MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-216I14
Chromosome	11 (Build37)
Map Location	69,239,249 - 69,239,395
singlet/doublet	singlet
Overlap gene	Dnahc2
Upstream gene	Pik3r5, BB220380, BC024997, Ccdc42, Myh10, Ndel1, 9930039A11Rik, Rpl26, Odf4, Arhgef15, Slc25a35, 2400006H24Rik, Pfas, 1500010J02Rik, Aurkb, 2310047M10Rik, Tmem107, Vamp2, Per1, Hes7, Aloxe3, Alox12b, Alox8, Gucy2e, Cntrob, Trappc1, Kcnab3, A030009H04Rik, Chd3, Cyb5d1, Lsmd1, Tmem88, Jmjd3
Downstream gene	Efnb3, Wdr79, LOC100043030, Trp53, Atp1b2, Shbg, Sat2, LOC382532, Fxr2, Sox15, Mpdu1, Cd68, Eif4a1, Senp3, Tnfsf12-tnfsf13, Tnfsf13, Tnfsf12, LOC100041994, Polr2a, Amac1, Zbtb4, Chrnb1, Fgf11, Tmem102, 4933402P03Rik, 1700095G12Rik, Nlgn2, 1810027O10Rik, Plscr3, Tnk1, LOC432576, Kctd11, Centb1, 2810408A11Rik, 0610025P10Rik, Gps2, Eif5a, Ybx2, Slc2a4, LOC668442, Cldn7, Rai12, Dullard, Gabarap, Phf23, Dvl2, Acadvl, Dlg4, Asgr1, Asgr2, Mgl2, Mgl1, Slc16a11, Slc16a13, Bcl6b, 0610010K14Rik, D11Bwg0434e, Alox12, Alox12e, Alox15, LOC668466, Pelp1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pik3r5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320207 MGI:2443588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BB220380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104709 MGI:2144613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC024997 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215723 MGI:2384904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276920 MGI:3045254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77579 MGI:1930780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83431 MGI:1932915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930039A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320040 MGI:2443227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19941 MGI:106022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Odf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252868 MGI:2182079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442801 MGI:3045246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71998 MGI:1919248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2400006H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57785 MGI:1889073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237823 MGI:2684864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 81 ESTs, 7 Proteins

name	1500010J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68964 MGI:1916214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Aurkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20877 MGI:107168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047M10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71923 MGI:1919173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66910 MGI:1914160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22318 MGI:1313277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Per1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18626 MGI:1098283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hes7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84653 MGI:2135679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aloxe3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23801 MGI:1345140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11686 MGI:1274782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11688 MGI:1098228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gucy2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14919 MGI:105123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntrob (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216846 MGI:2443290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245828 MGI:1098727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnab3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16499 MGI:1336208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A030009H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80515 MGI:1915359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216848 MGI:1344395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327951 MGI:2685586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsmd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78304 MGI:1925554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67020 MGI:1914270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216850 MGI:2448492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327954 MGI:107731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13643 MGI:109196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216853 MGI:2384933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 241 ESTs

name	Trp53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22059 MGI:98834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11932 MGI:88109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shbg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20415 MGI:98295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69215 MGI:1916465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Fxr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23879 MGI:1346074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20670 MGI:98363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpdu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24070 MGI:1346040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12514 MGI:88342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13681 MGI:95303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Senp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80886 MGI:2158736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf12-tnfsf13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tnfsf13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69583 MGI:1916833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21944 MGI:1196259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Polr2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20020 MGI:98086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56293 MGI:1927128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75580 MGI:1922830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11443 MGI:87890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14166 MGI:109167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380705 MGI:1921591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933402P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108803 MGI:1918293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700095G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74288 MGI:1921538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlgn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216856 MGI:2681835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810027O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69186 MGI:1916436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plscr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70310 MGI:1917560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83813 MGI:1930958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Kctd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216858 MGI:2448712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216859 MGI:2388270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810408A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70419 MGI:1917669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610025P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216860 MGI:1921092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56310 MGI:1891751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276770 MGI:106248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ybx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53422 MGI:1096372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20528 MGI:95758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cldn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53624 MGI:1859285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rai12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54351 MGI:1859017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dullard (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67181 MGI:1914431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabarap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56486 MGI:1861742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78246 MGI:1925496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dvl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13543 MGI:106613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acadvl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11370 MGI:895149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13385 MGI:1277959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asgr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11889 MGI:88081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asgr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11890 MGI:88082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216864 MGI:2385729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17312 MGI:96975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216867 MGI:2663709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc16a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69309 MGI:1916559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12029 MGI:1278332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104457 MGI:1915609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Bwg0434e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52898 MGI:106369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11684 MGI:87998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11685 MGI:1274790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11687 MGI:87997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 8 Proteins pseudo : _no_value

name	Pelp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75273 MGI:1922523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3r5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262160 GeneID:320207 MGI:2443588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoinositide-3-kinase, regulatory subunit 5, p101 transcript_id : NM_177320.2

name	BB220380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362958 GeneID:104709 MGI:2144613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence BB220380 transcript_id : NM_001081566.1

name	BB220380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362962 GeneID:104709 MGI:2144613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence BB220380 transcript_id : NM_001004435.2

name	BC024997 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122466 GeneID:215723 MGI:2384904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024997 transcript_id : NM_146004.1

name	Ccdc42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343047 GeneID:276920 MGI:3045254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 42 transcript_id : NM_177779.2

name	Myh10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:105554494 GeneID:77579 MGI:1930780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 10, non-muscle transcript_id : NM_175260.2

name	Ndel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963776 GeneID:83431 MGI:1932915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear distribution gene E-like homolog 1 (A. nidulans) transcript_id : NM_023668.1

name	9930039A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089299 GeneID:320040 MGI:2443227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930039A11 gene transcript_id : NM_177060.3

