MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-218B10
Chromosome	11 (Build37)
Map Location	60,388,482 - 60,528,340
singlet/doublet	doublet
Overlap gene	LOC100042448, LOC624403, LOC624424, OTTMUSG00000007757, LOC668206, Llgl1, Flii
Upstream gene	LOC668157, Olfr223, GA_x5J8B7W3UM0-970645-971221, Olfr225, AA536749, 4933433K01Rik, Flcn, Cops3, Nt5m, Med9, Rasd1, Pemt, Rai1, Srebf1, Tom1l2, LOC667892, Lrrc48, Atpaf2, 4933439F18Rik, LOC674310, Drg2, Myo15, Alkbh5
Downstream gene	Smcr7, Top3a, LOC100042517, Smcr8, Shmt1, LOC625958, LOC637900, Dhrs7b, Tmem11, Gtlf3b, Map2k3, Kcnj12, LOC668228, Tnfrsf13b, Usp22, LOC668239, Aldh3a1, Aldh3a2, 4933429E10Rik, 1300013J15Rik, LOC100042602, LOC626150, Zfp179, Mfap4, Mapk7, 3110043A19Rik, Eppb9, Epn2, Grap, Slc5a10, 2310040C09Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668157 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins pseudo : _no_value

name	Olfr223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258421 MGI:3030057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3UM0-970645-971221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257835
definition	note : olfactory receptor GA_x5J8B7W3UM0-970645-971221 pseudo : _no_value

name	Olfr225 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257886 MGI:3030059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA536749 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26936 MGI:1349438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933433K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194908 MGI:2687283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flcn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216805 MGI:2442184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cops3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26572 MGI:1349409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103850 MGI:1917127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192191 MGI:2183151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19416 MGI:1270848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pemt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18618 MGI:104535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rai1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19377 MGI:103291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Srebf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20787 MGI:107606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tom1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216810 MGI:2443306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC667892 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Lrrc48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74665 MGI:1921915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpaf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246782 MGI:2180561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933439F18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66771 MGI:1914021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674310 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Drg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13495 MGI:1342307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17910 MGI:1261811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Alkbh5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268420 MGI:2144489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 109 ESTs, 14 Proteins

name	LOC624403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624403
definition	note : poly(A) binding protein, cytoplasmic 4 pseudogene pseudo : _no_value

name	LOC624424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624424
definition	note : poly(A) binding protein, cytoplasmic 4 pseudogene pseudo : _no_value

name	OTTMUSG00000007757 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544782 MGI:3649879
definition	note : predicted gene, OTTMUSG00000007757 pseudo : _no_value

name	LOC668206 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 10 Proteins

name	Llgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16897 MGI:102682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flii (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14248 MGI:1342286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smcr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237781 MGI:2144199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Top3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21975 MGI:1197527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Smcr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237782 MGI:2444720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20425 MGI:98299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC637900 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 113 ESTs, 4 Proteins

name	Dhrs7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216820 MGI:2384931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216821 MGI:2144726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtlf3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24083 MGI:1344388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26397 MGI:1346868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16515 MGI:108495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Tnfrsf13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57916 MGI:1889411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216825 MGI:2144157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1086 ESTs, 1 Protein

name	Aldh3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11670 MGI:1353451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh3a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11671 MGI:1353452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933429E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380701 MGI:3588190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300013J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67473 MGI:1914723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042602 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC626150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 303 ESTs, 21 Proteins

name	Zfp179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22671 MGI:106611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76293 MGI:1342276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23939 MGI:1346347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110043A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73216 MGI:1920466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Eppb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27078 MGI:1351471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13855 MGI:1333766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71520 MGI:1918770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109342 MGI:1926089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69640 MGI:1916890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238927 GeneID:258421 MGI:3030057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 223 transcript_id : NM_146429.1

name	Olfr225 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801273 GeneID:257886 MGI:3030059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 225 transcript_id : NM_001011740.1

name	AA536749 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130928 GeneID:26936 MGI:1349438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA536749 transcript_id : NM_201245.2

name	AA536749 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27819595 GeneID:26936 MGI:1349438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA536749 transcript_id : NM_012027.1

name	4933433K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358941 GeneID:194908 MGI:2687283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933433K01 gene transcript_id : NM_183139.2

name	Flcn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122492 GeneID:216805 MGI:2442184
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folliculin transcript_id : NM_146018.1

name	Cops3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753487 GeneID:26572 MGI:1349409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 3 (Arabidopsis thaliana) transcript_id : NM_011991.1

name	Nt5m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129938 GeneID:103850 MGI:1917127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5',3'-nucleotidase, mitochondrial transcript_id : NM_134029.2

name	Med9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579900 GeneID:192191 MGI:2183151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 9 homolog (yeast) transcript_id : NM_138675.3

name	Rasd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382817 GeneID:19416 MGI:1270848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS, dexamethasone-induced 1 transcript_id : NM_009026.2

name	Pemt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33667035 GeneID:18618 MGI:104535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylethanolamine N-methyltransferase transcript_id : NM_008819.2

name	Rai1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649746 GeneID:19377 MGI:103291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid induced 1 transcript_id : NM_009021.2

name	Rai1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649744 GeneID:19377 MGI:103291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid induced 1 transcript_id : NM_001037764.1

name	Srebf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384748 GeneID:20787 MGI:107606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterol regulatory element binding factor 1 transcript_id : NM_011480.2

name	Tom1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875529 GeneID:216810 MGI:2443306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : target of myb1-like 2 (chicken) transcript_id : NM_153080.2

name	Tom1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181303 GeneID:216810 MGI:2443306
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : target of myb1-like 2 (chicken) transcript_id : NM_001039092.2

name	Tom1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875525 GeneID:216810 MGI:2443306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : target of myb1-like 2 (chicken) transcript_id : NM_001039093.1

name	Lrrc48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379069 GeneID:74665 MGI:1921915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 48 transcript_id : NM_029044.2

name	Atpaf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703851 GeneID:246782 MGI:2180561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase mitochondrial F1 complex assembly factor 2 transcript_id : NM_145427.1

