcript_id : NM_172394.2

name	Nup88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053893 GeneID:19069 MGI:104900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 88 transcript_id : NM_001083331.1

name	Rpain (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037172 GeneID:69723 MGI:1916973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RPA interacting protein transcript_id : NM_027186.1

name	C1qbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181166 GeneID:12261 MGI:1194505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent binding protein transcript_id : NM_007573.2

name	Dhx33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109637749 GeneID:216877 MGI:2445102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 33 transcript_id : NM_178367.4

name	Derl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130773 GeneID:116891 MGI:2151483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Der1-like domain family, member 2 transcript_id : NM_033562.3

name	Mis12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356584 GeneID:67139 MGI:1914389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MIS12 homolog (yeast) transcript_id : NM_025993.2

name	6330403K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21624634 GeneID:103712 MGI:1918001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330403K07 gene transcript_id : NM_134022.1

name	Nlrp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921280 GeneID:195046 MGI:2684861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1A transcript_id : NM_001004142.1

name	Nlrp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665739 GeneID:637515 MGI:3582959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1B transcript_id : NM_001040696.1

name	Nlrp1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986636 GeneID:627984 MGI:3582962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 1C transcript_id : NM_001039234.1

name	Wscd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475951 GeneID:216881 MGI:2448493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WSC domain containing 1 transcript_id : NM_177618.4

name	Aipl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426862 GeneID:114230 MGI:2148800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor-interacting protein-like 1 transcript_id : NM_053245.1

name	6720460F02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388016 GeneID:109212 MGI:1924434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720460F02 gene transcript_id : NM_144526.3

name	Pitpnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032318 GeneID:327958 MGI:2685726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PITPNM family member 3 transcript_id : NM_001081641.1

name	Pitpnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032351 GeneID:327958 MGI:2685726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PITPNM family member 3 transcript_id : NM_001024927.2

name	4933427D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130566 GeneID:74477 MGI:1921727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933427D14 gene transcript_id : NM_028963.2

name	Txnl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801882 GeneID:52700 MGI:1289248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin-like 5 transcript_id : NM_026559.3

name	Med31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119161 GeneID:67279 MGI:1914529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 31 homolog (yeast) transcript_id : NM_026068.2

name	4930563E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390195 GeneID:75304 MGI:1922554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs product : RIKEN cDNA 4930563E22 gene, transcript variant 1 transcript_id : XM_618902.3

name	Slc13a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385951 GeneID:237831 MGI:3037150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 transcript_id : NM_001004148.3

name	Fbxo39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803481 GeneID:327959 MGI:3505735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 39 transcript_id : NM_001037713.2

name	LOC628100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261980 GeneID:628100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to novel F-box domain containing protein transcript_id : XM_892822.3

name	Tekt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956378 GeneID:21689 MGI:1333819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 1 transcript_id : NM_011569.2

name	D130058I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130489 GeneID:276829 MGI:2442764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130058I21 gene transcript_id : NM_177776.3

name	Ggt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647221 GeneID:71522 MGI:1918772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyltransferase 6 transcript_id : NM_027819.2

name	Mybbp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982723 GeneID:18432 MGI:106181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYB binding protein (P160) 1a transcript_id : NM_016776.2

name	9830002I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366352 GeneID:77577 MGI:1924827
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830002I17 gene transcript_id : NM_029932.2

name	Ube2g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292440 GeneID:67128 MGI:1914378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) transcript_id : NM_025985.4

name	Ankfy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130294 GeneID:11736 MGI:1337008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and FYVE domain containing 1 transcript_id : NM_009671.5

name	Cyb5d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972403 GeneID:192986 MGI:2684848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 domain containing 2 transcript_id : NM_001024926.1

name	Zzef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865904 GeneID:195018 MGI:2444286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, ZZ-type with EF hand domain 1 transcript_id : NM_001045536.1

name	Atp2a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542158 GeneID:53313 MGI:1194503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, ubiquitous transcript_id : NM_016745.2

name	P2rx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560658 GeneID:18436 MGI:1098235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 1 transcript_id : NM_008771.2

name	LOC100043309 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261984 GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043309 transcript_id : XM_001480517.1

name	Camkk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922602 GeneID:55984 MGI:1891766
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase kinase 1, alpha transcript_id : NM_018883.2

name	1200014J11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802919 GeneID:66874 MGI:1914124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200014J11 gene transcript_id : NM_025818.2

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680481 GeneID:16407 MGI:1298377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_008399.1