name	Rpl26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130500915 GeneID:19941 MGI:106022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L26 transcript_id : NM_009080.2

name	Odf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21919407 GeneID:252868 MGI:2182079
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 4 transcript_id : NM_145746.1

name	Arhgef15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60279699 GeneID:442801 MGI:3045246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 15 transcript_id : NM_177566.3

name	Slc25a35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354306 GeneID:71998 MGI:1919248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 35 transcript_id : NM_028048.2

name	2400006H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56961625 GeneID:57785 MGI:1889073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2400006H24 gene transcript_id : NM_021329.2

name	Pfas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261973 GeneID:237823 MGI:2684864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 81 ESTs, 7 Proteins product : phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) transcript_id : XM_111232.8

name	1500010J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742799 GeneID:68964 MGI:1916214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500010J02 gene transcript_id : NM_026889.2

name	1500010J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742801 GeneID:68964 MGI:1916214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500010J02 gene transcript_id : NM_001013256.1

name	Aurkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51317393 GeneID:20877 MGI:107168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase B transcript_id : NM_011496.1

name	2310047M10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369094 GeneID:71923 MGI:1919173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310047M10 gene transcript_id : NM_028005.3

name	Tmem107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802127 GeneID:66910 MGI:1914160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 107 transcript_id : NM_028336.2

name	Tmem107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539608 GeneID:66910 MGI:1914160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 107 transcript_id : NM_025838.1

name	Vamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130363 GeneID:22318 MGI:1313277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 2 transcript_id : NM_009497.3

name	Per1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803296 GeneID:18626 MGI:1098283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : period homolog 1 (Drosophila) transcript_id : NM_011065.3

name	Hes7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368444 GeneID:84653 MGI:2135679
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy and enhancer of split 7 (Drosophila) transcript_id : NM_033041.3

name	Aloxe3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753041 GeneID:23801 MGI:1345140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate lipoxygenase 3 transcript_id : NM_011786.1

name	Alox12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130321 GeneID:11686 MGI:1274782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 12-lipoxygenase, 12R type transcript_id : NM_009659.2

name	Alox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893229 GeneID:11688 MGI:1098228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 8-lipoxygenase transcript_id : NM_009661.3

name	Gucy2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680134 GeneID:14919 MGI:105123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase 2e transcript_id : NM_008192.1

name	Cntrob (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362833 GeneID:216846 MGI:2443290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrobin, centrosomal BRCA2 interacting protein transcript_id : NM_172560.2

name	Trappc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66730564 GeneID:245828 MGI:1098727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 1 transcript_id : NM_001024206.1

name	Kcnab3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373382 GeneID:16499 MGI:1336208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related subfamily, beta member 3 transcript_id : NM_010599.3

name	A030009H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181135 GeneID:80515 MGI:1915359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030009H04 gene transcript_id : NM_020591.1

name	Chd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358949 GeneID:216848 MGI:1344395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 3 transcript_id : NM_146019.2

name	Cyb5d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865880 GeneID:327951 MGI:2685586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 domain containing 1 transcript_id : NM_001045525.1

name	Lsmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347214 GeneID:78304 MGI:1925554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM domain containing 1 transcript_id : NM_030083.2

name	Tmem88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802097 GeneID:67020 MGI:1914270
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 88 transcript_id : NM_025915.3

name	Jmjd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945393 GeneID:216850 MGI:2448492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 3 transcript_id : NM_001017426.1

name	Dnahc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486772 GeneID:327954 MGI:107731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, heavy chain 2 transcript_id : NM_001081330.1

name	Efnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367810 GeneID:13643 MGI:109196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin B3 transcript_id : NM_007911.4

name	Wdr79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130039 GeneID:216853 MGI:2384933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 79 transcript_id : NM_144824.2

name	LOC100043030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261974 GeneID:100043030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 241 ESTs product : similar to ribosomal protein S27 (metallopanstimulin 1) transcript_id : XM_001479913.1

name	Trp53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755880 GeneID:22059 MGI:98834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 transcript_id : NM_011640.1

name	Atp1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802992 GeneID:11932 MGI:88109
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, beta 2 polypeptide transcript_id : NM_013415.4

name	Shbg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755505 GeneID:20415 MGI:98295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sex hormone binding globulin transcript_id : NM_011367.1

name	Sat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362782 GeneID:69215 MGI:1916465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermidine/spermine N1-acetyl transferase 2 transcript_id : NM_026991.2

name	Fxr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921588 GeneID:23879 MGI:1346074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation, autosomal homolog 2 transcript_id : NM_011814.2

name	Sox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094090 GeneID:20670 MGI:98363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 15 transcript_id : NM_009235.1

name	Mpdu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347827 GeneID:24070 MGI:1346040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose-P-dolichol utilization defect 1 transcript_id : NM_011900.3

name	Cd68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753351 GeneID:12514 MGI:88342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD68 antigen transcript_id : NM_009853.1

name	Eif4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366509 GeneID:13681 MGI:95303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A1 transcript_id : NM_144958.3

name	Senp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802397 GeneID:80886 MGI:2158736
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO/sentrin specific peptidase 3 transcript_id : NM_030702.3

name	Tnfsf12-tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:77628046 GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12-member 13 transcript_id : NM_001034098.1

name	Tnfsf12-tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:77539771 GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12-member 13 transcript_id : NM_001034097.1

name	Tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77627742 GeneID:69583 MGI:1916833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 13 transcript_id : NM_023517.2

name	Tnfsf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33438583 GeneID:21944 MGI:1196259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12 transcript_id : NM_011614.1

name	Polr2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130551 GeneID:20020 MGI:98086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide A transcript_id : NM_009089.2

name	Amac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145472 GeneID:56293 MGI:1927128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-malonyl condensing enzyme 1 transcript_id : NM_019871.2

