MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-288E19
Chromosome	11 (Build37)
Map Location	119,251,339 - 119,399,032
singlet/doublet	doublet
Overlap gene	LOC672511, Rnf213, A730011L01Rik
Upstream gene	Lgals3bp, Cant1, C1qtnf1, D230014K01Rik, D11Bwg0517e, Enpp7, Cbx2, Cbx8, Cbx4, Tbc1d16, Ccdc40, Gaa, Eif4a3, Card14, Sgsh, Slc26a11
Downstream gene	Nptx1, 4932417H02Rik, Chmp6, Baiap2, Aatk, Azi1, 2410002I01Rik, 1810043H04Rik, 1810073N04Rik, 2810410L24Rik, LOC100042332, LOC100043384, LOC100043389, Bahcc1, Actg1, Fscn2, 2310003H01Rik, Nploc4, Tspan10, Pde6g, 1810049H13Rik, 3110023B02Rik, 2600005N12Rik, Hgs, Mrpl12, Slc25a10, LOC667716, Gcgr
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lgals3bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19039 MGI:99554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cant1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	C1qtnf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56745 MGI:1919254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230014K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217364 MGI:2443788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Bwg0517e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Enpp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238011 MGI:3027917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12416 MGI:88289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30951 MGI:1353589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12418 MGI:1195985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207592 MGI:2652878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207607 MGI:2443893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gaa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14387 MGI:95609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192170 MGI:1923731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170720 MGI:2386258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgsh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27029 MGI:1350341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268512 MGI:2444589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Rnf213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629974 MGI:1289196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730011L01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338371 MGI:2444688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nptx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18164 MGI:107811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932417H02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74370 MGI:1921620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208092 MGI:3583942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 196 ESTs, 4 Proteins

name	Baiap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108100 MGI:2137336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Aatk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11302 MGI:1197518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Azi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12009 MGI:107440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410002I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78777 MGI:1926027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810043H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208501 MGI:1913676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs

name	1810073N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72055 MGI:1919305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810410L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76377 MGI:1923627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC100042332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC100043384 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs

name	LOC100043389 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs

name	Bahcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268515 MGI:2679272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11465 MGI:87906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fscn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238021 MGI:2443337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310003H01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71885 MGI:1919135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nploc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217365 MGI:2679787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208634 MGI:2384781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde6g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18588 MGI:97526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810049H13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66431 MGI:1913681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110023B02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67291 MGI:1914541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2600005N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70317 MGI:1917567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15239 MGI:104681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56282 MGI:1926273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27376 MGI:1353497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gcgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14527 MGI:99572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals3bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130236 GeneID:19039 MGI:99554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactoside-binding, soluble, 3 binding protein transcript_id : NM_011150.2

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043963 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_001025618.1

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043971 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_001025617.1

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043950 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_029502.2

name	C1qtnf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892163 GeneID:56745 MGI:1919254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1q and tumor necrosis factor related protein 1 transcript_id : NM_019959.2

name	D230014K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369815 GeneID:217364 MGI:2443788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230014K01 gene transcript_id : NM_172573.1

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677494 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001039168.1

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677498 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001024931.2

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677496 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001039167.1

name	Enpp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71892413 GeneID:238011 MGI:3027917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleotide pyrophosphatase/phosphodiesterase 7 transcript_id : NM_001030291.1

name	Cbx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542345 GeneID:12416 MGI:88289
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 2 (Drosophila Pc class) transcript_id : NM_007623.2

name	Cbx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304946 GeneID:30951 MGI:1353589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 8 (Drosophila Pc class) transcript_id : NM_013926.1

name	Cbx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680861 GeneID:12418 MGI:1195985
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 4 (Drosophila Pc class) transcript_id : NM_007625.1

name	Tbc1d16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347142 GeneID:207592 MGI:2652878
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 16 transcript_id : NM_172443.2

name	Ccdc40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803137 GeneID:207607 MGI:2443893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 40 transcript_id : NM_175430.3

name	Gaa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982354 GeneID:14387 MGI:95609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, alpha, acid transcript_id : NM_008064.2

name	Eif4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149755 GeneID:192170 MGI:1923731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A, isoform 3 transcript_id : NM_138669.1

name	Card14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131044 GeneID:170720 MGI:2386258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase recruitment domain family, member 14 transcript_id : NM_130886.3

name	Sgsh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270982 GeneID:27029 MGI:1350341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-sulfoglucosamine sulfohydrolase (sulfamidase) transcript_id : NM_018822.3

name	Slc26a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85540462 GeneID:268512 MGI:2444589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 11 transcript_id : NM_178743.3

name	LOC672511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262525 GeneID:672511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical LOC672511 transcript_id : XM_001477846.1