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227222 GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_172944.2

name	Rabep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507021 CCDS:CCDS24968.1 GeneID:54189 MGI:1860236
definition	GO_component : GO:0005768 - endosome [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : rabaptin 5; neurocrescin; RAB5 effector protein product : rabaptin, RAB GTPase binding effector protein 1 protein_id : NP_062273.1

name	Nup88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955409 GeneID:19069 MGI:104900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; preimplantation protein 2; nucleoporin 88kDa product : nucleoporin 88 isoform 1 protein_id : NP_765982.2

name	Nup88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053894 GeneID:19069 MGI:104900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; preimplantation protein 2; nucleoporin 88kDa product : nucleoporin 88 isoform 2 protein_id : NP_001076800.1

name	Rpain (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037173 CCDS:CCDS24969.1 GeneID:69723 MGI:1916973
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : RPA interacting protein delta 2; RPA interacting protein epsilon product : RPA interacting protein protein_id : NP_081462.1

name	C1qbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181167 CCDS:CCDS24970.1 GeneID:12261 MGI:1194505
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006956 - complement activation [Evidence IEA] codon_start : 1 product : complement component 1, q subcomponent binding protein protein_id : NP_031599.2

name	Dhx33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560585 CCDS:CCDS24971.1 GeneID:216877 MGI:2445102
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33 product : DEAH (Asp-Glu-Ala-His) box polypeptide 33 protein_id : NP_848144.3

name	Derl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15808990 CCDS:CCDS24972.1 GeneID:116891 MGI:2151483
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0030307 - positive regulation of cell growth [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0030970 - retrograde protein transport, ER to cytosol [Evidence ISS]; GO:0030968 - unfolded protein response [Evidence ISS] codon_start : 1 note : derlin 2; carcinoma related product : Der1-like domain family, member 2 protein_id : NP_291040.1

name	Mis12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313120 CCDS:CCDS24973.1 GeneID:67139 MGI:1914389
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA] [Evidence ISS]; GO:0000778 - condensed nuclear chromosome kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0051382 - kinetochore assembly [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : MIS12 homolog protein_id : NP_080269.1

name	6330403K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624635 GeneID:103712 MGI:1918001
definition	codon_start : 1 product : hypothetical protein LOC103712 protein_id : NP_598783.1

name	Nlrp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921281 GeneID:195046 MGI:2684861
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006919 - caspase activation [Evidence ISS]; GO:0008219 - cell death [Evidence IDA]; GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0051402 - neuron apoptosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : death effector filament-forming Ced-4-like apoptosis protein; NACHT/LRR/pyrin domain-containing protein 1; caspase recruitment domain protein; NACHT, LRR and PYD containing protein 1; NLR family, pyrin domain containing 1 product : NACHT, leucine rich repeat and PYD containing 1 protein_id : NP_001004142.1

name	Nlrp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665740 GeneID:637515 MGI:3582959
definition	codon_start : 1 product : NACHT-, LRR-, and PYD-containing protein 1 paralog b protein_id : NP_001035786.1

name	Nlrp1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986637 GeneID:627984 MGI:3582962
definition	codon_start : 1 product : NACHT-, LRR-, and PYD-containing 1 paralog c protein_id : NP_001034323.1

name	Wscd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560748 CCDS:CCDS24975.1 GeneID:216881 MGI:2448493
definition	codon_start : 1 product : WSC domain containing 1 protein_id : NP_808286.2

name	Aipl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426863 CCDS:CCDS24976.1 GeneID:114230 MGI:2148800
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0001917 - photoreceptor inner segment [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0001918 - farnesylated protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0007603 - phototransduction, visible light [Evidence IMP]; GO:0018343 - protein farnesylation [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA]; GO:0030823 - regulation of cGMP metabolism [Evidence IMP]; GO:0001895 - retinal homeostasis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : aryl hydrocarbon receptor-interacting protein-like 1 protein_id : NP_444475.1

name	6720460F02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27735010 GeneID:109212 MGI:1924434
definition	codon_start : 1 product : hypothetical protein LOC109212 protein_id : NP_653109.2

name	Pitpnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032319 GeneID:327958 MGI:2685726
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Pitpnm family member 3 isoform 2 protein_id : NP_001075110.1

name	Pitpnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972419 CCDS:CCDS24978.1 GeneID:327958 MGI:2685726
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Pitpnm family member 3 isoform 1 protein_id : NP_001020098.1