name	4933439F18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328468 GeneID:66771 MGI:1914021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933439F18 gene transcript_id : NM_025757.3

name	Drg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946677 GeneID:13495 MGI:1342307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : developmentally regulated GTP binding protein 2 transcript_id : NM_021354.1

name	Myo15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754779 GeneID:17910 MGI:1261811
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin XV transcript_id : NM_010862.1

name	Myo15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281976 GeneID:17910 MGI:1261811
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin XV transcript_id : NM_182698.1

name	Alkbh5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803054 GeneID:268420 MGI:2144489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkB, alkylation repair homolog 5 (E. coli) transcript_id : NM_172943.3

name	LOC100042448 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261935 GeneID:100042448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 103 ESTs, 14 Proteins product : similar to Poly A binding protein, cytoplasmic 4, transcript variant 2 transcript_id : XM_001478623.1

name	LOC100042448 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261933 GeneID:100042448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 108 ESTs, 14 Proteins product : similar to Poly A binding protein, cytoplasmic 4, transcript variant 1 transcript_id : XM_001478614.1

name	LOC668206 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390138 GeneID:668206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 10 Proteins product : similar to Ubiquitin A-52 residue ribosomal protein fusion product 1 transcript_id : XM_001000017.1

name	Llgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678695 GeneID:16897 MGI:102682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lethal giant larvae homolog 1 (Drosophila) transcript_id : NM_008502.1

name	Flii (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11528489 GeneID:14248 MGI:1342286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flightless I homolog (Drosophila) transcript_id : NM_022009.1

name	Smcr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57862818 GeneID:237781 MGI:2144199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smith-Magenis syndrome chromosome region, candidate 7 homolog (human) transcript_id : NM_001009927.1

name	Top3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344076 GeneID:21975 MGI:1197527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : topoisomerase (DNA) III alpha transcript_id : NM_009410.2

name	LOC100042517 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261943 GeneID:100042517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042517 transcript_id : XM_001478819.1

name	Smcr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801967 GeneID:237782 MGI:2444720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) transcript_id : NM_175491.3

name	Shmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846102 GeneID:20425 MGI:98299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine hydroxymethyltransferase 1 (soluble) transcript_id : NM_009171.2

name	LOC637900 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390140 GeneID:637900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 113 ESTs, 4 Proteins product : similar to ribosomal protein L21 transcript_id : XM_484035.4

name	Dhrs7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703853 GeneID:216820 MGI:2384931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 7B transcript_id : NM_145428.1

name	Tmem11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801759 GeneID:216821 MGI:2144726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 11 transcript_id : NM_173453.2

name	Gtlf3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372070 GeneID:24083 MGI:1344388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene trap locus F3b transcript_id : NM_025294.4

name	Map2k3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227250 GeneID:26397 MGI:1346868
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 3 transcript_id : NM_008928.2

name	Kcnj12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803056 GeneID:16515 MGI:108495
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 12 transcript_id : NM_010603.4

name	Tnfrsf13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946667 GeneID:57916 MGI:1889411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 13b transcript_id : NM_021349.1

name	Usp22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802354 GeneID:216825 MGI:2144157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 22 transcript_id : NM_001004143.3

name	LOC668239 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261911 GeneID:668239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1086 ESTs, 1 Protein product : similar to Rps13 protein transcript_id : XM_001000226.2

name	Aldh3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680675 GeneID:11670 MGI:1353451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase family 3, subfamily A1 transcript_id : NM_007436.1

name	Aldh3a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802078 GeneID:11671 MGI:1353452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase family 3, subfamily A2 transcript_id : NM_007437.3

name	4933429E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802846 GeneID:380701 MGI:3588190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933429E10 gene transcript_id : NM_001033542.2

name	1300013J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387278 GeneID:67473 MGI:1914723
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300013J15 gene transcript_id : NM_026183.3

name	LOC100042602 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261947 GeneID:100042602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042602 transcript_id : XM_001478935.1

name	LOC626150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261949 GeneID:626150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 303 ESTs, 21 Proteins product : similar to H3 histone, family 3A transcript_id : XM_890719.3

name	Zfp179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20127401 GeneID:22671 MGI:106611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 179 transcript_id : NM_009548.2

name	Mfap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130625 GeneID:76293 MGI:1342276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 4 transcript_id : NM_029568.2

name	Mapk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754633 GeneID:23939 MGI:1346347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 7 transcript_id : NM_011841.1

name	3110043A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261912 GeneID:73216 MGI:1920466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 3110043A19 gene transcript_id : XM_001476479.1

name	Eppb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367793 GeneID:27078 MGI:1351471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial precursor protein B9 transcript_id : NM_013717.2

name	Epn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129929 GeneID:13855 MGI:1333766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epsin 2 transcript_id : NM_010148.2

name	Grap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802524 GeneID:71520 MGI:1918770
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRB2-related adaptor protein transcript_id : NM_027817.2

name	Slc5a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361551 GeneID:109342 MGI:1926089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium/glucose cotransporter), member 10 transcript_id : NM_001033227.2

name	2310040C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647254 GeneID:69640 MGI:1916890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310040C09 gene transcript_id : NM_178618.3

name	Olfr223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238928 CCDS:CCDS24773.1 GeneID:258421 MGI:3030057
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T000SA-78-1037; olfactory receptor MOR256-30; novel 7 transmembrane receptor (rhodopsin family) domain-containing protein product : olfactory receptor 223 protein_id : NP_666640.1

name	Olfr225 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801274 GeneID:257886 MGI:3030059
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T0073K-490-1545; olfactory receptor MOR256-51 product : olfactory receptor 225 protein_id : NP_001011740.1

name	AA536749 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152239 CCDS:CCDS24774.1 GeneID:26936 MGI:1349438
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Rho interacting protein 3; p116 Rho interacting protein product : Rho interacting protein 3 isoform 1 protein_id : NP_957697.1

name	AA536749 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819596 CCDS:CCDS24775.1 GeneID:26936 MGI:1349438
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : involved in control of the actin cytoskeleton; signaling protein note : isoform 2 is encoded by transcript variant 2; Rho interacting protein 3; p116 Rho interacting protein product : Rho interacting protein 3 isoform 2 protein_id : NP_036157.1