name	Zbtb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626059 GeneID:75580 MGI:1922830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 4 transcript_id : NM_029348.1

name	Chrnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981911 GeneID:11443 MGI:87890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) transcript_id : NM_009601.3

name	Fgf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753843 GeneID:14166 MGI:109167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 11 transcript_id : NM_010198.1

name	Tmem102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360242 GeneID:380705 MGI:1921591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 102 transcript_id : NM_001033433.2

name	4933402P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30425069 GeneID:108803 MGI:1918293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933402P03 gene transcript_id : NM_175368.1

name	1700095G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227236 GeneID:74288 MGI:1921538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700095G12 gene transcript_id : NM_028855.1

name	Nlgn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699424 GeneID:216856 MGI:2681835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroligin 2 transcript_id : NM_198862.2

name	1810027O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625729 GeneID:69186 MGI:1916436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810027O10 gene transcript_id : NM_026982.1

name	Plscr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803011 GeneID:70310 MGI:1917560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipid scramblase 3 transcript_id : NM_023564.3

name	Tnk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560012 GeneID:83813 MGI:1930958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase, non-receptor, 1 transcript_id : NM_031880.2

name	LOC432576 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390188 GeneID:432576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to TMEM95 protein transcript_id : XM_484042.3

name	Kctd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353128 GeneID:216858 MGI:2448712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 11 transcript_id : NM_153143.3

name	Centb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130064 GeneID:216859 MGI:2388270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, beta 1 transcript_id : NM_153788.3

name	2810408A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130354 GeneID:70419 MGI:1917669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810408A11 gene transcript_id : NM_027419.3

name	0610025P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61740636 GeneID:216860 MGI:1921092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610025P10 gene transcript_id : NM_001013414.1

name	Gps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130652 GeneID:56310 MGI:1891751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein pathway suppressor 2 transcript_id : NM_019726.3

name	Eif5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380083 GeneID:276770 MGI:106248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 5A transcript_id : NM_181582.3

name	Ybx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956376 GeneID:53422 MGI:1096372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Y box protein 2 transcript_id : NM_016875.2

name	Slc2a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026924 GeneID:20528 MGI:95758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 4 transcript_id : NM_009204.2

name	Cldn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801880 GeneID:53624 MGI:1859285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 7 transcript_id : NM_016887.3

name	Rai12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055319 GeneID:54351 MGI:1859017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid induced 12 transcript_id : NM_018740.1

name	Dullard (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129887 GeneID:67181 MGI:1914431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dullard homolog (Xenopus laevis) transcript_id : NM_026017.2

name	Gabarap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254379 GeneID:56486 MGI:1861742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid receptor associated protein transcript_id : NM_019749.3

name	Phf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364931 GeneID:78246 MGI:1925496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 23 transcript_id : NM_030064.2

name	Dvl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299587 GeneID:13543 MGI:106613
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dishevelled 2, dsh homolog (Drosophila) transcript_id : NM_007888.3

name	Acadvl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892573 GeneID:11370 MGI:895149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase, very long chain transcript_id : NM_017366.2

name	Dlg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803376 GeneID:13385 MGI:1277959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog 4 (Drosophila) transcript_id : NM_007864.2

name	Asgr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256508 GeneID:11889 MGI:88081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asialoglycoprotein receptor 1 transcript_id : NM_009714.2

name	Asgr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131075 GeneID:11890 MGI:88082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asialoglycoprotein receptor 2 transcript_id : NM_007493.3

name	Mgl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311550 GeneID:216864 MGI:2385729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage galactose N-acetyl-galactosamine specific lectin 2 transcript_id : NM_145137.2

name	Mgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130155 GeneID:17312 MGI:96975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage galactose N-acetyl-galactosamine specific lectin 1 transcript_id : NM_010796.2

name	Slc16a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347517 GeneID:216867 MGI:2663709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 11 transcript_id : NM_153081.2

name	Slc16a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803333 GeneID:69309 MGI:1916559
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 13 transcript_id : NM_172371.2

name	Bcl6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891681 GeneID:12029 MGI:1278332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 6, member B transcript_id : NM_007528.2

name	0610010K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21389317 GeneID:104457 MGI:1915609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010K14 gene transcript_id : NM_026757.1

name	D11Bwg0434e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349970 GeneID:52898 MGI:106369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0434 expressed transcript_id : NM_173742.2

name	Alox12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802272 GeneID:11684 MGI:87998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 12-lipoxygenase transcript_id : NM_007440.3

name	Alox12e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729794 GeneID:11685 MGI:1274790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate lipoxygenase, epidermal transcript_id : NM_145684.1

name	Alox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948632 GeneID:11687 MGI:87997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 15-lipoxygenase transcript_id : NM_009660.3

name	Pelp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345821 GeneID:75273 MGI:1922523
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline, glutamic acid and leucine rich protein 1 transcript_id : NM_029231.3

name	Pik3r5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262161 CCDS:CCDS24865.1 GeneID:320207 MGI:2443588
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : phosphoinositide-3-kinase, regulatory subunit 5, p101 protein_id : NP_796294.2

name	BB220380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362959 GeneID:104709 MGI:2144613
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; p87 phosphoinositide 3-kinase gamma (PI3Kg) adapter protein; phosphoinositide 3-kinase regulatory subunit 6 product : p87 phosphoinositide 3-kinase gamma adapter protein isoform 1 protein_id : NP_001075035.1

name	BB220380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138727 CCDS:CCDS24866.1 GeneID:104709 MGI:2144613
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; p87 phosphoinositide 3-kinase gamma (PI3Kg) adapter protein; phosphoinositide 3-kinase regulatory subunit 6 product : p87 phosphoinositide 3-kinase gamma adapter protein isoform 2 protein_id : NP_001004435.1