name	4933427D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859728 CCDS:CCDS24979.1 GeneID:74477 MGI:1921727
definition	codon_start : 1 product : hypothetical protein LOC74477 protein_id : NP_083239.1

name	Txnl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386060 CCDS:CCDS24980.1 GeneID:52700 MGI:1289248
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : putative 42-9-9 protein product : thioredoxin-like 5 protein_id : NP_080835.1

name	Med31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119162 CCDS:CCDS24981.1 GeneID:67279 MGI:1914529
definition	GO_component : GO:0000119 - mediator complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016455 - RNA polymerase II transcription mediator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 31 homolog protein_id : NP_080344.2

name	4930563E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63622315 GeneID:75304 MGI:1922554
definition	codon_start : 1 product : hypothetical protein LOC75304 isoform 1 protein_id : XP_618902.1

name	Slc13a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921291 CCDS:CCDS24983.1 GeneID:237831 MGI:3037150
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0015137 - citrate transporter activity [Evidence IDA]; GO:0015141 - succinate transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015142 - tricarboxylic acid transporter activity [Evidence IDA] GO_process : GO:0015746 - citrate transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0015744 - succinate transport [Evidence IDA]; GO:0006842 - tricarboxylic acid transport [Evidence IDA] codon_start : 1 note : sodium-coupled citrate transporter; novel solute carrier family 13 (sodium-dependent dicarboxylate transporter) (Slc13a2 or 3) member product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 protein_id : NP_001004148.1

name	Fbxo39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702282 CCDS:CCDS24984.1 GeneID:327959 MGI:3505735
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : F-box protein 38; novel TRAF-type zinc finger protein product : F-box protein 39 protein_id : NP_001032802.1

name	LOC628100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261981 GeneID:628100
definition	codon_start : 1 product : similar to novel F-box domain containing protein protein_id : XP_897915.3

name	Tekt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956379 GeneID:21689 MGI:1333819
definition	GO_component : GO:0005874 - microtubule [Evidence IDA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : tektin 1 protein_id : NP_035699.2

name	D130058I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244296 CCDS:CCDS24985.1 GeneID:276829 MGI:2442764
definition	codon_start : 1 product : hypothetical protein LOC276829 protein_id : NP_808444.1

name	Ggt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647222 GeneID:71522 MGI:1918772
definition	GO_function : GO:0003840 - gamma-glutamyltransferase activity [Evidence IEA] codon_start : 1 product : gamma-glutamyltransferase 6 protein_id : NP_082095.2

name	Mybbp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982724 CCDS:CCDS24986.1 GeneID:18432 MGI:106181
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0042564 - NLS-dependent protein nuclear import complex [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence TAS] GO_process : GO:0006118 - electron transport [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear protein P160; myb-binding protein 1a product : MYB binding protein (P160) 1a protein_id : NP_058056.2

name	9830002I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037493 CCDS:CCDS24987.1 GeneID:77577 MGI:1924827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77577 protein_id : NP_084208.1

name	Ube2g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754105 GeneID:67128 MGI:1914378
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2G 1 protein_id : NP_080261.2

name	Ankfy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702366 CCDS:CCDS24989.1 GeneID:11736 MGI:1337008
definition	GO_component : GO:0010008 - endosome membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence NAS] codon_start : 1 note : ankyrin repeat hooked to zinc finger motif; ankyrin repeat hooked to a zinc finger motif short form; Rabankyrin-5 product : ankyrin repeat and FYVE domain containing 1 protein_id : NP_033801.4

name	Cyb5d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972404 CCDS:CCDS24990.1 GeneID:192986 MGI:2684848
definition	codon_start : 1 exception : mismatches in translation product : cytochrome b5 domain containing 2 protein_id : NP_001020097.1

name	Zzef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865905 GeneID:195018 MGI:2444286
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA]; GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA] codon_start : 1 note : KIAA0399-like protein human product : zinc finger, ZZ-type with EF hand domain 1 protein_id : NP_001039001.1

name	Atp2a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542159 CCDS:CCDS24991.1 GeneID:53313 MGI:1194503
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sarcoendoplasmic reticulum Ca2+ ATPase; sarcoendoplasmic reticulum Ca2+ ATPase type 3 SERCA3 product : ATPase, Ca++ transporting, ubiquitous protein_id : NP_058025.2

name	P2rx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560659 CCDS:CCDS24992.1 GeneID:18436 MGI:1098235
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P2X1 receptor; programmed cell death 3 product : purinergic receptor P2X1 protein_id : NP_032797.2

name	LOC100043309 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261985 GeneID:100043309
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480567.1

name	Camkk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922603 CCDS:CCDS24993.1 GeneID:55984 MGI:1891766
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004683 - calmodulin regulated protein kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : calcium calmodulin dependent protein kinase kinase alpha product : calcium/calmodulin-dependent protein kinase kinase 1, alpha protein_id : NP_061371.2

name	1200014J11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229010 CCDS:CCDS24994.1 GeneID:66874 MGI:1914124
definition	codon_start : 1 exception : mismatches in translation product : ELG protein protein_id : NP_080094.2