name	4933433K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358942 GeneID:194908 MGI:2687283
definition	codon_start : 1 note : novel Phospholipase D Active site motif-containing protein product : hypothetical protein LOC194908 protein_id : NP_898962.2

name	Flcn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122493 CCDS:CCDS24777.1 GeneID:216805 MGI:2442184
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : folliculin protein_id : NP_666130.1

name	Cops3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753488 CCDS:CCDS24778.1 GeneID:26572 MGI:1349409
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP] codon_start : 1 note : COP9 complex S3 product : COP9 (constitutive photomorphogenic), subunit 3 protein_id : NP_036121.1

name	Nt5m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20127399 CCDS:CCDS24779.1 GeneID:103850 MGI:1917127
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0009120 - deoxyribonucleoside metabolism [Evidence IC]; GO:0009117 - nucleotide metabolism [Evidence IEA] codon_start : 1 product : 5',3'-deoxyribonucleotidase, mitochondrial protein_id : NP_598790.1

name	Med9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981674 CCDS:CCDS24780.1 GeneID:192191 MGI:2183151
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 9 homolog protein_id : NP_619616.2

name	Rasd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677673 CCDS:CCDS24781.1 GeneID:19416 MGI:1270848
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS, dexamethasone-induced 1 protein_id : NP_033052.1

name	Pemt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33667036 CCDS:CCDS24782.1 GeneID:18618 MGI:104535
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0008170 - N-methyltransferase activity [Evidence IEA]; GO:0004608 - phosphatidylethanolamine N-methyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence ISS]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0006644 - phospholipid metabolism [Evidence IEA] codon_start : 1 product : phosphatidylethanolamine N-methyltransferase protein_id : NP_032845.2

name	Rai1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649745 CCDS:CCDS24784.1 GeneID:19377 MGI:103291
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0040015 - negative regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : retinoic acid induced 1 protein_id : NP_001032853.1

name	Rai1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649747 CCDS:CCDS24784.1 GeneID:19377 MGI:103291
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0040015 - negative regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : retinoic acid induced 1 protein_id : NP_033047.2

name	Srebf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753981 CCDS:CCDS24785.1 GeneID:20787 MGI:107606
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : adipocyte determination- and differentiation-dependent factor 1 product : sterol regulatory element binding factor 1 protein_id : NP_035610.1

name	Tom1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875524 GeneID:216810 MGI:2443306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; target of myb1-like 2; myb1-like protein 2 product : target of myb1-like 2 isoform b protein_id : NP_001034181.1

name	Tom1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875530 CCDS:CCDS24786.1 GeneID:216810 MGI:2443306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; target of myb1-like 2; myb1-like protein 2 product : target of myb1-like 2 isoform a protein_id : NP_694720.2

name	Tom1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875526 CCDS:CCDS24787.1 GeneID:216810 MGI:2443306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; target of myb1-like 2; myb1-like protein 2 product : target of myb1-like 2 isoform c protein_id : NP_001034182.1

name	Lrrc48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312844 GeneID:74665 MGI:1921915
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel Leucine Rich Repeat domain-containing protein product : leucine rich repeat containing 48 protein_id : NP_083320.1

name	Atpaf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703852 CCDS:CCDS24789.1 GeneID:246782 MGI:2180561
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : ATP synthase mitochondrial F1 complex assembly factor 2 protein_id : NP_663402.1

name	4933439F18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328469 CCDS:CCDS24790.1 GeneID:66771 MGI:1914021
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66771 protein_id : NP_080033.2

name	Drg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946678 CCDS:CCDS24791.1 GeneID:13495 MGI:1342307
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : developmentally regulated GTP-binding protein 2 product : developmentally regulated GTP binding protein 2 protein_id : NP_067329.1

name	Myo15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754780 CCDS:CCDS24792.1 GeneID:17910 MGI:1261811
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; myosin XVA; shaker 2 product : myosin XV isoform 1 protein_id : NP_034992.1

name	Myo15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281977 CCDS:CCDS24793.1 GeneID:17910 MGI:1261811
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 2a is encoded by transcript variant 2; myosin XVA; shaker 2 product : myosin XV isoform 2a protein_id : NP_874357.1

name	Alkbh5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044423 CCDS:CCDS24794.1 GeneID:268420 MGI:2144489
definition	codon_start : 1 note : oxoglutarate and iron-dependent oxygenase domain containing product : alkB, alkylation repair homolog 5 protein_id : NP_766531.2

name	LOC100042448 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261934 GeneID:100042448
definition	codon_start : 1 product : similar to Poly A binding protein, cytoplasmic 4 isoform 1 protein_id : XP_001478664.1

name	LOC100042448 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261936 GeneID:100042448
definition	codon_start : 1 product : similar to Poly A binding protein, cytoplasmic 4 isoform 2 protein_id : XP_001478673.1

name	LOC668206 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390139 GeneID:668206
definition	codon_start : 1 product : similar to Ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_001000017.1

name	Llgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678696 GeneID:16897 MGI:102682
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0035090 - maintenance of apical/basal cell polarity [Evidence IMP] codon_start : 1 product : lethal giant larvae homolog protein_id : NP_032528.1

name	Flii (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528490 CCDS:CCDS24795.1 GeneID:14248 MGI:1342286
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0051014 - actin filament severing [Evidence TAS]; GO:0007275 - development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : flightless I homolog protein_id : NP_071292.1

name	Smcr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57862819 CCDS:CCDS24796.1 GeneID:237781 MGI:2144199
definition	codon_start : 1 note : Smith-Magenis syndrome chromosome region, candidate 7 homolog (human0 product : Smith-Magenis syndrome chromosome region, candidate 7 homolog protein_id : NP_001009927.1