name	BC024997 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122467 CCDS:CCDS24867.1 GeneID:215723 MGI:2384904
definition	codon_start : 1 product : hypothetical protein LOC215723 protein_id : NP_666116.1

name	Ccdc42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244294 CCDS:CCDS24868.1 GeneID:276920 MGI:3045254
definition	codon_start : 1 product : coiled-coil domain containing 42 protein_id : NP_808447.1

name	Myh10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33598964 CCDS:CCDS24869.1 GeneID:77579 MGI:1930780
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0001725 - stress fiber [Evidence IMP] [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0001778 - plasma membrane repair [Evidence IMP]; GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0006930 - substrate-bound cell migration, cell extension [Evidence IMP] codon_start : 1 note : myosin IIB; myosin heavy chain, nonmuscular, type B; nonmuscle myosin heavy chain II-B product : myosin heavy chain 10, non-muscle protein_id : NP_780469.1

name	Ndel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963777 CCDS:CCDS24870.1 GeneID:83431 MGI:1932915
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005813 - centrosome [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001833 - inner cell mass cell proliferation [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001764 - neuron migration [Evidence IGI]; GO:0008090 - retrograde axon cargo transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0047496 - vesicle transport along microtubule [Evidence IGI] codon_start : 1 exception : mismatches in translation note : nuclear disribution gene E like; nuclear distribution gene E-like product : NudeL protein protein_id : NP_076157.1

name	9930039A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089300 CCDS:CCDS24871.1 GeneID:320040 MGI:2443227
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320040 protein_id : NP_796034.2

name	Rpl26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677777 GeneID:19941 MGI:106022
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L26 protein_id : NP_033106.1

name	Odf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21919408 CCDS:CCDS24872.1 GeneID:252868 MGI:2182079
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0001520 - outer dense fiber [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : oppo 1; Oppo1-pending (oppo 1) product : outer dense fiber of sperm tails 4 protein_id : NP_665689.1

name	Arhgef15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60279700 CCDS:CCDS24873.1 GeneID:442801 MGI:3045246
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 15 protein_id : NP_808234.2

name	Slc25a35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312550 CCDS:CCDS24874.1 GeneID:71998 MGI:1919248
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 35 protein_id : NP_082324.1

name	2400006H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946640 CCDS:CCDS24875.1 GeneID:57785 MGI:1889073
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0008536 - Ran GTPase binding [Evidence IDA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence TAS] codon_start : 1 product : RAN guanine nucleotide release factor protein_id : NP_067304.1

name	Pfas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63622229 GeneID:237823 MGI:2684864
definition	codon_start : 1 product : phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) protein_id : XP_111232.4

name	1500010J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742800 GeneID:68964 MGI:1916214
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC68964 isoform a protein_id : NP_081165.2

name	1500010J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742802 GeneID:68964 MGI:1916214
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC68964 isoform b protein_id : NP_001013274.1

name	Aurkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317394 CCDS:CCDS24877.1 GeneID:20877 MGI:107168
definition	EC_number : 2.7.11.1 GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : aurora-related kinase 2; serine/threonine kinase 5; serine/threonine kinase 12 product : aurora kinase B protein_id : NP_035626.1

name	2310047M10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952555 GeneID:71923 MGI:1919173
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC71923 protein_id : NP_082281.2

name	Tmem107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539609 CCDS:CCDS24879.1 GeneID:66910 MGI:1914160
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC66910 isoform 1 protein_id : NP_080114.1

name	Tmem107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539635 CCDS:CCDS24880.1 GeneID:66910 MGI:1914160
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC66910 isoform 2 protein_id : NP_082612.1

name	Vamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678551 CCDS:CCDS24881.1 GeneID:22318 MGI:1313277
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0030141 - secretory granule [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA]; GO:0030672 - synaptic vesicle membrane [Evidence IDA]; GO:0019717 - synaptosome [Evidence IEA]; GO:0042589 - zymogen granule membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0000149 - SNARE binding [Evidence IDA] GO_process : GO:0017156 - calcium ion-dependent exocytosis [Evidence IDA] [Evidence IMP]; GO:0006944 - membrane fusion [Evidence IMP]; GO:0017157 - regulation of exocytosis [Evidence IDA]; GO:0016079 - synaptic vesicle exocytosis [Evidence IMP]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : synaptobrevin II; vesicle-associated membrane 2 product : vesicle-associated membrane protein 2 protein_id : NP_033523.1

name	Per1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755032 CCDS:CCDS24882.1 GeneID:18626 MGI:1098283
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 exception : mismatches in translation product : period homolog 1 protein_id : NP_035195.1

name	Hes7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098129 CCDS:CCDS24883.1 GeneID:84653 MGI:2135679
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0007219 - Notch signaling pathway [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IMP] [Evidence IDA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0001756 - somitogenesis [Evidence IMP]; GO:0035121 - tail morphogenesis [Evidence IMP] codon_start : 1 note : bHLH factor Hes7 product : hairy and enhancer of split 7 protein_id : NP_149030.2

name	Aloxe3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753042 CCDS:CCDS24884.1 GeneID:23801 MGI:1345140
definition	GO_function : GO:0003824 - catalytic activity [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arachidonate lipoxygenase 3 protein_id : NP_035916.1

name	Alox12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753040 CCDS:CCDS24885.1 GeneID:11686 MGI:1274782
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : arachidonate 12-lipoxygenase, 12R type protein_id : NP_033789.1

name	Alox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363263 CCDS:CCDS24886.1 GeneID:11688 MGI:1098228
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0050473 - arachidonate 15-lipoxygenase activity [Evidence IEA] [Evidence ISS]; GO:0047677 - arachidonate 8-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence ISS]; GO:0030336 - negative regulation of cell migration [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0045926 - negative regulation of growth [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS]; GO:0030850 - prostate gland development [Evidence ISS]; GO:0030856 - regulation of epithelial cell differentiation [Evidence ISS] codon_start : 1 note : 8S-lipoxygenase product : arachidonate 15-lipoxygenase, second type protein_id : NP_033791.1

