MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-310K22
Chromosome	11 (Build37)
Map Location	68,508,332 - 68,683,720
singlet/doublet	doublet
Overlap gene	Myh10, Ndel1
Upstream gene	Rcvrn, Glp2r, LOC544792, Dhrs7c, LOC100041899, Usp43, Wdr16, Stx8, Ntn1, Pik3r5, BB220380, BC024997, Ccdc42
Downstream gene	9930039A11Rik, Rpl26, Odf4, Arhgef15, Slc25a35, 2400006H24Rik, Pfas, 1500010J02Rik, Aurkb, 2310047M10Rik, Tmem107, Vamp2, Per1, Hes7, Aloxe3, Alox12b, Alox8, Gucy2e, Cntrob, Trappc1, Kcnab3, A030009H04Rik, Chd3, Cyb5d1, Lsmd1, Tmem88, Jmjd3, Dnahc2, Efnb3, Wdr79, LOC100043030, Trp53, Atp1b2, Shbg, Sat2, LOC382532, Fxr2, Sox15, Mpdu1, Cd68, Eif4a1, Senp3, Tnfsf12-tnfsf13, Tnfsf13, Tnfsf12, LOC100041994, Polr2a, Amac1, Zbtb4, Chrnb1, Fgf11, Tmem102, 4933402P03Rik, 1700095G12Rik, Nlgn2, 1810027O10Rik, Plscr3, Tnk1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rcvrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19674 MGI:97883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glp2r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93896 MGI:2136733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC544792 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	Dhrs7c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68460 MGI:1915710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Usp43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216835 MGI:2444541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71860 MGI:1919110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55943 MGI:1890156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18208 MGI:105088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3r5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320207 MGI:2443588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BB220380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104709 MGI:2144613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC024997 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215723 MGI:2384904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276920 MGI:3045254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77579 MGI:1930780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83431 MGI:1932915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930039A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320040 MGI:2443227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19941 MGI:106022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Odf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252868 MGI:2182079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442801 MGI:3045246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71998 MGI:1919248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2400006H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57785 MGI:1889073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237823 MGI:2684864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 81 ESTs, 7 Proteins

name	1500010J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68964 MGI:1916214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Aurkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20877 MGI:107168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047M10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71923 MGI:1919173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66910 MGI:1914160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22318 MGI:1313277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Per1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18626 MGI:1098283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hes7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84653 MGI:2135679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aloxe3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23801 MGI:1345140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11686 MGI:1274782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11688 MGI:1098228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gucy2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14919 MGI:105123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntrob (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216846 MGI:2443290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245828 MGI:1098727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnab3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16499 MGI:1336208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A030009H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80515 MGI:1915359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216848 MGI:1344395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327951 MGI:2685586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsmd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78304 MGI:1925554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67020 MGI:1914270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216850 MGI:2448492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327954 MGI:107731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13643 MGI:109196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216853 MGI:2384933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 241 ESTs

name	Trp53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22059 MGI:98834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11932 MGI:88109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shbg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20415 MGI:98295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69215 MGI:1916465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Fxr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23879 MGI:1346074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20670 MGI:98363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpdu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24070 MGI:1346040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12514 MGI:88342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13681 MGI:95303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Senp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80886 MGI:2158736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf12-tnfsf13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tnfsf13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69583 MGI:1916833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfsf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21944 MGI:1196259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Polr2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20020 MGI:98086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56293 MGI:1927128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75580 MGI:1922830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11443 MGI:87890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14166 MGI:109167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380705 MGI:1921591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933402P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108803 MGI:1918293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700095G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74288 MGI:1921538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlgn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216856 MGI:2681835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810027O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69186 MGI:1916436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plscr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70310 MGI:1917560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83813 MGI:1930958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcvrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677692 GeneID:19674 MGI:97883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : recoverin transcript_id : NM_009038.1