name	Top3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678403 CCDS:CCDS24797.1 GeneID:21975 MGI:1197527
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003916 - DNA topoisomerase activity [Evidence IEA]; GO:0003917 - DNA topoisomerase type I activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006304 - DNA modification [Evidence IEA]; GO:0006265 - DNA topological change [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IEA] codon_start : 1 note : topoisomerase 3 alpha; Top IIIa; topoisomerase (DNA) 3 alpha product : topoisomerase (DNA) III alpha protein_id : NP_033436.1

name	LOC100042517 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261944 GeneID:100042517
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478869.1

name	Smcr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425240 CCDS:CCDS24798.1 GeneID:237782 MGI:2444720
definition	codon_start : 1 product : Smith-Magenis syndrome chromosome region, candidate 8 homolog protein_id : NP_780700.1

name	Shmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846103 CCDS:CCDS24799.1 GeneID:20425 MGI:98299
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004372 - glycine hydroxymethyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006544 - glycine metabolism [Evidence IEA]; GO:0006563 - L-serine metabolism [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : serine hydroxymethyl transferase 1 (soluble) product : serine hydroxymethyltransferase 1 (soluble) protein_id : NP_033197.2

name	LOC637900 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390141 GeneID:637900
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484035.3

name	Dhrs7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703854 CCDS:CCDS24800.1 GeneID:216820 MGI:2384931
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dehydrogenase/reductase (SDR family) member 7B protein_id : NP_663403.1

name	Tmem11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734998 CCDS:CCDS24801.1 GeneID:216821 MGI:2144726
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 11 protein_id : NP_775655.1

name	Gtlf3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384646 CCDS:CCDS24802.1 GeneID:24083 MGI:1344388
definition	codon_start : 1 product : transcript expressed during hematopoiesis 2 protein_id : NP_079570.1

name	Map2k3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094081 CCDS:CCDS24804.1 GeneID:26397 MGI:1346868
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004708 - MAP kinase kinase activity [Evidence IMP] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IDA] [Evidence IMP]; GO:0042035 - regulation of cytokine biosynthesis [Evidence IMP] codon_start : 1 note : protein kinase, mitogen-activated, kinase 3; MAP kinase kinase 3 product : mitogen activated protein kinase kinase 3 protein_id : NP_032954.1

name	Kcnj12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560572 CCDS:CCDS24805.1 GeneID:16515 MGI:108495
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium inwardly-rectifying channel J12 protein_id : NP_034733.2

name	Tnfrsf13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946668 CCDS:CCDS24806.1 GeneID:57916 MGI:1889411
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP] codon_start : 1 note : transmembrane activator and calcium-modulating and cyclophilin ligand interactor product : tumor necrosis factor receptor superfamily, member 13b protein_id : NP_067324.1

name	Usp22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625685 CCDS:CCDS24807.1 GeneID:216825 MGI:2144157
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IC] codon_start : 1 product : ubiquitin specific protease 22 protein_id : NP_001004143.2

name	LOC668239 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390143 GeneID:668239
definition	codon_start : 1 product : similar to Rps13 protein protein_id : XP_001000226.1

name	Aldh3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680676 CCDS:CCDS24808.1 GeneID:11670 MGI:1353451
definition	EC_number : 1.2.1.3 GO_component : GO:0005737 - cytoplasm [Evidence IEP]; GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0004028 - 3-chloroallyl aldehyde dehydrogenase activity [Evidence IDA] [Evidence IMP]; GO:0008106 - alcohol dehydrogenase (NADP+) activity [Evidence ISS]; GO:0004029 - aldehyde dehydrogenase (NAD) activity [Evidence ISS]; GO:0004030 - aldehyde dehydrogenase [NAD(P)+] activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006081 - aldehyde metabolism [Evidence ISS] [Evidence IEA]; GO:0006118 - electron transport [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : aldehyde dehydrogenase 3, stomach cytosolic (class 3); alcohol dehydrogenase family 3, subfamily A1 product : aldehyde dehydrogenase family 3, subfamily A1 protein_id : NP_031462.1

name	Aldh3a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677435 CCDS:CCDS24809.1 GeneID:11671 MGI:1353452
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0004029 - aldehyde dehydrogenase (NAD) activity [Evidence IEA]; GO:0004030 - aldehyde dehydrogenase [NAD(P)+] activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006081 - aldehyde metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : aldehyde dehydrogenase 4, liver microsomal (class 3); aldehyde dehydrogenase 4, liver microsomal (class 3) regulator; alcohol dehydrogenase family 3, subfamily A2 product : aldehyde dehydrogenase family 3, subfamily A2 protein_id : NP_031463.2

name	4933429E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702045 CCDS:CCDS24810.1 GeneID:380701 MGI:3588190
definition	codon_start : 1 product : hypothetical protein LOC380701 protein_id : NP_001028714.1

name	1300013J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385694 CCDS:CCDS24811.1 GeneID:67473 MGI:1914723
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0015238 - drug transporter activity [Evidence IEA] GO_process : GO:0006855 - multidrug transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67473 protein_id : NP_080459.1

name	LOC100042602 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261948 GeneID:100042602
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478985.1

name	LOC626150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82934691 GeneID:626150
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895812.1

name	Zfp179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20127402 CCDS:CCDS24812.1 GeneID:22671 MGI:106611
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : brain finger protein product : zinc finger protein 179 protein_id : NP_033574.2

name	Mfap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313152 CCDS:CCDS24813.1 GeneID:76293 MGI:1342276
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : microfibrillar-associated protein 4 protein_id : NP_083844.1

name	Mapk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754634 CCDS:CCDS24814.1 GeneID:23939 MGI:1346347
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0045765 - regulation of angiogenesis [Evidence IMP] codon_start : 1 note : extracellular signal regulated kinase 5; big MAP kinase 1; mitogen-activated protein kinase 7; mitogen-activated kinase 7 product : mitogen activated protein kinase 7 protein_id : NP_035971.1

name	3110043A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261913 GeneID:73216 MGI:1920466
definition	codon_start : 1 product : hypothetical protein LOC73216 protein_id : XP_001476529.1

name	Eppb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305039 CCDS:CCDS24815.1 GeneID:27078 MGI:1351471
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B9 protein protein_id : NP_038745.1

