MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257C04
Chromosome	11 (Build37)
Map Location	83,615,565 - 83,616,524
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Lig3, Rffl, Rad51l3, Fndc8, Nle1, Unc45b, Slfn5, Set8-ps, Slfn9, Slfn8, LOC668706, Slfn10, Slfn2, Slfn1, Slfn4, Slfn3, LOC100043636, LOC435271, Slfn14, Pex12, Ap2b1, Rasl10b, OTTMUSG00000000934, 1700020L24Rik, Mmp28, Taf15, OTTMUSG00000000990, Ccl5, Ccl9, Ccl6, LOC194905, Ccl3, Ccl4, OTTMUSG00000000971, Expi, 1100001G20Rik, 2700008B19Rik, LOC676191
Downstream gene	Tcf2, Ddx52, Ap1gbp1, Dusp14, Tada2l, OTTMUSG00000000997, Acaca, LOC100043671, Aatf, Lhx1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lig3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16882 MGI:109152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rffl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67338 MGI:1914588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rad51l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19364 MGI:1261809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fndc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78919 MGI:1926169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nle1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217011 MGI:2429770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc45b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217012 MGI:2443377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327978 MGI:1329004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Set8-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435270
definition	note : SET domain-containing protein 8 pseudogene pseudo : _no_value

name	Slfn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237886 MGI:2445121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276950 MGI:2672859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 668 ESTs, 9 Proteins

name	Slfn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237887 MGI:3512288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20556 MGI:1313258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20555 MGI:1313259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20558 MGI:1329010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20557 MGI:1329005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs

name	LOC435271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins

name	Slfn14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237890 MGI:2684866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins

name	Pex12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103737 MGI:2144177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71770 MGI:1919020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rasl10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276952 MGI:2685575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000934 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237891 MGI:3652048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66330 MGI:1913580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118453 MGI:2153062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Taf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70439 MGI:1917689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000990 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629303 MGI:3650286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20304 MGI:98262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20308 MGI:104533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20305 MGI:98263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194905 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194905
definition	note : ribosomal protein L9 pseudogene pseudo : _no_value

name	Ccl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20302 MGI:98260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20303 MGI:98261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000971 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100034251 MGI:3649773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Expi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14038 MGI:107506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001G20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66107 MGI:1913357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700008B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217026 MGI:1919790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Tcf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21410 MGI:98505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78394 MGI:1925644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1gbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217030 MGI:1354742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56405 MGI:1927168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tada2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217031 MGI:2144471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000997 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628813 MGI:3650287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acaca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107476 MGI:108451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs

name	Aatf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56321 MGI:1929608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lhx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16869 MGI:99783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lig3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061469 GeneID:16882 MGI:109152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligase III, DNA, ATP-dependent transcript_id : NM_010716.2

name	Rffl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922699 GeneID:67338 MGI:1914588
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger and FYVE like domain containing protein transcript_id : NM_001007465.2

name	Rffl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16975487 GeneID:67338 MGI:1914588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger and FYVE like domain containing protein transcript_id : NM_026097.1

name	Rad51l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139188 GeneID:19364 MGI:1261809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD51-like 3 (S. cerevisiae) transcript_id : NM_011235.3

name	Fndc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931163 GeneID:78919 MGI:1926169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 8 transcript_id : NM_030224.1

name	Nle1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703859 GeneID:217011 MGI:2429770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : notchless homolog 1 (Drosophila) transcript_id : NM_145431.1

name	Unc45b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607168 GeneID:217012 MGI:2443377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-45 homolog B (C. elegans) transcript_id : NM_178680.3

name	Slfn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801697 GeneID:327978 MGI:1329004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 5 transcript_id : NM_183201.3

name	Slfn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089295 GeneID:237886 MGI:2445121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 9 transcript_id : NM_172796.2

name	Slfn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380410 GeneID:276950 MGI:2672859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 8 transcript_id : NM_181545.3

name	LOC668706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262009 GeneID:668706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 668 ESTs, 9 Proteins product : similar to Ribosomal protein L12 transcript_id : XM_001003212.2

name	Slfn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089303 GeneID:237887 MGI:3512288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 10 transcript_id : NM_181542.4

name	Slfn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755569 GeneID:20556 MGI:1313258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 2 transcript_id : NM_011408.1

name	Slfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755567 GeneID:20555 MGI:1313259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 1 transcript_id : NM_011407.1