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680482 CCDS:CCDS24995.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation function : adhesion receptor note : isoform 1 is encoded by transcript variant 1; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 1 protein_id : NP_032425.1

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370456 CCDS:CCDS24996.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 2 protein_id : NP_766532.1

name	LOC100043249 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261978 GeneID:100043249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein product : hypothetical protein LOC100043249 pseudo : _no_value transcript_id : XR_034671.1

name	9230020A06Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261979 GeneID:619299 MGI:3588244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230020A06 gene transcript_id : XR_035429.1

name	LOC432577 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261982 GeneID:432577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 607 ESTs, 13 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_034718.1

name	LOC627119 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261983 GeneID:627119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 292 ESTs, 7 Proteins product : similar to Signal recognition particle receptor (docking protein) pseudo : _no_value transcript_id : XR_034726.1

clone name	MSMg01-054I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520P01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-097L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-140I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-214N12.b	B6Ng01-214N12.g
ACC	GA031983	GA031984
length	635	767
definition	B6Ng01-214N12.b	B6Ng01-214N12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(71,916,278 - 71,916,801)	(71,735,424 - 71,736,186)
sequence	gaattctctctttcaaagcgttcatccccgtggctttcagaggtctgtgc atagccatcactgttacccagctccagaacattgttccccaaagaaacgc cattcagatcagtaatcactgtgagccttgtcagcaggatccaggagatg tggccctttgtgtctgtctgctttcctttgtgatgtttctgagtctcgcc tatagagtagcacatatcagtacttaccggttgcatgttactccgtggtg cagatcgccttattctgcgtatccactgatcacctgatgggcattaaaat ggtttcacattttggttattgtgagtaattgtttctgtgtgtgtgtgtgt gtgtgctcatgtccccccccaagtgtgtgtgtgtgcgtgtgctcatgtcc ccccaagtgtgtgtgtgtgtgtgtgcgctcatgtcccccccaagtgtgtg tgtgtgtgtgtgctcatgtcccccccaagtgtgtgtgtgtgtacatgtgt gtgtgtgctcatgtcccccccaagtgtgtgtgtgtgtgtacatgtgtgtg tgtgctcatgtcccccccatgtgtgtgtgtgtgtacatgtgtgtgtgtgc tcatgtccccccaagtgtgtgtgtgtgctcatgtc	gaattcagttcccaagctaaactgaatcccagctctgctgttttctagcc aggtgagtggaggaaagttgtctggcctctgtgcctcctccataaaagga gacctagcagcagagtcatgagtctacagttatgggtcaagattggaagt ggttagggatgaggtgtggctccgttggtagagtgcttgcctagcatttg tgacaccctgggtttgatcccaaagtaccacgtggatcaggcctggtggc atatgcctgtaacaaggcagaaagatcagaagctgggctacatggcaagt tcaaagctagcccgggctacatgagacttgtcccaaaataaataagtagc aaaactctataaagggaaatgggaataaatgcttattccaaggatttgtg gactgatattttaaatggtcttagacccactctgaagagagagatggcat ctctagccagtgtctcaagctcgagtcccagttctgccaacacttgctag acgtgactttggcgagtgacctcttacttcggttccccatttctataact gcaaacagtggagttgccttatgtttaagtgatgtgaagatgagctgcat gttagataggggatgaaatttgctggccagtggcagtaaagacctcagaa gtgctcaagctgaggcttaatgccagttctgtaggtccccaggatctacg tgttttccttgttccctcaggaataaaatttgcaagagtcacataatgtt gaccttgggatatccca
quality values	Open. Hide. 49 31 42 35 58 62 62 62 62 62 62 62 62 37 18 47 62 62 54 47 62 62 44 47 62 62 62 62 62 62 59 43 49 62 62 62 62 47 46 51 62 59 54 62 62 62 62 62 62 59 62 62 59 62 62 59 59 62 59 62 59 62 62 62 59 62 62 62 62 59 62 62 59 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 59 62 59 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 54 49 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 48 59 56 62 62 62 62 62 62 62 59 59 59 59 59 59 56 56 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 59 62 59 59 59 59 59 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 62 59 59 59 59 59 62 44 51 56 34 59 51 56 38 38 38 38 38 51 51 56 56 56 44 50 56 37 44 56 51 56 56 56 47 56 56 51 56 56 56 56 51 56 51 51 38 39 31 25 50 38 31 31 50 51 51 56 51 38 37 37 31 31 26 22 50 30 31 32 43 56 39 27 21 9 25 33 30 33 56 56 56 45 56 30 30 26 28 27 23 20 13 19 21 26 46 30 35 43 52 52 50 24 20 9 12 12 12 27 43 50 41 48 62 36 38 43 43 38 9 9 9 7 7 8 22 50 37 33 33 41 42 38 30 30 21 27 28 19 22 26 23 52 39 34 41 40 33 25 16 7 6 8 11 8 9 22 33 13 21 19 17 19 23 26 13 17 12 12 12 22 24 28 16 16 14 19 52 52 25 20 18 22 17 19 15 25 42 39 31 37 27 23 19 22 10 19 24 12 27 15 35 21 27 12 24 21 29 17 23 22 13 23 13 9 15 13 12	Open. Hide. 62 49 51 42 62 47 37 62 62 62 62 62 44 32 44 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 54 54 59 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 62 56 47 47 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 47 54 56 62 56 56 56 56 62 62 62 54 62 47 51 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 54 47 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 56 47 56 56 56 56 62 62 41 37 47 62 62 62 62 56 62 62 62 43 62 56 41 31 62 62 62 62 62 50 62 50 43 24 36 39 56 50 62 56 54 62 62 24 47 46 47 50 41 62 42 62 30 35 47 38 47 52 62 38 62 32 62 62 62 30 47 48 54 62 27 42 41 50 42 27 50 42 41 41 52 35 52 27 52 18 47 41 36 47 52 52 47 15 15 23 25 29 52 52 52 54 45 18 18 18 17 12 25 16 19 22 15 39 32 52 46 25 39 28 34 54 47 24 15 38 17 21 19 34 24 29 26 22 27 32 32 50 27 36 9 23 15 16 13 16 12 12 22 10 17 15 13 15 38 33 39 41 35 27 7 16 9 8 9 13 10 20 15 15 40 37 49 42 20 42 23 19 18 35 33 35 31 22 22 34 35 25 7 14 27 13 22 22 18 13 13 9 9 9 9 7 16 27 26 19 18 25 34 16 13 7 8 9 6 7 8 20 24 17 13 11 9 6 7 18 9 12 27 15 20 34 20 16 19 9 13 7 9 9 12 9 12 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_71916278_71916801
seq2: B6Ng01-214N12.b_162_685 (reverse)