name	Gucy2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680135 CCDS:CCDS24887.1 GeneID:14919 MGI:105123
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IEA]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 exception : mismatches in translation note : guanylyl cyclase 2e product : guanylate cyclase 2e protein_id : NP_032218.1

name	Cntrob (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369792 CCDS:CCDS24888.1 GeneID:216846 MGI:2443290
definition	GO_component : GO:0005814 - centriole [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007099 - centriole replication [Evidence ISS]; GO:0051299 - centrosome separation [Evidence ISS]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : LYST-interacting protein LIP8 product : centrobin, centrosomal BRCA2 interacting protein protein_id : NP_766148.1

name	Trappc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66730565 CCDS:CCDS24889.1 GeneID:245828 MGI:1098727
definition	codon_start : 1 note : novel Sybindin-like family domain-containing protein product : trafficking protein particle complex 1 protein_id : NP_001019377.1

name	Kcnab3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330160 CCDS:CCDS24890.1 GeneID:16499 MGI:1336208
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium voltage-gated channel, shaker-related subfamily, beta member 3 protein_id : NP_034729.2

name	A030009H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181136 GeneID:80515 MGI:1915359
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC80515 protein_id : NP_065616.1

name	Chd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358950 GeneID:216848 MGI:1344395
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0016585 - chromatin remodeling complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016581 - NuRD complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004365 - glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IDA] [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Mi-2 alpha product : chromodomain helicase DNA binding protein 3 protein_id : NP_666131.2

name	Cyb5d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865881 CCDS:CCDS24892.1 GeneID:327951 MGI:2685586
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : cytochrome b5 domain containing 1 protein_id : NP_001038990.1

name	Lsmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037525 CCDS:CCDS24893.1 GeneID:78304 MGI:1925554
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA] codon_start : 1 note : novel LSM domain-containing protein product : MAK31-like protein protein_id : NP_084359.1

name	Tmem88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560207 CCDS:CCDS24894.1 GeneID:67020 MGI:1914270
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67020 protein_id : NP_080191.2

name	Jmjd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945394 CCDS:CCDS24895.1 GeneID:216850 MGI:2448492
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : jumonji domain containing 3 protein_id : NP_001017426.1

name	Dnahc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486773 GeneID:327954 MGI:107731
definition	codon_start : 1 note : dynein heavy chain domain 3; dynein, axon, heavy chain 2; region surrounding P-loop 1; axonemal dynein heavy chain product : dynein, axonemal, heavy chain 2 protein_id : NP_001074799.1

name	Efnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681281 CCDS:CCDS24896.1 GeneID:13643 MGI:109196
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007628 - adult walking behavior [Evidence IMP]; GO:0016198 - axon choice point recognition [Evidence IMP]; GO:0007411 - axon guidance [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : ephrin B3 protein_id : NP_031937.1

name	Wdr79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450205 CCDS:CCDS24897.1 GeneID:216853 MGI:2384933
definition	codon_start : 1 product : WD repeat domain 79 protein_id : NP_659073.1

name	LOC100043030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261975 GeneID:100043030
definition	codon_start : 1 product : similar to ribosomal protein S27 (metallopanstimulin 1) protein_id : XP_001479963.1

name	Trp53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755881 GeneID:22059 MGI:98834
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] [Evidence IGI]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030330 - DNA damage response, signal transduction by p53 class mediator [Evidence IDA] [Evidence IGI]; GO:0042771 - DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis [Evidence ISS] [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0009792 - embryonic development (sensu Metazoa) [Evidence IGI]; GO:0031571 - G1 DNA damage checkpoint [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008156 - negative regulation of DNA replication [Evidence IMP] [Evidence IDA]; GO:0048147 - negative regulation of fibroblast proliferation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI] [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0000060 - protein import into nucleus, translocation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] [Evidence IDA]; GO:0009411 - response to UV [Evidence IMP]; GO:0010165 - response to X-ray [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : p53 cellular tumor antigen; p53 tumor suppressor; tumor supressor p53 product : transformation related protein 53 protein_id : NP_035770.1

name	Atp1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242138 CCDS:CCDS24898.1 GeneID:11932 MGI:88109
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : snoRNA MBI-85 product : Na+/K+ -ATPase beta 2 subunit protein_id : NP_038201.1

name	Shbg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755506 CCDS:CCDS24899.1 GeneID:20415 MGI:98295
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 product : sex hormone binding globulin protein_id : NP_035497.1

name	Sat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249210 GeneID:69215 MGI:1916465
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004145 - diamine N-acetyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008216 - spermidine metabolism [Evidence ISS]; GO:0008215 - spermine metabolism [Evidence ISS] codon_start : 1 product : spermidine/spermine N1-acetyl transferase 2 protein_id : NP_081267.1

name	Fxr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921589 CCDS:CCDS24901.1 GeneID:23879 MGI:1346074
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : fragile X mental retardation gene 2, autosomal homolog product : fragile X mental retardation-related protein 2 protein_id : NP_035944.2

name	Sox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094091 CCDS:CCDS24902.1 GeneID:20670 MGI:98363
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IGI] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IGI] [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IGI]; GO:0048627 - myoblast development [Evidence IMP]; GO:0045843 - negative regulation of striated muscle development [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0043403 - skeletal muscle regeneration [Evidence IMP] codon_start : 1 product : SRY-box 15 protein_id : NP_033261.1

name	Mpdu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981340 CCDS:CCDS24903.1 GeneID:24070 MGI:1346040
definition	codon_start : 1 note : suppressor of Lec15 homolog (C.griseus) product : mannose-P-dolichol utilization defect 1 protein_id : NP_036030.2