name	Rnf213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375267 GeneID:629974 MGI:1289196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 213 transcript_id : NM_001040005.2

name	A730011L01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254316 GeneID:338371 MGI:2444688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730011L01 gene transcript_id : NM_177394.2

name	Nptx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672925 GeneID:18164 MGI:107811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin 1 transcript_id : NM_008730.2

name	4932417H02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061324 GeneID:74370 MGI:1921620
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932417H02 gene transcript_id : NM_028898.1

name	Chmp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94391054 GeneID:208092 MGI:3583942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 196 ESTs, 4 Proteins product : chromatin modifying protein 6, transcript variant 1 transcript_id : XM_126613.6

name	Baiap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369752 GeneID:108100 MGI:2137336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1-associated protein 2 transcript_id : NM_001037755.2

name	Baiap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351289 GeneID:108100 MGI:2137336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1-associated protein 2 transcript_id : NM_130862.3

name	Baiap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802566 GeneID:108100 MGI:2137336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1-associated protein 2 transcript_id : NM_001037754.2

name	Aatk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130971 GeneID:11302 MGI:1197518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-associated tyrosine kinase transcript_id : NM_007377.3

name	Azi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753153 GeneID:12009 MGI:107440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-azacytidine induced gene 1 transcript_id : NM_009734.1

name	2410002I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130816 GeneID:78777 MGI:1926027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410002I01 gene transcript_id : NM_183137.2

name	1810043H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262528 GeneID:208501 MGI:1913676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs product : RIKEN cDNA 1810043H04 gene, transcript variant 2 transcript_id : XM_903145.3

name	1810073N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384420 GeneID:72055 MGI:1919305
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810073N04 gene transcript_id : NM_024249.4

name	LOC100042332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262529 GeneID:100042332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100042332 transcript_id : XM_001477964.1

name	LOC100043384 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262575 GeneID:100043384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs product : hypothetical protein LOC100043384 transcript_id : XM_001480749.1

name	LOC100043389 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262577 GeneID:100043389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs product : hypothetical protein LOC100043389 transcript_id : XM_001480755.1

name	Bahcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274629 GeneID:268515 MGI:2679272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BAH domain and coiled-coil containing 1 transcript_id : NM_198423.2

name	Actg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48762677 GeneID:11465 MGI:87906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, gamma, cytoplasmic 1 transcript_id : NM_009609.2

name	Fscn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366463 GeneID:238021 MGI:2443337
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) transcript_id : NM_172802.2

name	2310003H01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73476380 GeneID:71885 MGI:1919135
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310003H01 gene transcript_id : NM_027980.1

name	Nploc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054973 GeneID:217365 MGI:2679787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear protein localization 4 homolog (S. cerevisiae) transcript_id : NM_199469.1

name	Tspan10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703723 GeneID:208634 MGI:2384781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 10 transcript_id : NM_145363.1

name	Pde6g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982123 GeneID:18588 MGI:97526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 6G, cGMP-specific, rod, gamma transcript_id : NM_012065.2

name	1810049H13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352675 GeneID:66431 MGI:1913681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810049H13 gene transcript_id : NM_025560.2

name	3110023B02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350048 GeneID:67291 MGI:1914541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110023B02 gene transcript_id : NM_152807.2

name	2600005N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91199553 GeneID:70317 MGI:1917567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2600005N12 gene transcript_id : NM_197995.2

name	Hgs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982285 GeneID:15239 MGI:104681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HGF-regulated tyrosine kinase substrate transcript_id : NM_008244.2

name	Mrpl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164791 GeneID:56282 MGI:1926273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L12 transcript_id : NM_027204.2

name	Slc25a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305500 GeneID:27376 MGI:1353497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 transcript_id : NM_013770.1

name	LOC667716 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94391011 GeneID:667716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC667716 transcript_id : XM_992013.1

name	Gcgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679964 GeneID:14527 MGI:99572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucagon receptor transcript_id : NM_008101.1

name	Lgals3bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755144 CCDS:CCDS25701.1 GeneID:19039 MGI:99554
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence ISS] [Evidence TAS] codon_start : 1 note : peptidylprolyl isomerase C-associated protein; mama product : lectin, galactoside-binding, soluble, 3 binding protein protein_id : NP_035280.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043972 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_001020788.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043964 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_001020789.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043951 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_083778.2

name	C1qtnf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910610 CCDS:CCDS25703.1 GeneID:56745 MGI:1919254
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : putative secreted protein ZSIG37; mouse ortholog product : C1q and tumor necrosis factor related protein 1 protein_id : NP_064343.1

name	D230014K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369816 CCDS:CCDS25704.1 GeneID:217364 MGI:2443788
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217364 protein_id : NP_766161.1