name	Slfn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490390 GeneID:20558 MGI:1329010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 4 transcript_id : NM_011410.2

name	Slfn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755571 GeneID:20557 MGI:1329005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 3 transcript_id : NM_011409.1

name	LOC100043636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262010 GeneID:100043636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs product : hypothetical protein LOC100043636 transcript_id : XM_001480989.1

name	LOC435271 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261966 GeneID:435271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins product : similar to schlafen 4 transcript_id : XM_487182.5

name	Slfn14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261968 GeneID:237890 MGI:2684866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins product : schlafen family member 14 transcript_id : XM_894124.3

name	Pex12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374304 GeneID:103737 MGI:2144177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 12 transcript_id : NM_134025.3

name	Ap2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403596 GeneID:71770 MGI:1919020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 2, beta 1 subunit transcript_id : NM_001035854.2

name	Ap2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403599 GeneID:71770 MGI:1919020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 2, beta 1 subunit transcript_id : NM_027915.3

name	Rasl10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83523749 GeneID:276952 MGI:2685575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 10, member B transcript_id : NM_001013386.1

name	OTTMUSG00000000934 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000635 GeneID:237891 MGI:3652048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000934 transcript_id : NM_001013759.1

name	1700020L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382444 GeneID:66330 MGI:1913580
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700020L24 gene transcript_id : NM_025492.2

name	Mmp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129946 GeneID:118453 MGI:2153062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 28 (epilysin) transcript_id : NM_172797.2

name	Mmp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131115 GeneID:118453 MGI:2153062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 28 (epilysin) transcript_id : NM_080453.2

name	Taf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803447 GeneID:70439 MGI:1917689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_027427.2

name	OTTMUSG00000000990 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865928 GeneID:629303 MGI:3650286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000990 transcript_id : NM_001045543.1

name	Ccl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803000 GeneID:20304 MGI:98262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 5 transcript_id : NM_013653.2

name	Ccl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85540457 GeneID:20308 MGI:104533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 9 transcript_id : NM_011338.2

name	Ccl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506295 GeneID:20305 MGI:98263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 6 transcript_id : NM_009139.3

name	Ccl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432552 GeneID:20302 MGI:98260
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 3 transcript_id : NM_011337.2

name	Ccl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366031 GeneID:20303 MGI:98261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 4 transcript_id : NM_013652.2

name	OTTMUSG00000000971 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432557 GeneID:100034251 MGI:3649773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000971 transcript_id : NM_001081957.1

name	Expi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366027 GeneID:14038 MGI:107506
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extracellular proteinase inhibitor transcript_id : NM_007969.4

name	1100001G20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126365757 GeneID:66107 MGI:1913357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001G20 gene transcript_id : NM_183249.2

name	2700008B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432548 GeneID:217026 MGI:1919790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700008B19 gene transcript_id : NM_145432.3

name	Tcf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185899 GeneID:21410 MGI:98505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 2 transcript_id : NM_009330.2

name	Ddx52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859745 GeneID:78394 MGI:1925644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 transcript_id : NM_030096.1

name	Ap1gbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996506 GeneID:217030 MGI:1354742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP1 gamma subunit binding protein 1 transcript_id : NM_194341.1

name	Dusp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360089 GeneID:56405 MGI:1927168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 14 transcript_id : NM_019819.3

name	Tada2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802722 GeneID:217031 MGI:2144471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional adaptor 2 (ADA2 homolog, yeast)-like transcript_id : NM_172562.2

name	OTTMUSG00000000997 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776580 GeneID:628813 MGI:3650287
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000997 transcript_id : NM_001037932.1

name	Acaca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656172 GeneID:107476 MGI:108451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A carboxylase alpha transcript_id : NM_133360.2

name	LOC100043671 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262012 GeneID:100043671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs product : hypothetical protein LOC100043671 transcript_id : XM_001481024.1

name	Aatf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790012 GeneID:56321 MGI:1929608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis antagonizing transcription factor transcript_id : NM_019816.1

name	Lhx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130719 GeneID:16869 MGI:99783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 1 transcript_id : NM_008498.2

name	Rffl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16975488 CCDS:CCDS25149.1 GeneID:67338 MGI:1914588
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; fring; rififylin product : fring isoform 2 protein_id : NP_080373.1