name	Cd68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753352 GeneID:12514 MGI:88342
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 note : macrosialin product : CD68 antigen protein_id : NP_033983.1

name	Eif4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450625 CCDS:CCDS24904.1 GeneID:13681 MGI:95303
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : initiation factor eIF-4A long form product : eukaryotic translation initiation factor 4A1 protein_id : NP_659207.1

name	Senp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981408 CCDS:CCDS24905.1 GeneID:80886 MGI:2158736
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0019538 - protein metabolism [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sentrin/SUMO-specific protease; SUMO/sentrin specific protease 3 product : smt3-specific isopeptidase 1 protein_id : NP_109627.2

name	Tnfsf12-tnfsf13 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:77628047 GeneID:619441
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : tumor necrosis factor (ligand) superfamily, member 12-member 13 isoform b protein_id : NP_001029270.1

name	Tnfsf12-tnfsf13 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:77539772 CCDS:CCDS24906.1 GeneID:619441
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : tumor necrosis factor (ligand) superfamily, member 12-member 13 isoform a protein_id : NP_001029269.1

name	Tnfsf13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77627743 GeneID:69583 MGI:1916833
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0048298 - positive regulation of isotype switching to IgA isotypes [Evidence ISS] [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP] codon_start : 1 note : tumor necrosis factor (ligand) superfamily, member 12 product : tumor necrosis factor (ligand) superfamily, member 13 protein_id : NP_076006.2

name	Tnfsf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33438584 CCDS:CCDS24907.1 GeneID:21944 MGI:1196259
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0008219 - cell death [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : tumor necrosis factor (ligand) superfamily, member 12 protein_id : NP_035744.1

name	Polr2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677795 GeneID:20020 MGI:98086
definition	GO_component : GO:0005665 - DNA-directed RNA polymerase II, core complex [Evidence IEA]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IEA] [Evidence ISS] codon_start : 1 note : RNA polymerase II 1 product : polymerase (RNA) II (DNA directed) polypeptide A protein_id : NP_033115.1

name	Amac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145473 CCDS:CCDS24908.1 GeneID:56293 MGI:1927128
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : testicular condensing enzyme product : acyl-malonyl condensing enzyme 1 protein_id : NP_063924.2

name	Zbtb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626060 GeneID:75580 MGI:1922830
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger and BTB domain containing 4 protein_id : NP_083624.1

name	Chrnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981912 CCDS:CCDS24910.1 GeneID:11443 MGI:87890
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : acetylcholine receptor beta product : cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) protein_id : NP_033731.2

name	Fgf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753844 CCDS:CCDS24911.1 GeneID:14166 MGI:109167
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : fibroblast growth factor 11 protein_id : NP_034328.1

name	Tmem102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701935 GeneID:380705 MGI:1921591
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC380705 protein_id : NP_001028605.1

name	4933402P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425070 CCDS:CCDS24912.1 GeneID:108803 MGI:1918293
definition	codon_start : 1 product : hypothetical protein LOC108803 protein_id : NP_780577.1

name	1700095G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144227237 GeneID:74288 MGI:1921538
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA] codon_start : 1 product : spermatid maturation 1 protein_id : NP_083131.1

name	Nlgn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699425 CCDS:CCDS24914.1 GeneID:216856 MGI:2681835
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence ISS] codon_start : 1 note : ortholog of human and rat neuroligin 2 NLGN2 product : neuroligin 2 protein_id : NP_942562.2

name	1810027O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625730 CCDS:CCDS24915.1 GeneID:69186 MGI:1916436
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 product : hypothetical protein LOC69186 protein_id : NP_081258.1

name	Plscr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963735 CCDS:CCDS24916.1 GeneID:70310 MGI:1917560
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP] codon_start : 1 product : phospholipid scramblase 3 protein_id : NP_076053.1

name	Tnk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560013 CCDS:CCDS24917.1 GeneID:83813 MGI:1930958
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004715 - non-membrane spanning protein tyrosine kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence IMP]; GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : non-receptor tyrosine kinase product : tyrosine kinase, non-receptor, 1 protein_id : NP_114086.2

name	LOC432576 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390189 GeneID:432576
definition	codon_start : 1 product : similar to TMEM95 protein protein_id : XP_484042.3

name	Kctd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346589 CCDS:CCDS24918.1 GeneID:216858 MGI:2448712
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0007399 - nervous system development [Evidence IDA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IDA] codon_start : 1 product : retinoic acid, EGF, and NGF upregulated protein_id : NP_694783.1

name	Centb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27881415 CCDS:CCDS24919.1 GeneID:216859 MGI:2388270
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004629 - phospholipase C activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : centaurin, beta 1 protein_id : NP_722483.2

name	2810408A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271515 CCDS:CCDS24920.1 GeneID:70419 MGI:1917669
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] GO_process : GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70419 protein_id : NP_081695.2

name	0610025P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61740637 CCDS:CCDS24921.1 GeneID:216860 MGI:1921092
definition	codon_start : 1 product : hypothetical protein LOC216860 protein_id : NP_001013432.1

name	Gps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980980 CCDS:CCDS24922.1 GeneID:56310 MGI:1891751
definition	codon_start : 1 product : G protein pathway suppressor 2 protein_id : NP_062700.2

name	Eif5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712036 CCDS:CCDS24923.1 GeneID:276770 MGI:106248
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 5A protein_id : NP_853613.1

name	Ybx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956377 GeneID:53422 MGI:1096372
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA]; GO:0045285 - ubiquinol-cytochrome-c reductase complex [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IDA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0045182 - translation regulator activity [Evidence IDA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0016478 - negative regulation of translation [Evidence IDA]; GO:0048157 - oogenesis (sensu Mammalia) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007286 - spermatid development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Y-box protein MSY2 product : Y box protein 2 protein_id : NP_058571.2