name	Glp2r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30023839 GeneID:93896 MGI:2136733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucagon-like peptide 2 receptor transcript_id : NM_175681.2

name	LOC544792 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261928 GeneID:544792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to hCG1653800 transcript_id : XM_618894.4

name	Dhrs7c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625740 GeneID:68460 MGI:1915710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 7C transcript_id : NM_001013013.1

name	Usp43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123314451 GeneID:216835 MGI:2444541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 43 transcript_id : NM_173754.4

name	Wdr16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053951 GeneID:71860 MGI:1919110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 16 transcript_id : NM_027963.2

name	Stx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118241 GeneID:55943 MGI:1890156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 8 transcript_id : NM_018768.2

name	Ntn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363093 GeneID:18208 MGI:105088
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin 1 transcript_id : NM_008744.2

name	Pik3r5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262160 GeneID:320207 MGI:2443588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoinositide-3-kinase, regulatory subunit 5, p101 transcript_id : NM_177320.2

name	BB220380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362958 GeneID:104709 MGI:2144613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence BB220380 transcript_id : NM_001081566.1

name	BB220380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362962 GeneID:104709 MGI:2144613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence BB220380 transcript_id : NM_001004435.2

name	BC024997 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122466 GeneID:215723 MGI:2384904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024997 transcript_id : NM_146004.1

name	Ccdc42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343047 GeneID:276920 MGI:3045254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 42 transcript_id : NM_177779.2

name	Myh10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:105554494 GeneID:77579 MGI:1930780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 10, non-muscle transcript_id : NM_175260.2

name	Ndel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963776 GeneID:83431 MGI:1932915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear distribution gene E-like homolog 1 (A. nidulans) transcript_id : NM_023668.1

name	9930039A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089299 GeneID:320040 MGI:2443227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930039A11 gene transcript_id : NM_177060.3

name	Rpl26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130500915 GeneID:19941 MGI:106022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L26 transcript_id : NM_009080.2

name	Odf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21919407 GeneID:252868 MGI:2182079
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 4 transcript_id : NM_145746.1

name	Arhgef15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60279699 GeneID:442801 MGI:3045246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 15 transcript_id : NM_177566.3

name	Slc25a35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354306 GeneID:71998 MGI:1919248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 35 transcript_id : NM_028048.2

name	2400006H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56961625 GeneID:57785 MGI:1889073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2400006H24 gene transcript_id : NM_021329.2

name	Pfas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261973 GeneID:237823 MGI:2684864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 81 ESTs, 7 Proteins product : phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) transcript_id : XM_111232.8

name	1500010J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742799 GeneID:68964 MGI:1916214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500010J02 gene transcript_id : NM_026889.2

name	1500010J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742801 GeneID:68964 MGI:1916214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500010J02 gene transcript_id : NM_001013256.1

name	Aurkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51317393 GeneID:20877 MGI:107168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase B transcript_id : NM_011496.1

name	2310047M10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369094 GeneID:71923 MGI:1919173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310047M10 gene transcript_id : NM_028005.3

name	Tmem107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802127 GeneID:66910 MGI:1914160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 107 transcript_id : NM_028336.2

name	Tmem107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539608 GeneID:66910 MGI:1914160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 107 transcript_id : NM_025838.1

name	Vamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130363 GeneID:22318 MGI:1313277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 2 transcript_id : NM_009497.3

name	Per1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803296 GeneID:18626 MGI:1098283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : period homolog 1 (Drosophila) transcript_id : NM_011065.3

name	Hes7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368444 GeneID:84653 MGI:2135679
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy and enhancer of split 7 (Drosophila) transcript_id : NM_033041.3

name	Aloxe3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753041 GeneID:23801 MGI:1345140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate lipoxygenase 3 transcript_id : NM_011786.1

name	Alox12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130321 GeneID:11686 MGI:1274782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 12-lipoxygenase, 12R type transcript_id : NM_009659.2