name	Rffl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925636 CCDS:CCDS25148.1 GeneID:67338 MGI:1914588
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; fring; rififylin product : fring isoform 1 protein_id : NP_001007466.1

name	Rad51l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755278 GeneID:19364 MGI:1261809
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : TRAD/RAD51L3 product : RAD51-like 3 protein_id : NP_035365.1

name	Fndc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931164 CCDS:CCDS25151.1 GeneID:78919 MGI:1926169
definition	codon_start : 1 product : fibronectin type III domain containing 8 protein_id : NP_084500.1

name	Nle1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703860 CCDS:CCDS25152.1 GeneID:217011 MGI:2429770
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0001826 - inner cell mass cell differentiation [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation note : novel WD40 repeat containing protein product : Notchless gene homolog protein_id : NP_663406.1

name	Unc45b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607169 GeneID:217012 MGI:2443377
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IEA] codon_start : 1 exception : mismatches in translation note : striated muscle UNC45 product : cardiomyopathy associated 4 protein_id : NP_848795.2

name	Slfn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254398 CCDS:CCDS25153.1 GeneID:327978 MGI:1329004
definition	codon_start : 1 exception : mismatches in translation note : expressesd sequence AI956840 product : schlafen 5 protein_id : NP_899024.2

name	Slfn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089296 CCDS:CCDS25154.1 GeneID:237886 MGI:2445121
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : schlafen 9 protein_id : NP_766384.2

name	Slfn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559803 CCDS:CCDS25155.1 GeneID:276950 MGI:2672859
definition	codon_start : 1 exception : mismatches in translation product : schlafen 8 protein_id : NP_853523.1

name	LOC668706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390243 GeneID:668706
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003212.1

name	Slfn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089304 GeneID:237887 MGI:3512288
definition	codon_start : 1 product : schlafen 10 protein_id : NP_853520.3

name	Slfn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755570 CCDS:CCDS25156.1 GeneID:20556 MGI:1313258
definition	GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : schlafen 2 protein_id : NP_035538.1

name	Slfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755568 CCDS:CCDS25157.1 GeneID:20555 MGI:1313259
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : schlafen 1 protein_id : NP_035537.1

name	Slfn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490391 CCDS:CCDS25158.1 GeneID:20558 MGI:1329010
definition	codon_start : 1 product : schlafen 4 protein_id : NP_035540.2

name	Slfn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755572 CCDS:CCDS25159.1 GeneID:20557 MGI:1329005
definition	GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : schlafen 3 protein_id : NP_035539.1

name	LOC100043636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262011 GeneID:100043636
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481039.1

name	LOC435271 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261967 GeneID:435271
definition	codon_start : 1 product : hypothetical protein protein_id : XP_487182.5

name	Slfn14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261969 GeneID:237890 MGI:2684866
definition	codon_start : 1 product : similar to LRRGT00163 protein_id : XP_899217.2

name	Pex12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527244 CCDS:CCDS25160.1 GeneID:103737 MGI:2144177
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : peroxisomal biogenesis factor 12 protein_id : NP_598786.1

name	Ap2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78711838 CCDS:CCDS25161.1 GeneID:71770 MGI:1919020
definition	GO_component : GO:0030131 - clathrin adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030276 - clathrin binding [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006461 - protein complex assembly [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : adaptor-related protein complex 2, beta 1 subunit isoform a protein_id : NP_001030931.1

name	Ap2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313640 CCDS:CCDS25162.1 GeneID:71770 MGI:1919020
definition	GO_component : GO:0030131 - clathrin adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030276 - clathrin binding [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006461 - protein complex assembly [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : adaptor-related protein complex 2, beta 1 subunit isoform b protein_id : NP_082191.1

name	Rasl10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83523750 CCDS:CCDS25163.1 GeneID:276952 MGI:2685575
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-like, family 10, member B protein_id : NP_001013404.1

name	OTTMUSG00000000934 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000636 CCDS:CCDS25164.1 GeneID:237891 MGI:3652048
definition	codon_start : 1 product : hypothetical protein LOC237891 protein_id : NP_001013781.1

name	1700020L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313524 CCDS:CCDS25165.1 GeneID:66330 MGI:1913580
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66330 protein_id : NP_079768.1

name	Mmp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348964 CCDS:CCDS25167.1 GeneID:118453 MGI:2153062
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; epilysin; matrix metalloproteinase 28 (epilysin) product : matrix metalloproteinase 28 (epilysin) isoform 2 protein_id : NP_766385.1