name	Epn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468893 CCDS:CCDS24816.1 GeneID:13855 MGI:1333766
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : epsin 2 protein_id : NP_034278.1

name	Grap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362273 CCDS:CCDS24817.1 GeneID:71520 MGI:1918770
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : GRB2-related adaptor protein protein_id : NP_082093.1

name	Slc5a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794617 CCDS:CCDS24818.1 GeneID:109342 MGI:1926089
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 5 (sodium/glucose cotransporter), member 10 protein_id : NP_001028399.1

name	2310040C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647255 GeneID:69640 MGI:1916890
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69640 protein_id : NP_848733.2

name	LOC667892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667892
definition	number : 1 pseudo : _no_value

name	LOC674310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674310
definition	number : 1 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 1 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 2 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 3 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 4 pseudo : _no_value

name	LOC668228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668228
definition	number : 2 pseudo : _no_value

name	LOC668228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668228
definition	number : 1 pseudo : _no_value

name	LOC668157 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261905 GeneID:668157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_032580.1

clone name	MSMg01-461E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-206N23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-092O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161D24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164K13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-218B10.b	B6Ng01-218B10.g
ACC	GA034311	GA034312
length	1,151	1,194
definition	B6Ng01-218B10.b	B6Ng01-218B10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(60,388,482 - 60,389,628)	(60,527,155 - 60,528,340)
sequence	gaattccttggccttggctccaagctccgcttcccgctctttgcgagact tgaatctacccacaaacactttacggtcattgagaagcaagccattcatc ttctcgatggccttgtcggcggcctcttgggtctcaaagtgaacaaaagc gtagcccttagagccgttctcatcacagaccaccttacaggacaagatgt ttccaaaggcagagaaagtgtcatacagtgccttgttgtctatggatttg tccaggttcttgatgaagacatttcccaccccagactttctcaaagaggg atcgctctgccaccacatgatgcggataggcttttcatttatcacgtcga agttcatggtgtccaaggccctctcagcgtcagctggctgctggaagttg acgaaggcataacccagcgagcgcccagtgatcatatcgcgacagaccca gatggacagcacaggcccgacagggctgaacttttcatacagcatggctt cggtgacgtccgagtgcaaatcgcccacgtataaggaggccatggggtag ctgctggctgcagcgttcatctcctcaccccccaggaccccgagcgccgc caggaggacttctcacaaggctacgcctgggaagactggagcaaggaggc ttcgagcctggacccgagtgtggcacgacttgcacgcgactgcaaaagac ccaaaacaaaaggccctcgaaaacaatatggcccgctcctggagtttgta ccagctgtcctggcttgaggcttaaaaaataaaaattaaaagtagtaaat cccctcctaaagggggcaaaaaattgtcaagagacaatcagatgctgcac tcactgcccgccttgggaatttgcgtttcgcgataaatacaggcccaggg ctcccagaggttttacagttacagcagcccgggaaaggggaaaccaagtc tttgtggtgcctgcaaagggcagcgcggaaagtgggtgctgtacagcact gcgctgggctgctatgcggggccgcgaaaggcttgcagggccgggccggc cgagggggatggtctcacccttgaacggacatacagatgccaatgccaca gccagcagaagctggtgaaaggtcactttccgctgctccagcacaagtcg c	gaattcactttgtagaccaggctggcctcgaactcagaaatccgcctgtc tctgcctcccaagtgctgggattaaaggcgtgcgccaccactgcccagcc tgggctcagtttttttttaaaagcactataaacatcaaaagggccaagaa acccatgtgaccatttcatcctctgtatcctcaggtctacatgtgggttg ggacccagacaagccaagtggagatcaaactgagtctgaaggcttgccag gtaagagattactgaagccagcctgacggtttcaggagccacttgtccct ccctcatcctggatagacgttgaggaaggggcacagtggtcagtccagca ggccttagaggactacccaggcccattgtttttcttaccaggtatacatc cagcacacacgctctaaagaacatgagcggccacgtcgcctgcgcctggt ccgcaaaggtaatgagcagcgcgccttcacccgctgcttccacgcctgga gcacgttccgccaagccccagcctaagcagtacctatgacctcagactcc agtgaggaagaggaggactcctcgtacctgcttcagctagccacagcctg caagcagcacacagccccaagccccaccagtgtgtccacatgtgtgcaga tgtagtttaaaagatattaaatgcttttatttttcaatattaaaaaatca gtacttttaatattaaaacaactagtttttaaaaaaagacagaaaagccg aaggtggcatctacagggaagcccatcctcactgcccgcacacacacgtg cacacacacgcacacacacacctctgactgacttcagtcatgacgcccag cagtcttctagtcacaggagcacacaatacacacagggccaggagcaagt accaaaactgctttagaaatgactgggccagcctcagttcaggcgttaga aaattactctgctttgaagaagaaaggaagtacagtatggagtgcaaaag gatgcctcgcacccctccggctgagcttgagctgggtatgtgtttcagga ccaagcatcagtcagtcgggtccgtgttaaaggggcaggctaagtacgta acgatggttgactactatggagccaaccagttcatgctgctctgcgggta gctagccttcatggtatggccagaatgggcttgctgggggagct