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677499 CCDS:CCDS25705.1 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 3 protein_id : NP_001020102.2

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677495 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 2 protein_id : NP_001034257.1

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677497 CCDS:CCDS25706.1 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 1 protein_id : NP_001034256.1

name	Enpp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892414 CCDS:CCDS25707.1 GeneID:238011 MGI:3027917
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008252 - nucleotidase activity [Evidence ISS]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence ISS] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006685 - sphingomyelin catabolism [Evidence ISS] codon_start : 1 product : ectonucleotide pyrophosphatase/phosphodiesterase 7 protein_id : NP_001025462.1

name	Cbx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542346 CCDS:CCDS25708.1 GeneID:12416 MGI:88289
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0031519 - PcG protein complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : M33 polycomb-like protein; hromobox homolog 2 product : chromobox homolog 2 protein_id : NP_031649.2

name	Cbx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304947 CCDS:CCDS25709.1 GeneID:30951 MGI:1353589
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006342 - chromatin silencing [Evidence ISS]; GO:0016574 - histone ubiquitination [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : polycomb 3 product : chromobox homolog 8 protein_id : NP_038954.1

name	Cbx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680862 CCDS:CCDS25710.1 GeneID:12418 MGI:1195985
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : homeobox gene repression note : polycomb 2 homolog product : chromobox homolog 4 protein_id : NP_031651.1

name	Tbc1d16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369589 CCDS:CCDS25711.1 GeneID:207592 MGI:2652878
definition	codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 16 protein_id : NP_766031.1

name	Ccdc40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425148 CCDS:CCDS25712.1 GeneID:207607 MGI:2443893
definition	codon_start : 1 product : coiled-coil domain containing 40 protein_id : NP_780639.1

name	Gaa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982355 CCDS:CCDS25713.1 GeneID:14387 MGI:95609
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IDA] [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005980 - glycogen catabolism [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acid alpha-glucosidase protein_id : NP_032090.2

name	Eif4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149756 CCDS:CCDS25714.1 GeneID:192170 MGI:1923731
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 protein_id : NP_619610.1

name	Card14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700028 CCDS:CCDS25715.1 GeneID:170720 MGI:2386258
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : caspase recruitment domain family, member 14 protein_id : NP_570956.1

name	Sgsh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543697 GeneID:27029 MGI:1350341
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016250 - N-sulfoglucosamine sulfohydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0030201 - heparan sulfate proteoglycan metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : sulphamidase product : N-sulfoglucosamine sulfohydrolase (sulfamidase) protein_id : NP_061292.2

name	Slc26a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85540463 CCDS:CCDS25717.1 GeneID:268512 MGI:2444589
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel sulfate transporter protein (Slc26a11) product : anion exchanger Slc26a11 protein_id : NP_848858.2

name	LOC672511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262526 GeneID:672511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477896.1

name	Rnf213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90855774 GeneID:629974 MGI:1289196
definition	codon_start : 1 product : ring finger protein 213 protein_id : NP_001035094.1

name	A730011L01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893575 CCDS:CCDS25718.1 GeneID:338371 MGI:2444688
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 product : hypothetical protein LOC338371 protein_id : NP_796368.1

name	Nptx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679120 CCDS:CCDS25719.1 GeneID:18164 MGI:107811
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : neuronal pentraxin 1 protein_id : NP_032756.1

name	4932417H02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061325 CCDS:CCDS25720.1 GeneID:74370 MGI:1921620
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : raptor protein_id : NP_083174.1

name	Chmp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935435 GeneID:208092 MGI:3583942
definition	codon_start : 1 product : similar to Charged multivesicular body protein 6 (Chromatin-modifying protein 6) isoform 1 protein_id : XP_126613.3

name	Baiap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649707 CCDS:CCDS25722.1 GeneID:108100 MGI:2137336
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007266 - Rho protein signal transduction [Evidence TAS] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; insulin receptor substrate p53 product : brain-specific angiogenesis inhibitor 1-associated protein 2 isoform a protein_id : NP_001032844.1

name	Baiap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83642836 CCDS:CCDS25724.1 GeneID:108100 MGI:2137336
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007266 - Rho protein signal transduction [Evidence TAS] codon_start : 1 note : isoform b is encoded by transcript variant 2; insulin receptor substrate p53 product : brain-specific angiogenesis inhibitor 1-associated protein 2 isoform b protein_id : NP_570932.2

name	Baiap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649713 CCDS:CCDS25723.1 GeneID:108100 MGI:2137336
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007266 - Rho protein signal transduction [Evidence TAS] codon_start : 1 note : isoform c is encoded by transcript variant 3; insulin receptor substrate p53 product : brain-specific angiogenesis inhibitor 1-associated protein 2 isoform c protein_id : NP_001032843.1