name	Mmp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348960 CCDS:CCDS25166.1 GeneID:118453 MGI:2153062
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; epilysin; matrix metalloproteinase 28 (epilysin) product : matrix metalloproteinase 28 (epilysin) isoform 1 protein_id : NP_536701.1

name	Taf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794412 CCDS:CCDS25168.1 GeneID:70439 MGI:1917689
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA binding protein 56); TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68 kDa product : TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_081703.1

name	OTTMUSG00000000990 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865929 GeneID:629303 MGI:3650286
definition	codon_start : 1 product : hypothetical protein LOC629303 protein_id : NP_001039008.1

name	Ccl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305461 GeneID:20304 MGI:98262
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : small inducible cytokine A5 product : chemokine (C-C motif) ligand 5 protein_id : NP_038681.1

name	Ccl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755434 CCDS:CCDS25170.1 GeneID:20308 MGI:104533
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A9; MIP-1 gamma; small inducible cytokine A10 product : chemokine (C-C motif) ligand 9 protein_id : NP_035468.1

name	Ccl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677883 CCDS:CCDS25171.1 GeneID:20305 MGI:98263
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A6; CC chemokine; CC chemokine C10 product : chemokine (C-C motif) ligand 6 protein_id : NP_033165.1

name	Ccl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755432 GeneID:20302 MGI:98260
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A3; MIP1 (a); MIP-1 alpha; macrophage inflammatory protein-1alpha product : chemokine (C-C motif) ligand 3 protein_id : NP_035467.1

name	Ccl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305459 GeneID:20303 MGI:98261
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A4; MIP-1 beta product : chemokine (C-C motif) ligand 4 protein_id : NP_038680.1

name	OTTMUSG00000000971 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432558 GeneID:100034251 MGI:3649773
definition	codon_start : 1 note : novel protein similar to extracellular proteinase inhibitor Expi product : extracellular proteinase inhibitor family member protein_id : NP_001075426.1

name	Expi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921600 CCDS:CCDS25175.1 GeneID:14038 MGI:107506
definition	codon_start : 1 product : extracellular proteinase inhibitor protein_id : NP_031995.3

name	1100001G20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304022 GeneID:66107 MGI:1913357
definition	codon_start : 1 product : WDNM1-like protein protein_id : NP_899072.1

name	2700008B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249080 GeneID:217026 MGI:1919790
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217026 protein_id : NP_663407.2

name	Tcf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185900 CCDS:CCDS25179.1 GeneID:21410 MGI:98505
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0030902 - hindbrain development [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : putative; transcription factor 2 (MGD\|MGI:98505); hepatocyte nuclear factor-1 beta product : transcription factor 2 protein_id : NP_033356.2

name	Ddx52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859746 CCDS:CCDS25180.1 GeneID:78394 MGI:1925644
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 52 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 protein_id : NP_084372.1

name	Ap1gbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996507 CCDS:CCDS25181.1 GeneID:217030 MGI:1354742
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : AP1 gamma subunit binding protein 1 protein_id : NP_919322.1

name	Dusp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560388 CCDS:CCDS25182.1 GeneID:56405 MGI:1927168
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : Mkp-1 like protein tyrosine phosphatase; MAP kinase phsophatase 6 product : dual specificity phosphatase 14 protein_id : NP_062793.2

name	Tada2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369796 CCDS:CCDS25183.1 GeneID:217031 MGI:2144471
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcriptional adaptor 2 (ADA2 homolog, yeast)-like protein_id : NP_766150.1

name	OTTMUSG00000000997 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776581 CCDS:CCDS25184.1 GeneID:628813 MGI:3650287
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC628813 protein_id : NP_001033021.1

name	Acaca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656173 CCDS:CCDS25185.1 GeneID:107476 MGI:108451
definition	EC_number : 6.4.1.2 GO_function : GO:0003989 - acetyl-CoA carboxylase activity [Evidence IMP]; GO:0005524 - ATP binding [Evidence IEA]; GO:0009374 - biotin binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acetyl-CoA carboxylase 265 product : acetyl-Coenzyme A carboxylase alpha protein_id : NP_579938.2

name	LOC100043671 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262013 GeneID:100043671
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481074.1