quality values	Open. Hide. 58 36 27 34 58 58 46 62 62 62 38 62 62 62 62 62 47 62 62 62 39 21 54 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 49 49 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 51 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 47 47 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 46 62 62 35 32 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 54 54 62 62 54 54 47 54 41 58 49 52 54 52 54 46 54 49 54 54 54 58 42 54 58 41 41 58 36 28 54 36 29 54 54 54 52 47 52 52 42 44 48 58 54 54 52 54 34 54 54 58 58 54 52 58 58 52 54 21 58 58 58 58 33 58 58 58 54 58 42 41 58 52 58 54 54 37 58 52 52 58 47 51 48 46 46 51 49 50 46 29 52 58 50 58 58 32 53 53 52 51 50 58 43 54 50 50 51 40 51 50 51 48 49 49 42 21 58 58 58 52 39 27 54 46 40 50 51 50 41 27 50 58 37 42 35 20 50 44 50 46 39 58 49 58 38 28 27 49 50 35 50 50 58 50 58 49 50 49 42 53 58 42 52 50 39 32 53 58 49 53 37 29 41 50 50 38 53 39 47 37 39 44 52 54 20 36 58 24 33 38 29 49 33 58 38 45 54 54 54 54 51 35 18 54 46 54 31 33 53 24 54 54 25 35 45 42 26 41 39 54 49 31 34 54 54 42 30 41 41 39 26 54 26 23 54 49 44 44 27 47 54 54 39 46 35 29 47 34 28 41 22 19 28 51 28 45 33 28 31 23 23 40 22 34 30 45 43 45 45 19 13 36 53 37 32 32 31 32 8 40 27 21 31 46 47 22 34 45 28 25 16 14 51 53 42 32 29 40 40 9 9 14 37 28 43 35 51 51 29 34 31 42 21 7 38 24 37 32 21 28 51 42 31 29 25 51 31 33 24 29 7 9 6 46 46 6 9 27 26 28 28 23 18 32 19 26 32 31 16 22 32 32 7 40 33 33 48 31 29 46 39 16 31 44 28 27 28 31 30 22 37 36 36 48 31 31 21 18 32 7 19 31 25 14 20 32 41 46 31 24 47 31 24 22 7 36 26 13 13 18 16 41 6 31 12 11 44 7 11 25 24 34 24 6 10 13 24 11 34 13 21 23 26 15 17 37 14 28 48 34 30 33 27 27 34 32 24 19 17 10 24 34 18 10 6 7 14 7 17 30 14 14 22 27 21 17 22 13 8 31 43 28 5 6 26 30 12 4 6 20 7 4 11 8 13 7 33 30 26 11 9 13 10 22 7 7 7 5 13 7 34 20 5 7 21 8 11 6 18 16 16 8 7 11 7 5 6 6 11 11 10 14 11 10 10 28 21 11 10 17 5 11 20 5 9 6 13 3 4 7 24 22 7 18 11 10 6 7 8 16 26 22 7 5 23 5 6 14 10 26 8 18 12 4 3 1 4 6 6 17 11 7 3 1 5 10 4 14 5 5 15 7 15	Open. Hide. 62 47 51 47 62 42 42 47 62 62 62 62 47 54 56 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 54 49 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 56 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 47 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 56 62 51 62 62 56 62 62 56 56 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 38 62 52 48 52 52 52 52 38 62 62 62 62 62 62 62 54 47 47 52 41 52 52 52 52 49 47 31 52 52 52 52 35 47 52 54 54 48 43 38 43 48 58 34 58 54 54 37 58 33 52 58 35 58 43 37 45 54 49 41 44 58 54 54 54 58 58 58 58 46 45 54 54 42 54 45 54 54 58 37 36 54 54 52 52 54 52 58 52 48 52 41 54 54 50 58 54 54 54 42 47 54 52 58 54 42 20 58 52 58 58 58 54 47 41 34 41 54 46 58 52 54 52 54 42 42 54 35 47 54 52 46 16 32 49 47 39 49 46 50 50 43 26 47 50 53 39 58 58 51 40 50 52 52 50 50 46 50 50 48 58 50 53 58 58 54 34 23 51 54 53 24 41 25 58 50 46 42 21 29 58 58 54 58 25 39 46 41 37 21 25 24 24 50 58 35 40 39 29 46 31 54 42 44 49 40 50 14 52 51 31 50 37 36 58 58 58 19 12 58 51 54 51 54 58 42 53 26 50 50 58 51 50 49 26 50 51 19 58 25 14 36 28 25 32 32 32 50 42 50 39 50 21 20 49 50 41 50 21 41 35 39 29 37 31 33 49 37 27 28 37 41 13 41 17 15 36 34 31 40 40 34 40 28 42 39 49 37 35 7 15 9 6 6 10 5 13 8 40 32 37 32 35 26 40 33 37 32 16 26 41 41 38 37 33 23 40 40 33 18 32 35 22 15 29 45 31 24 34 45 31 18 25 51 49 19 31 22 36 53 30 39 21 7 26 39 21 26 26 28 22 20 39 40 23 39 42 22 32 21 27 12 21 25 18 31 28 24 19 25 31 30 18 20 24 21 21 19 29 22 25 9 6 22 12 25 28 26 24 30 20 14 31 51 44 24 31 35 27 45 51 28 27 14 36 46 16 21 30 12 11 21 27 38 13 25 22 26 19 16 7 13 19 12 6 5 5 6 6 9 16 14 13 22 27 27 8 46 39 33 18 7 17 18 11 27 26 14 26 28 23 30 19 16 16 9 23 15 8 12 19 46 13 12 30 15 30 13 29 9 11 8 11 24 28 27 29 17 8 6 9 16 31 31 44 47 15 25 12 32 23 15 8 16 32 31 24 16 29 20 29 14 8 15 10 9 10 14 6 20 24 17 5 8 28 10 10 8 4 5 17 16 43 17 5 15 17 25 10 7 6 23 14 6 6 12 11 4 5 29 8 16 5 8 13 15 21 13 8 10 12 17 11 9 10 9 19 17 19 22 20 12 19 23 23 15 10 28 11 17 27 27 15 8 19 3 15 6 7 28 14 7 7 14 30 6 3 5 5 6 6 12 4 11 24 7 17 7 6 6 6 10 6 15 3 3 3 4 9 8 5 6 17 9 10 19 5 3 2 10 5 11 4 3 3 2 3 5 5 7 4 3 5 3 2 3 1 4 15 6 4 22 6 15 3 3 3 3 6 10 23 6 8 11 4 8 2 3 3 5 4 4 18 4 12 24 12 12 20 18 11 8 17 6 7 15 9 4 7 5 5 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_60388482_60389628
seq2: B6Ng01-218B10.b_47_1197

seq1  GAATTCCTTGGCCTTGGCTCCAAGCTCCGCTTCCCGCTCTTTGCGAGACT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTGGCCTTGGCTCCAAGCTCCGCTTCCCGCTCTTTGCGAGACT  50