name	Aatk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345411 CCDS:CCDS25725.1 GeneID:11302 MGI:1197518
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] codon_start : 1 product : apoptosis-associated tyrosine kinase protein_id : NP_031403.2

name	Azi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753154 GeneID:12009 MGI:107440
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence TAS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pre-acrosome localization protein 1 protein_id : NP_033864.1

name	2410002I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130817 GeneID:78777 MGI:1926027
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC78777 protein_id : NP_898960.2

name	1810043H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935441 GeneID:208501 MGI:1913676
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_908238.1

name	1810073N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541852 CCDS:CCDS25728.1 GeneID:72055 MGI:1919305
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72055 protein_id : NP_077211.3

name	LOC100042332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262530 GeneID:100042332
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478014.1

name	LOC100043384 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262576 GeneID:100043384
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480799.1

name	LOC100043389 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262578 GeneID:100043389
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480805.1

name	Bahcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49274630 GeneID:268515 MGI:2679272
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : BAH domain and coiled-coil containing 1 protein_id : NP_940815.2

name	Actg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752954 CCDS:CCDS25730.1 GeneID:11465 MGI:87906
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005884 - actin filament [Evidence IEA]; GO:0043034 - costamere [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045214 - sarcomere organization [Evidence IDA] codon_start : 1 note : beta-actin FE-3 product : actin, gamma, cytoplasmic 1 protein_id : NP_033739.1

name	Fscn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370192 CCDS:CCDS25731.1 GeneID:238021 MGI:2443337
definition	GO_function : GO:0051015 - actin filament binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence IEA] codon_start : 1 exception : mismatches in translation product : fascin homolog 2, actin-bundling protein, retinal protein_id : NP_766390.1

name	2310003H01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73476381 GeneID:71885 MGI:1919135
definition	codon_start : 1 product : hypothetical protein LOC71885 protein_id : NP_082256.1

name	Nploc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054974 CCDS:CCDS25732.1 GeneID:217365 MGI:2679787
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0042175 - nuclear envelope-endoplasmic reticulum network [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0007030 - Golgi organization and biogenesis [Evidence ISS]; GO:0006944 - membrane fusion [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : novel protein containing zf-NPL4 and NPL4 domains product : nuclear protein localization 4 protein_id : NP_955763.1

name	Tspan10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703724 CCDS:CCDS25733.1 GeneID:208634 MGI:2384781
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : oculospanin product : tetraspanin 10 protein_id : NP_663338.1

name	Pde6g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549783 GeneID:18588 MGI:97526
definition	GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0030553 - cGMP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0045742 - positive regulation of epidermal growth factor receptor signaling pathway [Evidence IDA]; GO:0045745 - positive regulation of G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : cGMP phosphodiesterase gamma product : phosphodiesterase 6G, cGMP-specific, rod, gamma protein_id : NP_036197.1

name	1810049H13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384992 CCDS:CCDS25735.1 GeneID:66431 MGI:1913681
definition	codon_start : 1 product : hypothetical protein LOC66431 protein_id : NP_079836.1

name	3110023B02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779893 CCDS:CCDS25736.1 GeneID:67291 MGI:1914541
definition	codon_start : 1 product : hypothetical protein LOC67291 protein_id : NP_690020.1

name	2600005N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91199554 GeneID:70317 MGI:1917567
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70317 protein_id : NP_932112.2

name	Hgs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982286 GeneID:15239 MGI:104681
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HGF-regulated tyrosine kinase substrate protein_id : NP_032270.2

name	Mrpl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164792 CCDS:CCDS25737.1 GeneID:56282 MGI:1926273
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005761 - mitochondrial ribosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L12 protein_id : NP_081480.2

name	Slc25a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305501 CCDS:CCDS25738.1 GeneID:27376 MGI:1353497
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0015290 - electrochemical potential-driven transporter activity [Evidence IDA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : involved in translocation of malonate, malate and succinate in exchange for phosphate, sulfate, sulfite or thiosulfate across mitochondrial inner membrane note : dicarboxylate ion carrier; solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 10 product : solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 protein_id : NP_038798.1

name	LOC667716 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94391012 GeneID:667716
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997107.1

name	Gcgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679965 CCDS:CCDS25739.1 GeneID:14527 MGI:99572
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glucagon receptor protein_id : NP_032127.1

name	2810410L24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262574 GeneID:76377 MGI:1923627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2810410L24 gene transcript_id : XR_035443.1