name	Aatf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790013 CCDS:CCDS25186.1 GeneID:56321 MGI:1929608
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0040016 - embryonic cleavage [Evidence IMP]; GO:0042985 - negative regulation of amyloid precursor protein biosynthesis [Evidence IDA]; GO:0007346 - regulation of progression through mitotic cell cycle [Evidence IMP]; GO:0042254 - ribosome biogenesis and assembly [Evidence IMP] codon_start : 1 note : traube product : apoptosis antagonizing transcription factor protein_id : NP_062790.1

name	Lhx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678688 CCDS:CCDS25187.1 GeneID:16869 MGI:99783
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001706 - endoderm formation [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : LIM homeo box protein 1 product : LIM homeobox protein 1 protein_id : NP_032524.1

name	LOC676191 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676191
definition	number : 1 pseudo : _no_value

clone name	MSMg01-311D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-411K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232M24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-351A17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-266M22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-264G03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-480I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373O18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526I18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-450D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001I16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257C04.b	B6Ng01-257C04.g
ACC	GA062911	GA062912
length	961	517
definition	B6Ng01-257C04.b	B6Ng01-257C04.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaagccctgcctggtctacctagaaagttgtaggccatatgaaat aaataaagaaaaatataaatccaaagaagaaagtaaggaaaagtgtttag acttgttttcaattaaggagtgtttttgttttgtttgtttgttgttgttg ttgttgttgttttcctgtcatctttctgttgctgtttatagttgggtttt gctctcttggtcagctccttgctcctataacctctaggtggcgcacgttc caaaagttagccttttgtaggactccttttgtctctactagaagtcaatc caagggaatggggtgggggctgtgcaccagatttagcaaattaaagaata cggctcccagttaaactagaatctcaaataggcaaaatgttacttggaac ttacgtatactaaaaaatgtactagatgttcacctgaaattcgaagtcag ctgacaactatggctacgtgtacatcgctatcggtttctcctactgctag gatttgaggatggtgtgcttgaaaaaaagcattcagagtgacatgggcaa gccagcaactatgacaatatagtcacaactattgtgtgacatctcaagtg tcccaaagccttaacacaccctaaccctctactcccgcctcatctcctgt cgctgtgctcccgccctgactacatctcttgtataatcaaggcaaaggtc tgggatgctccactgacctcctttgctttctttggcaacatcttggtgta gtttacctcacacctcttgcactagtgtgaggcccacaaccttgcagttc agtctgacagagagcagcatagataggttcttgtgtaagaaagagtctat gttgatcaaaatggaaatggcacccgaagtaaatccttgtagcccatacc tgcccttagccagcctcttgaccagcctcacgtttaacacttcatggggg gagggggggag	actctgtagaccaggctggcctcaaactcagagatcctcctgcctctgcc tcccacgtgctgggattaaggatgtgtgccaccactctgggttctactaa tttaaaaaaattatttatttttgctttatgtatgtagcttgcctgcagat gtctgtgtttgcggcatgctaacaggaaccagaagagagtgttggattcc ctggcactggatctaaaggtggttgtgggctgccaggtgggtactccgca ttgagcttgggtcctctggaagaatagtcagtgctcccccacattaattt atttattcactttatatcccaatatcagaccccctcttctcccagttctc cctcacacagttcctccccaccctctcctgacttctctgagaagggggag ccacccagtatcaccttactctggcccgtcaagtcactacaggactaggc acatcctctcccactgaggccagacaaagaagcccagttggggaaacagg atccacaggcaggcaac