seq1  GACATGAGCACACACACACACTTGGGGGGACATGAGCACACACACACATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATGAGCACACACACACACTTGGGGGGACATGAGCACACACACACATG  50

seq1  TACACACACACACACTTGGGGGGGACATGAGCACACACACACATGTACAC  100
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  TACACACACACACACATGGGGGGGACATGAGCACACACACACATGTACAC  100

seq1  ACACACACACACTTGGGGGGGACATGAGCACACACACACATGTACACACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACACACACTTGGGGGGGACATGAGCACACACACACATGTACACACA  150

seq1  CACACACTTGGGGGGGACATGAGCACACACACACACACACACTTGGGGGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACTTGGGGGGGACATGAGCACACACACACACACACACTTGGGGGG  200

seq1  GACATGAGCGCACACACACACACACACACTTGGGGGGACATGAGCACACG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATGAGCGCACACACACACACACACACTTGGGGGGACATGAGCACACG  250

seq1  CACACACACACACTTGGGGGGGGACATGAGCACACACACACACACACACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACACACACTTGGGGGGGGACATGAGCACACACACACACACACACA  300

seq1  GAAACAATTACTCACAATAACCAAAATGTGAAACCATTTTAATGCCCATC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACAATTACTCACAATAACCAAAATGTGAAACCATTTTAATGCCCATC  350

seq1  AGGTGATCAGTGGATACGCAGAATAAGGCGATCTGCACCACGGAGTAACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGATCAGTGGATACGCAGAATAAGGCGATCTGCACCACGGAGTAACA  400