clone name	MSMg01-070A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-505M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-288E19.b	B6Ng01-288E19.g
ACC	GA085997	GA085998
length	1,109	853
definition	B6Ng01-288E19.b	B6Ng01-288E19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(119,397,926 - 119,399,032)	(119,251,339 - 119,252,190)
sequence	gaattccatgtgcccttcctttgaagttcctgggccactttgttctcata tacacaaaataaaagatgtgggtaactgcgagtccttgatctagggaaaa ccggacattcctgaccaagcttggctctatgtaggtatagagctttgaac acaatggccaggatccaagtcctggcattatagatcctagaatgcttaag aacatgaggccaggggccagacaagcccaaagcttagctgccccctccct gtatgtgcacaggtacacattgtgtttgcagaagggactggctactctgg ctacttgctggcctttccagggtttcctgccagtgtctttggttccctgg ccaggacacagaagccatggtttatttcagaccactgagtagaagactta gagggggagtctggcctcatagcatagcaggcagataatcctccctggac cctcaagcagctcccggccacacactacacttccatcattaaagcctttt tctgtttttgttttctgagccagggtttctctgtgtagccctggctgttc tgggactcagcctgtagaccaggatggcctcaaactcagaattctgcctg tttcaaccttccaactaatgctggcgttgtaaactactcattcaaaacta caaacatgtgctagtggcacagccctttaaccacagaactttatttacag cctttaatcccaggcagaggcaggcagatctgagtttaaggccagcctgg tctacaaagtaggacagccaggcctaccagtaccagagagaccctgtctc aaaaaccaaaacaaaaaagcaaatacaggcatgatggcacaggccttggg aggcagaggcagccaaatatctgagttcaaggccagcttggtctacatga gagttttaggccaaccagagccacatagtgagatcttgtcttaaaaaaca ccaacccccccctccccacacacacacacacacacacaacctaagaagga atctacttagttgtcaacctgatcctggcacactggccagtgacacccag gtcagaagagttaaaaccagcctcaggggagtggtggagcccttagccac aggaggcct	gaattccagcaaggctgtgcgccaaggaggcggaggggcggcgccggccc cgtgacccctcatcgaagcgcgccagtccgcgcgggcgcatgggcactgc aggtgcgagcgaggggcttcggggttccaggatctggtgctgggctagga gcgggatgcaagtccaggggcagtgacgcgaggcctagggtgcgggatgt gggtctcagggacgcgcagggaccggggtgcaaggtcccgttgggcaggg cgcgggtgtttcgggccaagggtccacggggcgacatgcggagctctgga tgctgtttcattgggtgccggtcctgctagggaagagtgggccggcggct catggcccctgtggtcacagtccctgaatggtgcctgcgtcctgatgcgc cggcgcccagcggccacttccttcatgttccaagtttcggtttcactgca ggcagccggtccagcctggccctgagtctccgaccccattaactctcggg ttgcggacagcgctaggtcggccctgctccccagcaacacccaggaaggt cggggacccccaacctacacaaccccgtgtcctcgcgtaaagcggtccca ggctccgccccggaatctgctctcaccaactgcagcagaacttttgcgag ccagatgtctgccctcaccaactgaagccagaactttttcgtgccaggcg tctgtgcccagggcgctgatcttacctaggtcaaagccgggagcctcccc tgtccccgaagctgcagcgagaggtgcgctcgctcgcaatgggctagccc aaacccatctgcttttttcttagtctagcccgggcggggggtgggagggg agg
quality values	Open. Hide. 58 31 15 26 58 58 34 16 54 62 62 49 62 62 62 62 62 62 62 62 62 62 62 47 47 47 62 62 62 62 49 62 62 62 62 39 30 32 28 28 28 32 28 28 38 38 28 24 56 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 62 62 62 56 59 59 62 62 62 62 62 59 59 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 54 51 62 62 62 53 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 47 47 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 49 52 52 54 52 58 58 58 58 58 58 54 58 54 58 58 58 58 54 54 58 58 54 46 54 52 54 58 54 54 38 45 41 48 58 54 58 45 41 58 58 40 58 58 54 52 54 47 54 58 58 54 37 58 47 42 58 53 58 46 47 58 54 58 52 58 41 