quality values	Open. Hide. 62 47 25 39 62 37 24 41 47 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 59 62 62 49 43 43 35 34 30 25 33 28 49 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 54 43 49 38 62 59 59 62 62 54 54 54 54 48 62 62 62 62 62 54 38 62 59 62 62 62 62 62 49 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 54 54 58 58 54 58 58 54 58 58 58 58 52 58 58 58 58 54 58 58 58 58 54 58 58 48 54 58 54 58 58 52 58 58 58 58 58 58 58 54 54 58 58 54 58 58 58 58 58 52 52 54 54 54 58 58 58 58 58 58 50 58 58 58 53 51 50 49 58 54 58 58 51 54 58 54 52 52 58 51 58 50 54 58 58 52 49 51 54 46 53 46 51 54 51 52 58 58 50 53 58 58 49 44 37 41 49 50 51 46 58 51 58 53 54 51 54 33 39 52 58 54 52 50 58 44 49 58 39 50 58 50 33 58 37 43 50 49 58 40 47 32 42 42 53 52 50 49 41 47 46 31 39 54 47 42 51 49 54 54 52 45 54 54 35 52 53 54 54 50 42 38 50 40 40 32 49 53 54 52 51 49 37 54 33 40 28 32 54 33 38 37 51 47 40 37 42 40 53 54 52 53 53 38 51 37 31 30 33 31 26 31 53 36 34 52 16 30 13 49 51 37 32 22 34 45 41 53 21 26 37 34 22 35 33 31 36 23 31 31 36 31 29 25 25 33 44 11 38 31 31 45 31 31 31 42 34 19 30 32 40 31 13 6 11 14 46 31 42 31 26 31 13 32 16 46 41 40 14 38 18 43 31 31 20 26 31 24 40 32 30 32 33 36 46 46 30 28 31 11 37 46 31 34 36 39 26 29 31 46 30 21 44 16 13 25 27 48 41 37 41 25 22 39 36 11 27 17 31 46 32 26 31 31 22 21 20 31 33 31 25 22 34 32 23 33 22 12 33 23 17 32 31 19 25 23 25 22 22 19 31 31 37 38 32 33 25 19 31 39 32 32 23 20 16 24 20 33 19 19 19 30 43 32 43 43 24 4 5 43 33 33 31 31 19 10 4	Open. Hide. 46 59 62 62 51 56 39 36 27 35 39 29 26 45 48 34 48 62 62 62 50 56 51 49 49 56 50 62 59 59 51 59 59 59 62 59 62 59 59 62 62 62 59 59 59 59 51 56 51 50 46 49 43 43 27 34 24 28 35 34 38 46 32 28 44 49 49 49 50 34 56 44 49 50 46 50 36 51 56 51 49 51 50 43 46 46 46 46 54 54 62 59 59 59 59 40 43 40 36 38 50 59 46 46 54 56 59 59 56 56 59 59 59 59 49 46 50 48 46 50 59 59 62 59 59 62 62 62 62 56 59 59 62 50 50 43 34 48 48 54 62 56 59 48 62 59 50 43 59 59 59 59 56 59 59 59 59 54 50 51 56 59 40 50 39 41 50 48 45 43 59 59 62 59 56 59 46 50 59 51 43 35 50 34 23 46 25 51 43 28 54 51 51 56 56 54 49 51 50 48 48 46 56 40 36 34 43 40 40 36 36 46 46 50 38 45 46 43 56 46 59 62 59 59 59 49 56 56 48 50 51 62 56 51 48 36 48 34 49 38 36 34 26 28 13 23 23 15 18 17 23 20 23 30 49 51 41 30 45 25 34 34 49 50 27 34 23 27 34 38 27 11 40 34 27 23 13 16 23 18 13 19 34 31 59 51 50 43 46 46 46 46 34 56 49 49 49 43 51 24 16 12 19 27 16 18 10 14 13 19 46 50 36 46 39 43 51 51 56 59 50 27 39 41 43 39 23 27 56 50 50 51 34 30 30 18 10 9 13 10 11 24 43 17 13 24 18 18 23 24 43 34 33 34 31 31 17 34 13 14 24 50 51 56 59 50 43 43 49 43 43 51 30 31 27 24 13 19 10 23 24 19 34 50 46 50 34 43 34 46 19 40 38 30 50 38 34 43 50 46 50 51 24 34 34 30 16 12 39 43 56 41 24 40 31 27 23 10 16 28 23 34 34 36 23 23 23 16 10 17 18 18 35 33 27 24 27 22 34 34 34 34 51 49 22 22 23 12 31 18 23 18 17 18 17 13 18 30 17 17 19 23 18 27 43 39 36 15 43 18 30 24 24 43 26 21 18 17 19 34 34 14 18 13 13 8 10 27 56 51 59 23 27 39 34 34 24 24 16 34 34 28 24 17 13 18 13 19 43 28 34 30 46 30 24 31 28