seq1  TGAATCTACCCACAAACACTTTACGGTCATTGAGAAGCAAGCCATTCATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATCTACCCACAAACACTTTACGGTCATTGAGAAGCAAGCCATTCATC  100

seq1  TTCTCGATGGCCTTGTCGGCGGCCTCTTGGGTCTCAAAGTGAACAAAAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCGATGGCCTTGTCGGCGGCCTCTTGGGTCTCAAAGTGAACAAAAGC  150

seq1  GTAGCCCTTAGAGCCGTTCTCATCACAGACCACCTTACAGGACAAGATGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCCCTTAGAGCCGTTCTCATCACAGACCACCTTACAGGACAAGATGT  200

seq1  TTCCAAAGGCAGAGAAAGTGTCATACAGTGCCTTGTTGTCTATGGATTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAAAGGCAGAGAAAGTGTCATACAGTGCCTTGTTGTCTATGGATTTG  250

seq1  TCCAGGTTCTTGATGAAGACATTTCCCACCCCAGACTTTCTCAAAGAGGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGTTCTTGATGAAGACATTTCCCACCCCAGACTTTCTCAAAGAGGG  300

seq1  ATCGCTCTGCCACCACATGATGCGGATAGGCTTTTCATTTATCACGTCGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGCTCTGCCACCACATGATGCGGATAGGCTTTTCATTTATCACGTCGA  350

seq1  AGTTCATGGTGTCCAAGGCCCTCTCAGCGTCAGCTGGCTGCTGGAAGTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCATGGTGTCCAAGGCCCTCTCAGCGTCAGCTGGCTGCTGGAAGTTG  400

seq1  ACGAAGGCATAACCCAGCGAGCGCCCAGTGATCATATCGCGACAGACCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAAGGCATAACCCAGCGAGCGCCCAGTGATCATATCGCGACAGACCCA  450

seq1  GATGGACAGCACAGGCCCGACAGGGCTGAACTTTTCATACAGCATGGCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGACAGCACAGGCCCGACAGGGCTGAACTTTTCATACAGCATGGCTT  500

seq1  CGGTGACGTCCGAGTGCAAATCGCCCACGTATAAGGAGGCCATGGGGTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGTGACGTCCGAGTGCAAATCGCCCACGTATAAGGAGGCCATGGGGTAG  550

seq1  CTGCTGGCTGCAGCGTTCATCTCCTCACCCCCCAGGACCCCGAGCGCCGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGGCTGCAGCGTTCATCTCCTCACCCCCCAGGACCCCGAGCGCCGC  600

seq1  CAGGAGGACTTCTCACAAGGCTACGCCTGGGAAGACTGGAGCAAGGAGGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGGACTTCTCACAAGGCTACGCCTGGGAAGACTGGAGCAAGGAGGC  650

seq1  TTCGAGCCTGGACCCGAGTGTGGCACGACTTGCACGCGACTGCAAAAGAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGAGCCTGGACCCGAGTGTGGCACGACTTGCACGCGACTGCAAAAGAC  700

seq1  CCAAAACAAAAGGCCCTCGAAAACAATATGGCCCGCTCCTGGAGTTTGTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAACAAAAGGCCCTCGAAAACAATATGGCCCGCTCCTGGAGTTTGTA  750

seq1  CCAGCTGTCCTGGCTTGAGGCTTAAAAAATAAAAATT-AAAGTAGTAAAT  799
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CCAGCTGTCCTGGCTTGAGGCTTAAAAAATAAAAATTAAAAGTAGTAAAT  800

seq1  CCCCTCCTAAAGGGGGCAAAAAATTGTCAAGAGACAATCAGATGCTGCAC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTCCTAAAGGGGGCAAAAAATTGTCAAGAGACAATCAGATGCTGCAC  850

seq1  TCACTG-CCGCCTTGGGAATTTGCGTTTCGCGATAAATACAGGCCCAGGG  898
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTGCCCGCCTTGGGAATTTGCGTTTCGCGATAAATACAGGCCCAGGG  900

seq1  CTCCCAGAGG-TTTACAGTTACAGCAGCCCGGGAAAGGGGAAACCAAGTC  947
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CTCCCAGAGGTTTTACAGTTACAGCAGCCCGGGAAAGGGGAAACCAAGTC  950

seq1  TTTGTGGGTGCCTGCAAAGGGCAGCGCGGAAGGT-GGTGCTG-ACAGCCA  995
      ||||| ||||||||||||||||||||||||| || ||||||| |||| ||
seq2  TTTGT-GGTGCCTGCAAAGGGCAGCGCGGAAAGTGGGTGCTGTACAG-CA  998

seq1  CTGCGCTGGGCTGCTATGCGGG--CGCG-AAGGCTTGCAGGGGCGGGCCG  1042
      ||||||||||||||||||||||  |||| ||||||||||||| |||||| 
seq2  CTGCGCTGGGCTGCTATGCGGGGCCGCGAAAGGCTTGCAGGGCCGGGCC-  1047

seq1  GGCCGAGGGGGATGG-CTCACCCCTGGACGGACATACAGATGCCAATG-C  1090
      ||||||||||||||| ||||||| || ||||||||||||||||||||| |
seq2  GGCCGAGGGGGATGGTCTCACCCTTGAACGGACATACAGATGCCAATGCC  1097

seq1  ACAGGCAGGCCAGAAGCT-GTGAAA-GTCACTTCCCGGCCTGCTCCCAGC  1138
      |||| |||  |||||||| |||||| ||||||| |||  ||||| |||||
seq2  ACAGCCAG--CAGAAGCTGGTGAAAGGTCACTTTCCG--CTGCT-CCAGC  1142

seq1  ACAAGTCGC  1147
      |||||||||
seq2  ACAAGTCGC  1151

seq1: chr11_60527155_60528340
seq2: B6Ng01-218B10.g_67_1260 (reverse)

seq1  AGCT-CCCCAGCAAGCCCATCTTGGGCCAT-CACTGAAAGGGGCTGCCTA  48
      |||| ||||||||||||||| |  |||||| |  ||||   ||||  |||
seq2  AGCTCCCCCAGCAAGCCCAT-TCTGGCCATACCATGAA---GGCTAGCTA  46