54 37 50 52 43 42 52 54 54 42 54 54 54 46 54 58 58 54 58 58 58 54 54 58 58 54 49 58 58 54 54 58 54 54 51 47 35 58 58 36 26 54 58 51 52 50 46 52 23 58 43 49 49 58 58 53 58 51 51 50 50 46 58 45 35 50 46 50 33 22 30 42 46 58 41 21 50 35 48 34 51 52 37 39 39 17 32 46 54 41 40 58 51 32 40 25 41 40 50 50 54 34 28 46 50 37 38 39 32 40 44 40 50 19 58 8 58 35 39 15 46 25 49 37 50 31 34 35 47 51 17 51 54 32 41 51 22 39 16 50 39 28 18 50 42 52 50 34 50 42 34 50 42 51 40 53 39 53 12 50 35 19 41 42 34 54 37 38 19 30 50 34 33 38 37 30 33 52 33 51 33 17 29 54 29 51 35 21 10 44 42 33 49 33 40 53 25 18 51 54 40 51 31 27 20 29 44 35 41 32 53 54 54 54 53 26 21 54 44 51 39 33 32 16 15 19 31 24 39 40 41 24 24 20 21 34 34 21 19 33 31 31 21 53 45 51 25 51 18 29 25 31 22 34 14 17 21 34 35 33 21 15 51 31 37 31 31 42 35 31 51 18 36 33 31 31 25 27 29 32 25 33 31 32 33 42 28 31 38 37 32 32 31 14 16 31 12 7 18 24 33 48 48 36 15 24 21 37 29 32 21 27 31 33 19 37 11 36 25 18 31 23 31 26 16 31 31 31 32 25 27 21 25 32 19 17 30 21 31 24 44 44 44 44 19 19 16 7 15 10 31 31 36 38 41 36 36 41 31 8 31 31 38 26 17 26 26 18 21 31 26 23 27 22 14 10 8 21 12 9 20 24 27 32 22 19 19 14 25 19 7 5 18 19 13 12 16 24 31 8 23 4 17 31 21 21 13 7 32 26 21 10 48 16 11 22 18 28 16 26 16 25 20 23 27 19 12 20 13 23 7 17 13 12 4 6 16 11 29 6 15 9 5 47 29 21 9 9 9 27 21 8 33 21 9 25 8 10 6 25 28 38 21 10 4 3 6 6 8 8 8 3 5 20 23 8 16 9 16 25 21 7 11 8 19 10 16 25 11 23 9 5 6 22 22 8 15 7 6 5 20 16 21 14 9 3	Open. Hide. 62 47 51 44 62 62 47 43 62 62 62 62 62 50 28 28 28 27 28 27 21 27 35 40 56 62 54 54 54 54 62 62 62 59 35 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 56 56 40 48 50 38 43 56 56 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 47 40 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 49 42 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 58 42 54 58 58 58 58 42 54 54 54 52 58 58 54 58 58 58 58 54 38 43 58 58 58 58 54 54 42 52 52 52 54 54 54 54 52 58 52 54 58 54 54 42 44 49 44 41 58 52 58 58 58 58 58 29 28 58 47 58 54 54 58 58 58 51 51 58 53 49 50 54 49 51 50 48 46 49 58 58 48 58 58 58 51 58 58 51 39 58 58 51 51 58 44 46 53 58 49 50 39 58 58 51 49 58 50 51 39 41 48 35 51 58 51 51 51 58 47 39 54 49 54 41 37 51 40 50 52 51 58 49 58 53 50 52 53 39 58 40 40 46 58 58 51 51 58 20 58 50 54 49 40 37 49 29 54 51 54 54 40 37 28 24 40 42 28 31 40 30 40 49 49 49 54 46 31 30 14 14 18 50 18 14 44 38 54 54 51 34 21 46 51 31 40 37 21 51 47 46 29 39 53 51 46 40 38 46 51 37 37 53 51 47 34 52 51 32 35 30 41 34 52 34 29 47 32 40 23 51 32 32 32 52 46 32 53 53 32 46 33 27 18 31 51 42 31 40 36 22 21 33 20 20 51 40 38 30 36 29 24 31 43 32 39 30 31 46 31 51 45 48 22 46 46 27 46 30 31 31 29 42 37 37 31 23 31 20 24 26 27 47 29 32 34 27 24 37 41 30 30 42 37 36 46 31 31 39 31 37 43 28 29 47 47 47 47 25 26 37 32 31 20 31 43 34 31 21 31 36 18 12 46 37 26 38 47 43 43 43 44 21 25 41 18 36 18 43 41 12 30 9 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_119397926_119399032
seq2: B6Ng01-288E19.b_44_1152 (reverse)