seq1  TGCAACCGGTAAGTACTGATATGTGCTACTCTATAGGCGAGACTCAGAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAACCGGTAAGTACTGATATGTGCTACTCTATAGGCGAGACTCAGAAA  450

seq1  CATCACAAAGGAAAGCAGACAGACACAAAGGGCCACATCTCCTGGATCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCACAAAGGAAAGCAGACAGACACAAAGGGCCACATCTCCTGGATCCT  500

seq1  GCTGACAAGGCTCACAGTGATTAC  524
      ||||||||||||||||||||||||
seq2  GCTGACAAGGCTCACAGTGATTAC  524

seq1: chr11_71735424_71736186
seq2: B6Ng01-214N12.g_68_834

seq1  GAATTCAGTTCCCAAGCTAAACTGAATCCCAGCTCTGCTGTTTTCTAGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTTCCCAAGCTAAACTGAATCCCAGCTCTGCTGTTTTCTAGCC  50

seq1  AGGTGAGTGGAGGAAAGTTGTCTGGCCTCTGTGCCTCCTCCATAAAAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAGTGGAGGAAAGTTGTCTGGCCTCTGTGCCTCCTCCATAAAAGGA  100

seq1  GACCTAGCAGCAGAGTCATGAGTCTACAGTTATGGGTCAAGATTGGAAGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTAGCAGCAGAGTCATGAGTCTACAGTTATGGGTCAAGATTGGAAGT  150

seq1  GGTTAGGGATGAGGTGTGGCTCCGTTGGTAGAGTGCTTGCCTAGCATTTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAGGGATGAGGTGTGGCTCCGTTGGTAGAGTGCTTGCCTAGCATTTG  200

seq1  TGACACCCTGGGTTTGATCCCAAAGTACCACGTGGATCAGGCCTGGTGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACACCCTGGGTTTGATCCCAAAGTACCACGTGGATCAGGCCTGGTGGC  250

seq1  ATATGCCTGTAACAAGGCAGAAAGATCAGAAGCTGGGCTACATGGCAAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGCCTGTAACAAGGCAGAAAGATCAGAAGCTGGGCTACATGGCAAGT  300

seq1  TCAAAGCTAGCCCGGGCTACATGAGACTTGTCCCAAAATAAATAAGTAGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGCTAGCCCGGGCTACATGAGACTTGTCCCAAAATAAATAAGTAGC  350

seq1  AAAACTCTATAAAGGGAAATGGGAATAAATGCTTATTCCAAGGATTTGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTCTATAAAGGGAAATGGGAATAAATGCTTATTCCAAGGATTTGTG  400

seq1  GACTGATATTTTAAATGGTCTTAGACCCACTCTGAAGAGAGAGATGGCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGATATTTTAAATGGTCTTAGACCCACTCTGAAGAGAGAGATGGCAT  450

seq1  CTCTAGCCAGTGTCTCAAGCTCGAGTCCCAGTTCTGCCAACACTTGCTAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTAGCCAGTGTCTCAAGCTCGAGTCCCAGTTCTGCCAACACTTGCTAG  500

seq1  ACGTGACTTTGGCGAGTGACCTCTTACTTCGGTTCCCCATTTCTATAACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTGACTTTGGCGAGTGACCTCTTACTTCGGTTCCCCATTTCTATAACT  550

seq1  GCAAACAGTGGAGTTGCCTTATGTTTAAGTGATGTGAAGATGAGCTGCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACAGTGGAGTTGCCTTATGTTTAAGTGATGTGAAGATGAGCTGCAT  600

seq1  GTTAGATA-GGGATGAAATTTGCTGGCCAGTGGCAGTAAAGACCTCAGAA  649
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  GTTAGATAGGGGATGAAATTTGCTGGCCAGTGGCAGTAAAGACCTCAGAA  650

seq1  GTGCTCAAGCTGAGGCTTAATGCCAGTTCTGTAGGT-CCCAGGATCTACG  698
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  GTGCTCAAGCTGAGGCTTAATGCCAGTTCTGTAGGTCCCCAGGATCTACG  700

seq1  TGTTTTCCTTGTCCCCTCAGGAATAAAA-TTGCAAGAGTCACATAAAG-T  746
      |||||||||||| ||||||||||||||| ||||||||||||||||| | |
seq2  TGTTTTCCTTGTTCCCTCAGGAATAAAATTTGCAAGAGTCACATAATGTT  750

seq1  GACCTTGGGACATCCCA  763
      |||||||||| ||||||
seq2  GACCTTGGGATATCCCA  767

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information