seq1  CCCCGCAG-GCAGGCATGACCTGGGTTTGCTCCCCTTAGTCGTC-ACCAT  96
       ||||||| ||| |||||| || |||| |||  || |||| ||| |||||
seq2  -CCCGCAGAGCA-GCATGAACT-GGTTGGCT--CCATAGTAGTCAACCAT  91

seq1  C-TGTCGGTCTT-GCCTTGCCCCTTAACACGGACCCG-CTGACTGATGCT  143
      | |  ||  ||| ||||  ||| |||||||||||||| ||||||||||||
seq2  CGTTACGTACTTAGCCTGCCCCTTTAACACGGACCCGACTGACTGATGCT  141

seq1  GGGCCCTG-AACACAT-CCCAGCCTCAAGCTCAGCCGGAGGGGTGCGA-G  190
       || |||| ||||||| ||||| ||||||||||||||||||||||||| |
seq2  TGGTCCTGAAACACATACCCAG-CTCAAGCTCAGCCGGAGGGGTGCGAGG  190

seq1  CATCCTTTTGCACTCCATACTGTACTTCCTTTCTCCT--CAAGCAGAGTA  238
      |||||||||||||||||||||||||||||||||| ||   ||||||||||
seq2  CATCCTTTTGCACTCCATACTGTACTTCCTTTCTTCTTCAAAGCAGAGTA  240

seq1  TTTTTCTAACGCCTGGACTGA-GCTGG-CCAGTCATTTCTAAAGCAGTTT  286
       |||||||||||||| ||||| ||||| ||||||||||||||||||||||
seq2  ATTTTCTAACGCCTGAACTGAGGCTGGCCCAGTCATTTCTAAAGCAGTTT  290

seq1  TGGTACTTGCTCCTGG-CCTGTGTGTATTGTGTGCTCCTGTGACTAG-AG  334
      |||||||||||||||| |||||||||||||||||||||||||||||| ||
seq2  TGGTACTTGCTCCTGGCCCTGTGTGTATTGTGTGCTCCTGTGACTAGAAG  340

seq1  ACTGCTGGGCGTCATGACTGAAGTCAGTCAGAGGTGTGTGTGTGCGTGTG  384
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTGGGCGTCATGACTGAAGTCAGTCAGAGGTGTGTGTGTGCGTGTG  390

seq1  TGTGCACGTGTGTGTGC-GGCAGTGAGGATGGGCTTCCCTGTAGATGCCA  433
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  TGTGCACGTGTGTGTGCGGGCAGTGAGGATGGGCTTCCCTGTAGATGCCA  440

seq1  CCTTCGGCTTTTCTGTCTTTTTTTAAAAACTAGTTGTTTTAATATTAAAA  483
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCGGCTTTTCTGTCTTTTTTTAAAAACTAGTTGTTTTAATATTAAAA  490

seq1  GTACTGATTTTTTAATATTG-AAAATAAAAGCATTTAATATCTTTTAAAC  532
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GTACTGATTTTTTAATATTGAAAAATAAAAGCATTTAATATCTTTTAAAC  540

seq1  TACATCTGCACACATGTGGACACACTGGTGGGGCTTGGGGCTGTGTGCTG  582
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATCTGCACACATGTGGACACACTGGTGGGGCTTGGGGCTGTGTGCTG  590

seq1  CTTGCAGGCTGTGGCTAGCTGAAGCAGGTACGAGGAGTCCTCCTCTTCCT  632
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCAGGCTGTGGCTAGCTGAAGCAGGTACGAGGAGTCCTCCTCTTCCT  640

seq1  CACTGGAGTCTGAGGTCATAGGTACTGCTTAGGCTGGGGCTTGGCGGAAC  682
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGAGTCTGAGGTCATAGGTACTGCTTAGGCTGGGGCTTGGCGGAAC  690

seq1  GTGCTCCAGGCGTGGAAGCAGCGGGTGAAGGCGCGCTGCTCATTACCTTT  732
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTCCAGGCGTGGAAGCAGCGGGTGAAGGCGCGCTGCTCATTACCTTT  740

seq1  GCGGACCAGGCGCAGGCGACGTGGCCGCTCATGTTCTTTAGAGCGTGTGT  782
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGACCAGGCGCAGGCGACGTGGCCGCTCATGTTCTTTAGAGCGTGTGT  790

seq1  GCTGGATGTATACCTGGTAAGAAAAACAATGGGCCTGGGTAGTCCTCTAA  832
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGATGTATACCTGGTAAGAAAAACAATGGGCCTGGGTAGTCCTCTAA  840

seq1  GGCCTGCTGGACTGACCACTGTGCCCCTTCCTCAACGTCTATCCAGGATG  882
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGCTGGACTGACCACTGTGCCCCTTCCTCAACGTCTATCCAGGATG  890

seq1  AGGGAGGGACAAGTGGCTCCTGAAACCGTCAGGCTGGCTTCAGTAATCTC  932
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGGGACAAGTGGCTCCTGAAACCGTCAGGCTGGCTTCAGTAATCTC  940

seq1  TTACCTGGCAAGCCTTCAGACTCAGTTTGATCTCCACTTGGCTTGTCTGG  982
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCTGGCAAGCCTTCAGACTCAGTTTGATCTCCACTTGGCTTGTCTGG  990

seq1  GTCCCAACCCACATGTAGACCTGAGGATACAGAGGATGAAATGGTCACAT  1032
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCAACCCACATGTAGACCTGAGGATACAGAGGATGAAATGGTCACAT  1040

seq1  GGGTTTCTTGGCCCTTTTGATGTTTATAGTGCTTTTAAAAAAAAACTGAG  1082
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTTCTTGGCCCTTTTGATGTTTATAGTGCTTTTAAAAAAAAACTGAG  1090

seq1  CCCAGGCTGGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGG  1132
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGCTGGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGG  1140

seq1  CAGAGACAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGA  1182
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGACAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGA  1190

seq1  ATTC  1186
      ||||
seq2  ATTC  1194

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information