seq1  AGGCCT-CTGTGGCTAA-GGCT-CACCACTCCCCTGA-GCT-GTTTTTAC  45
      |||||| |||||||||| |||| |||||||||||||| ||| ||||| ||
seq2  AGGCCTCCTGTGGCTAAGGGCTCCACCACTCCCCTGAGGCTGGTTTTAAC  50

seq1  TCTTCTGACCTGGGTGTCACTGGCCAGTGTGCCAGGATCAGGTTTGACAA  95
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TCTTCTGACCTGGGTGTCACTGGCCAGTGTGCCAGGATCAGG-TTGACAA  99

seq1  CTAAGTAAGATTCCTTC-TAGGTTGTGTGTGTGTGTGTGTGTG-GGGGGG  143
      |||||| |||||||||| ||||||||||||||||||||||||| |||| |
seq2  CTAAGT-AGATTCCTTCTTAGGTTGTGTGTGTGTGTGTGTGTGTGGGGAG  148

seq1  GGGGGGGTTGGTGTTTTTTAAGACAAGATCTCACTATGTGGCTCTGGTTG  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGGTTGGTGTTTTTTAAGACAAGATCTCACTATGTGGCTCTGGTTG  198

seq1  GCCTAAAACTCCTCATGTAGACCAAGCTGGCCTTGAACTCAGATATTTGG  243
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GCCTAAAACT-CTCATGTAGACCAAGCTGGCCTTGAACTCAGATATTTGG  247

seq1  CTGCCTCTGCCTCCCAAGGCCTGTGCCATCATGCCTGTATTTTGCTTTTT  293
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CTGCCTCTGCCTCCCAAGGCCTGTGCCATCATGCCTGTA-TTTGCTTTTT  296

seq1  TGTTTTGGTTTTTTGAGACAGGGTCTCTCTGGTACTGGTAGGCCTGGCTG  343
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTGG-TTTTTGAGACAGGGTCTCTCTGGTACTGGTAGGCCTGGCTG  345

seq1  TCCTACTTTGTAGACCAGGCTGGCCTTAAACTCAGATCTGCCTGCCTCTG  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTACTTTGTAGACCAGGCTGGCCTTAAACTCAGATCTGCCTGCCTCTG  395

seq1  CCTGGGATTAAAGGCTGTAAATAAAGTTCTGTGGTTAAAGGGCTGTGCCA  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGGATTAAAGGCTGTAAATAAAGTTCTGTGGTTAAAGGGCTGTGCCA  445

seq1  CTAGCACATGTTTGTAGTTTTGAATGAGTAGTTTACAACGCCAGCATTAG  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCACATGTTTGTAGTTTTGAATGAGTAGTTTACAACGCCAGCATTAG  495

seq1  TTGGAAGGTTGAAACAGGCAGAATTCTGAGTTTGAGGCCATCCTGGTCTA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAAGGTTGAAACAGGCAGAATTCTGAGTTTGAGGCCATCCTGGTCTA  545

seq1  CAGGCTGAGTCCCAGAACAGCCAGGGCTACACAGAGAAACCCTGGCTCAG  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTGAGTCCCAGAACAGCCAGGGCTACACAGAGAAACCCTGGCTCAG  595

seq1  AAAACAAAAACAGAAAAAGGCTTTAATGATGGAAGTGTAGTGTGTGGCCG  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAAAAACAGAAAAAGGCTTTAATGATGGAAGTGTAGTGTGTGGCCG  645

seq1  GGAGCTGCTTGAGGGTCCAGGGAGGATTATCTGCCTGCTATGCTATGAGG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCTGCTTGAGGGTCCAGGGAGGATTATCTGCCTGCTATGCTATGAGG  695

seq1  CCAGACTCCCCCTCTAAGTCTTCTACTCAGTGGTCTGAAATAAACCATGG  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGACTCCCCCTCTAAGTCTTCTACTCAGTGGTCTGAAATAAACCATGG  745

seq1  CTTCTGTGTCCTGGCCAGGGAACCAAAGACACTGGCAGGAAACCCTGGAA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGTGTCCTGGCCAGGGAACCAAAGACACTGGCAGGAAACCCTGGAA  795

seq1  AGGCCAGCAAGTAGCCAGAGTAGCCAGTCCCTTCTGCAAACACAATGTGT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCAGCAAGTAGCCAGAGTAGCCAGTCCCTTCTGCAAACACAATGTGT  845

seq1  ACCTGTGCACATACAGGGAGGGGGCAGCTAAGCTTTGGGCTTGTCTGGCC  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGTGCACATACAGGGAGGGGGCAGCTAAGCTTTGGGCTTGTCTGGCC  895

seq1  CCTGGCCTCATGTTCTTAAGCATTCTAGGATCTATAATGCCAGGACTTGG  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCCTCATGTTCTTAAGCATTCTAGGATCTATAATGCCAGGACTTGG  945

seq1  ATCCTGGCCATTGTGTTCAAAGCTCTATACCTACATAGAGCCAAGCTTGG  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTGGCCATTGTGTTCAAAGCTCTATACCTACATAGAGCCAAGCTTGG  995

seq1  TCAGGAATGTCCGGTTTTCCCTAGATCAAGGACTCGCAGTTACCCACATC  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGAATGTCCGGTTTTCCCTAGATCAAGGACTCGCAGTTACCCACATC  1045