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_83615565_83616524
seq2: B6Ng01-257C04.b_44_1004

seq1  GAATTCAAGCCCTGCCTGGTCTACCTAGAAAGTTGTAGGCCATATGAAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGCCCTGCCTGGTCTACCTAGAAAGTTGTAGGCCATATGAAAT  50

seq1  AAATAAAGAAAAATATAAATCCAAAGAAGAAAGTAAGGAAAAGTGTTTAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAAGAAAAATATAAATCCAAAGAAGAAAGTAAGGAAAAGTGTTTAG  100

seq1  ACTTGTTTTCAATTAAGGAGTGTTTTTGTTTTGTTTGTTTGTTGTTGTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGTTTTCAATTAAGGAGTGTTTTTGTTTTGTTTGTTTGTTGTTGTTG  150

seq1  TTGTTGTTGTTTTCCTGTCATCTTTCTGTTGCTGTTTATAGTTGGGTTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGTTGTTTTCCTGTCATCTTTCTGTTGCTGTTTATAGTTGGGTTTT  200

seq1  GCTCTCTTGGTCAGCTCCTTGCTCCTATAACCTCTAGGTGGCGCACGTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTCTTGGTCAGCTCCTTGCTCCTATAACCTCTAGGTGGCGCACGTTC  250

seq1  CAAAAGTTAGCCTTTTGTAGGACTCCTTTTGTCTCTACTAGAAGTCAATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGTTAGCCTTTTGTAGGACTCCTTTTGTCTCTACTAGAAGTCAATC  300

seq1  CAAGGGAATGGGGTGGGGGCTGTGCACCAGATTTAGCAAATTAAAGAATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGGAATGGGGTGGGGGCTGTGCACCAGATTTAGCAAATTAAAGAATA  350

seq1  CGGCTCCCAGTTAAACTAGAATCTCAAATAGGCAAAATGTTACTTGGAAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCTCCCAGTTAAACTAGAATCTCAAATAGGCAAAATGTTACTTGGAAC  400

seq1  TTACGTATACTAAAAAATGTACTAGATGTTCACCTGAAATTCGAAGTCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACGTATACTAAAAAATGTACTAGATGTTCACCTGAAATTCGAAGTCAG  450

seq1  CTGACAACTATGGCTACGTGTACATCGCTATCGGTTTCTCCTACTGCTAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAACTATGGCTACGTGTACATCGCTATCGGTTTCTCCTACTGCTAG  500

seq1  GATTTGAGGATGGTGTGCTTGAAAAAAAGCATTCAGAGTGACATGGGCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTGAGGATGGTGTGCTTGAAAAAAAGCATTCAGAGTGACATGGGCAA  550

seq1  GCCAGCAACTATGACAATATAGTCACAACTATTGTGTGACATCTCAAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCAACTATGACAATATAGTCACAACTATTGTGTGACATCTCAAGTG  600

seq1  TCCCAAAGCCTTAACACACCCTAACCCTCTACTCCCGCCTCATCTCCTGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAAAGCCTTAACACACCCTAACCCTCTACTCCCGCCTCATCTCCTGT  650

seq1  CGCTGTGCTCCCGCCCTGACTACATCTCTTGTATAATCAAGGCAAAGGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTGTGCTCCCGCCCTGACTACATCTCTTGTATAATCAAGGCAAAGGTC  700

seq1  TGGGATGCTCCACTGACCTCCTTTGCTTTCTTTGGCAACATCTTGGTGTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGATGCTCCACTGACCTCCTTTGCTTTCTTTGGCAACATCTTGGTGTA  750

seq1  GTTTACCTCACACCTCTTGCACTAGTGTGAGGCCCACAACCTTGCAGTTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTACCTCACACCTCTTGCACTAGTGTGAGGCCCACAACCTTGCAGTTC  800

seq1  AGTCTGACAGAGAGCAGCATAGATAGG-TCTTGTGTAAGAAAGAGTCTAT  849
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  AGTCTGACAGAGAGCAGCATAGATAGGTTCTTGTGTAAGAAAGAGTCTAT  850

seq1  GTTGATCAAAATGGAAATGGCACCCGAAGTAAATCCTTGTAGCCCATACC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGATCAAAATGGAAATGGCACCCGAAGTAAATCCTTGTAGCCCATACC  900

seq1  TGCCCTTAGCCAGCCTCTTGACCAGCCTCACGTTTAACACTTCATGGGGG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCTTAGCCAGCCTCTTGACCAGCCTCACGTTTAACACTTCATGGGGG  950

seq1  GAGGGGGGGAG  960
      |||||||||||
seq2  GAGGGGGGGAG  961

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information