name	Slc2a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026925 GeneID:20528 MGI:95758
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence TAS] [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0000299 - integral to membrane of membrane fraction [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0048471 - perinuclear region [Evidence ISS] [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0012506 - vesicle membrane [Evidence ISS] GO_function : GO:0005355 - glucose transporter activity [Evidence TAS] [Evidence IDA]; GO:0005360 - insulin-responsive hydrogen:glucose transporter activity [Evidence TAS]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0042593 - glucose homeostasis [Evidence ISS]; GO:0015758 - glucose transport [Evidence TAS] [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 2 (facilitated glucose transporter), member 4 protein_id : NP_033230.2

name	Cldn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393144 CCDS:CCDS24925.1 GeneID:53624 MGI:1859285
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : claudin-7 product : claudin 7 protein_id : NP_058583.1

name	Rai12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055320 CCDS:CCDS24926.1 GeneID:54351 MGI:1859017
definition	codon_start : 1 exception : mismatches in translation note : Clone 13u product : S-phase 2 protein protein_id : NP_061210.1

name	Dullard (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956160 CCDS:CCDS24927.1 GeneID:67181 MGI:1914431
definition	GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Dullard homolog protein_id : NP_080293.1

name	Gabarap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789961 CCDS:CCDS24928.1 GeneID:56486 MGI:1861742
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IDA]; GO:0005790 - smooth endoplasmic reticulum [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GABA-A receptor-associated protein; gamma-aminobutyric acid reseptor associated protein product : gamma-aminobutyric acid receptor associated protein protein_id : NP_062723.1

name	Phf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313418 CCDS:CCDS24929.1 GeneID:78246 MGI:1925496
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PHD zinc finger containing protein JUNE1; novel PHD-finger protein JUNE1 product : PHD finger protein 23 protein_id : NP_084340.1

name	Dvl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299588 CCDS:CCDS24930.1 GeneID:13543 MGI:106613
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0001843 - neural tube closure [Evidence IMP]; GO:0007379 - segment specification [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence TAS] [Evidence IDA] codon_start : 1 note : dishevelled 2, dsh homolog (Drosophila) (MGD\|MGI:106613 GB\|NM_007888, evidence: BLASTN, 99%, match=2936); putative product : dishevelled 2, dsh homolog protein_id : NP_031914.3

name	Acadvl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956084 CCDS:CCDS24931.1 GeneID:11370 MGI:895149
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A dehydrogenase, very long chain protein_id : NP_059062.1

name	Dlg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681195 GeneID:13385 MGI:1277959
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence NAS]; GO:0031234 - extrinsic to internal side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence IDA] [Evidence ISS]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0042043 - neurexin binding [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0008022 - protein C-terminus binding [Evidence NAS]; GO:0005102 - receptor binding [Evidence NAS]; GO:0005198 - structural molecule activity [Evidence NAS] GO_process : GO:0007626 - locomotory behavior [Evidence NAS]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IGI]; GO:0042220 - response to cocaine [Evidence NAS]; GO:0016188 - synaptic vesicle maturation [Evidence IGI] [Evidence IDA]; GO:0007416 - synaptogenesis [Evidence NAS] codon_start : 1 function : guanylate kinase note : discs large homolog 4; synapse-associated protein 90; PSD-95 alpha; PSD-95 beta; PSD-95 alpha 2b product : postsynaptic density protein 95 protein_id : NP_031890.1

name	Asgr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753126 CCDS:CCDS24933.1 GeneID:11889 MGI:88081
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : asialoglycoprotein receptor 1 protein_id : NP_033844.1

name	Asgr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680734 CCDS:CCDS24934.1 GeneID:11890 MGI:88082
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : asialoglycoprotein receptor 2 protein_id : NP_031519.1

name	Mgl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553093 CCDS:CCDS24935.1 GeneID:216864 MGI:2385729
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030246 - carbohydrate binding [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : macrophage galactose-type C-type lectin 2 product : macrophage galactose N-acetyl-galactosamine specific lectin 2 protein_id : NP_660119.1

name	Mgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754688 CCDS:CCDS24936.1 GeneID:17312 MGI:96975
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : macrophage galactose N-acetyl-galactosamine specific lectin 1 protein_id : NP_034926.1

name	Slc16a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346495 GeneID:216867 MGI:2663709
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel RNA polymerase Rpb1 C-terminal repeat domain containing protein product : solute carrier family 16, member 11 protein_id : NP_694721.1

name	Slc16a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336097 CCDS:CCDS24938.1 GeneID:69309 MGI:1916559
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 16 (monocarboxylic acid transporters), member 13 protein_id : NP_758959.1

name	Bcl6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671616 CCDS:CCDS24939.1 GeneID:12029 MGI:1278332
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : BcL6-associated zinc finger protein product : B-cell CLL/lymphoma 6, member B protein_id : NP_031554.1

name	0610010K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21389318 CCDS:CCDS24940.1 GeneID:104457 MGI:1915609
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC104457 protein_id : NP_081033.1

name	D11Bwg0434e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239393 GeneID:52898 MGI:106369
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC52898 protein_id : NP_776103.1

name	Alox12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542127 CCDS:CCDS24942.1 GeneID:11684 MGI:87998
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence ISS] [Evidence IEA]; GO:0047977 - hepoxilin-epoxide hydrolase activity [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019870 - potassium channel inhibitor activity [Evidence ISS] GO_process : GO:0019369 - arachidonic acid metabolism [Evidence ISS]; GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA]; GO:0045794 - negative regulation of cell volume [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0042391 - regulation of membrane potential [Evidence ISS] codon_start : 1 product : arachidonate 12-lipoxygenase protein_id : NP_031466.2

name	Alox12e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729795 CCDS:CCDS24943.1 GeneID:11685 MGI:1274790
definition	GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA] codon_start : 1 product : arachidonate lipoxygenase, epidermal protein_id : NP_663717.1