seq1  TTTTATTTTGTGTATATGAGAACAAAGTGGCCCAGGAACTTCAAAGGAAG  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATTTTGTGTATATGAGAACAAAGTGGCCCAGGAACTTCAAAGGAAG  1095

seq1  GGCACATGGAATTC  1107
      ||||||||||||||
seq2  GGCACATGGAATTC  1109

seq1: chr11_119251339_119252190
seq2: B6Ng01-288E19.g_69_921

seq1  GAATTCCAGCAAGGCTGTGCGCCAAGGAGGCGGAGGGGCGGCGCCGGCCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGCAAGGCTGTGCGCCAAGGAGGCGGAGGGGCGGCGCCGGCCC  50

seq1  CGTGACCCCTCATCGAAGCGCGCCAGTCCGCGCGGGCGCATGGGCACTGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGACCCCTCATCGAAGCGCGCCAGTCCGCGCGGGCGCATGGGCACTGC  100

seq1  AGGTGCGAGCGAGGGGCTTCGGGGTTCCAGGATCTGGTGCTGGGCTAGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGCGAGCGAGGGGCTTCGGGGTTCCAGGATCTGGTGCTGGGCTAGGA  150

seq1  GCGGGATGCAAGTCCAGGGGCAGTGACGCGAGGCCTAGGGTGCGGGATGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGGATGCAAGTCCAGGGGCAGTGACGCGAGGCCTAGGGTGCGGGATGT  200

seq1  GGGTCTCAGGGACGCGCAGGGACCGGGGTGCAAGGTCCCGTTGGGCAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCTCAGGGACGCGCAGGGACCGGGGTGCAAGGTCCCGTTGGGCAGGG  250

seq1  CGCGGGTGTTTCGGGCCAAGGGTCCACGGGGCGACATGCGGAGCTCTGGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCGGGTGTTTCGGGCCAAGGGTCCACGGGGCGACATGCGGAGCTCTGGA  300

seq1  TGCTGTTTCATTGGGTGCCGGTCCTGCTAGGGAAGAGTGGGCCGGCGGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTTTCATTGGGTGCCGGTCCTGCTAGGGAAGAGTGGGCCGGCGGCT  350

seq1  CATGGCCCCTGTGGTCACAGTCCCTGAATGGTGCCTGCGTCCTGATGCGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGCCCCTGTGGTCACAGTCCCTGAATGGTGCCTGCGTCCTGATGCGC  400

seq1  CGGCGCCCAGCGGCCACTTCCTTCATGTTCCAAGTTTCGGTTTCACTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCGCCCAGCGGCCACTTCCTTCATGTTCCAAGTTTCGGTTTCACTGCA  450

seq1  GGCAGCCGGTCCAGCCTGGCCCTGAGTCTCCGACCCCATTAACTCTCGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGCCGGTCCAGCCTGGCCCTGAGTCTCCGACCCCATTAACTCTCGGG  500

seq1  TTGCGGACAGCGCTAGGTCGGCCCTGCTCCCCAGCAACACCCAGGAAGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCGGACAGCGCTAGGTCGGCCCTGCTCCCCAGCAACACCCAGGAAGGT  550

seq1  CGGGGACCCCCAACCTACACAACCCCGTGTCCTCGCGTAAAGCGGTCCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGGACCCCCAACCTACACAACCCCGTGTCCTCGCGTAAAGCGGTCCCA  600

seq1  GGCTCCGCCCCGGAATCTGCTCTCACCAACTGCAGCAGAACTTTTGCGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCCGCCCCGGAATCTGCTCTCACCAACTGCAGCAGAACTTTTGCGAG  650

seq1  CCAGATGTCTGCCCTCACCAACTGAAGCCAGAACTTTTTCGTGCCAGGCG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGATGTCTGCCCTCACCAACTGAAGCCAGAACTTTTTCGTGCCAGGCG  700

seq1  TCTGTGCCCAGGGCGCTGATCTTACCTAGGTCAAAGCCGGGAGCCTCCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGCCCAGGGCGCTGATCTTACCTAGGTCAAAGCCGGGAGCCTCCCC  750

seq1  TGTCCCCGAAGCTGCAGCGAGAGGTGCGCTCGCTCGCAATGGGCTAGCCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCCCGAAGCTGCAGCGAGAGGTGCGCTCGCTCGCAATGGGCTAGCCC  800

seq1  AAACCCATCTGCTTTTTTCTTAGTCTAGCCCGGGCGGGGGGT-GGAGGGG  849
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AAACCCATCTGCTTTTTTCTTAGTCTAGCCCGGGCGGGGGGTGGGAGGGG  850

seq1  AGG  852
      |||
seq2  AGG  853

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information