name	Alox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948633 CCDS:CCDS24944.1 GeneID:11687 MGI:87997
definition	GO_function : GO:0004052 - arachidonate 12-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : arachidonate 15-lipoxygenase protein_id : NP_033790.3

name	Pelp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38230105 CCDS:CCDS24945.1 GeneID:75273 MGI:1922523
definition	codon_start : 1 exception : mismatches in translation product : proline-, glutamic acid-, leucine-rich protein 1 protein_id : NP_083507.2

name	LOC382532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382532
definition	number : 1 pseudo : _no_value

name	LOC100041994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041994
definition	number : 2 pseudo : _no_value

name	LOC100041994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041994
definition	number : 1 pseudo : _no_value

name	LOC668442 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668442
definition	number : 1 pseudo : _no_value

name	LOC668466 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261976 GeneID:668466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 8 Proteins product : similar to Fgfr1op2 protein pseudo : _no_value transcript_id : XR_034580.1

clone name	MSMg01-547A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-065L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098B04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490M13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-487O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512K03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-216I14.b	B6Ng01-216I14.g
ACC	GA033200	GA033201
length	894	159
definition	B6Ng01-216I14.b	B6Ng01-216I14.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttgttcagctctgagccccatttttaatggggttatttgattt tctggagcctaccttcttgagttctttatatatattggatatttgtccct tatctgatttaggataggtaaagatcctttcccaatctgttggtggtctt tttgtcttgttgatgttgtcttttgccttgcagaagctttgcaacttcat gaggtcccacttatcaattctcgatcttactgcagaagccattgctgttc tattcaggaactttccccctgtacccatatctttgaggctttcccctact ttctcctctataagtttcagtgtctcaggttttatgtggagttccttaat acacttagatttgaccttagtacaaggagataggaatggatcaattcgca ttattctacataataaccaccaattgtgccagcaccatttgttgaaaatg ctgtctttcttccactggatgattttagctcccttgtcaaagatcaagtg accataggtgtgtgggttcttctctgggtcttcaattctgttccattggt ctacttgtctgttgctataccagtaccatgattttttttatcacaattgc tctgtagtacagctttatgtcaggcatggtgattccaccagaggttcttt tatccttgagaagagtttttgctatcctatgtttttttgttattgtccta ggccactcttgtaaaggcaaacactgagtcggggctggcttacaatttca gaagtttagttcattgtcatcatggcaggaaacatggtaggacacagcag atatagcagctagagaagtaactgggacttctacatcttgatccataggc agaggggtagaaggagagggacaggagagtgagagggaggtagg	tgttaagaagctgggggaggcagaggcaggcggatttctgagttcgagac cagcctggtctacaaagtgagttccaggacagccagggctacacagagaa accctgtctcgaaaaaaccaaaaccaaaaagaagaaggaggaggaggagg aggaggagg
quality values	Open. Hide. 58 29 20 25 58 58 45 58 58 49 62 62 31 19 42 62 62 62 62 62 54 56 62 62 62 56 42 62 62 62 62 42 42 38 24 38 32 32 28 33 45 56 59 62 62 62 62 59 62 49 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 42 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 56 62 62 62 62 54 62 62 62 62 62 62 47 54 54 47 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 54 58 54 41 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 47 54 54 53 58 54 54 54 54 54 58 54 53 58 58 58 58 58 58 37 47 53 54 54 54 49 52 58 58 58 58 58 49 58 58 50 51 40 53 39 48 45 30 38 51 58 54 53 41 51 50 30 26 48 58 32 40 51 27 19 9 15 23 28 35 37 47 32 49 42 49 29 49 18 51 32 58 51 46 58 58 39 50 41 49 37 16 35 50 58 26 58 29 25 58 36 50 58 58 58 53 53 41 50 39 42 58 58 39 51 38 58 28 58 58 58 58 58 51 44 34 42 52 28 23 20 13 39 39 25 54 37 47 31 40 39 35 41 47 47 51 49 31 44 54 32 52 39 17 27 52 46 42 35 39 52 54 41 20 42 41 18 54 54 51 38 42 41 54 37 45 42 39 33 34 17 28 48 37 42 40 18 53 53 37 40 53 53 53 37 53 31 40 34 43 53 53 32 32 25 42 35 30 31 40 47 40 32 15 25 35 52 40 39 33 41 36 33 15 31 31 31 33 20 28 32 11 22 21 12 18 27 25 25 36 37 13 32 42 11 26 39 32 18 20 18 27 32 29 34 27 33 32 31 42 46 28 24 22 46 38 33 17 17 31 30 34 43 43 21 30 21 9 23 30 31 30 31 14 8 25 25 7 33 24 41 31 32 24 28 18 30 27 9 11 30 19 41 25 39 30 29 11 11 9 6 6 5 29 9 23 25 29 17 35 17 36 17 31 21 13 13 12 41 21	Open. Hide. 59 32 21 49 30 20 16 37 28 13 22 29 35 43 50 62 62 62 59 59 30 59 62 62 62 59 51 62 62 59 49 62 62 59 36 62 62 62 59 59 62 62 62 62 62 59 59 62 59 62 62 44 54 59 62 59 54 35 48 56 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 56 62

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_69239249_69239395
seq2: B6Ng01-216I14.g_85_229 (reverse)

seq1  CCTCCTCCTCCTCAGCCTCCTCCTCCTT-TTTTTTTTTTTTTTGGTTTTT  49
      ||||||||||||   ||||||||||||| || |||||  |||||||||||
seq2  CCTCCTCCTCCT---CCTCCTCCTCCTTCTTCTTTTTGGTTTTGGTTTTT  47

seq1  TTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTG  99
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTG  97

seq1  TAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCC  147
      ||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  TAGACCAGGCTGGTCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCC  145

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information