name	Alox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893229 GeneID:11688 MGI:1098228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 8-lipoxygenase transcript_id : NM_009661.3

name	Gucy2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680134 GeneID:14919 MGI:105123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase 2e transcript_id : NM_008192.1

name	Cntrob (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362833 GeneID:216846 MGI:2443290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrobin, centrosomal BRCA2 interacting protein transcript_id : NM_172560.2

name	Trappc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66730564 GeneID:245828 MGI:1098727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 1 transcript_id : NM_001024206.1

name	Kcnab3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373382 GeneID:16499 MGI:1336208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related subfamily, beta member 3 transcript_id : NM_010599.3

name	A030009H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181135 GeneID:80515 MGI:1915359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030009H04 gene transcript_id : NM_020591.1

name	Chd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358949 GeneID:216848 MGI:1344395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 3 transcript_id : NM_146019.2

name	Cyb5d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865880 GeneID:327951 MGI:2685586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 domain containing 1 transcript_id : NM_001045525.1

name	Lsmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347214 GeneID:78304 MGI:1925554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM domain containing 1 transcript_id : NM_030083.2

name	Tmem88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802097 GeneID:67020 MGI:1914270
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 88 transcript_id : NM_025915.3

name	Jmjd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945393 GeneID:216850 MGI:2448492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 3 transcript_id : NM_001017426.1

name	Dnahc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486772 GeneID:327954 MGI:107731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, heavy chain 2 transcript_id : NM_001081330.1

name	Efnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367810 GeneID:13643 MGI:109196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin B3 transcript_id : NM_007911.4

name	Wdr79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130039 GeneID:216853 MGI:2384933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 79 transcript_id : NM_144824.2

name	LOC100043030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261974 GeneID:100043030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 241 ESTs product : similar to ribosomal protein S27 (metallopanstimulin 1) transcript_id : XM_001479913.1

name	Trp53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755880 GeneID:22059 MGI:98834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 transcript_id : NM_011640.1

name	Atp1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802992 GeneID:11932 MGI:88109
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, beta 2 polypeptide transcript_id : NM_013415.4

name	Shbg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755505 GeneID:20415 MGI:98295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sex hormone binding globulin transcript_id : NM_011367.1

name	Sat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362782 GeneID:69215 MGI:1916465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermidine/spermine N1-acetyl transferase 2 transcript_id : NM_026991.2

name	Fxr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921588 GeneID:23879 MGI:1346074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation, autosomal homolog 2 transcript_id : NM_011814.2

name	Sox15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094090 GeneID:20670 MGI:98363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 15 transcript_id : NM_009235.1

name	Mpdu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347827 GeneID:24070 MGI:1346040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose-P-dolichol utilization defect 1 transcript_id : NM_011900.3

name	Cd68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753351 GeneID:12514 MGI:88342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD68 antigen transcript_id : NM_009853.1

name	Eif4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366509 GeneID:13681 MGI:95303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A1 transcript_id : NM_144958.3

name	Senp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802397 GeneID:80886 MGI:2158736
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO/sentrin specific peptidase 3 transcript_id : NM_030702.3

name	Tnfsf12-tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:77628046 GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12-member 13 transcript_id : NM_001034098.1

name	Tnfsf12-tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:77539771 GeneID:619441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12-member 13 transcript_id : NM_001034097.1

name	Tnfsf13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77627742 GeneID:69583 MGI:1916833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 13 transcript_id : NM_023517.2

name	Tnfsf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33438583 GeneID:21944 MGI:1196259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor (ligand) superfamily, member 12 transcript_id : NM_011614.1

name	Polr2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130551 GeneID:20020 MGI:98086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide A transcript_id : NM_009089.2

name	Amac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145472 GeneID:56293 MGI:1927128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-malonyl condensing enzyme 1 transcript_id : NM_019871.2

name	Zbtb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626059 GeneID:75580 MGI:1922830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 4 transcript_id : NM_029348.1

name	Chrnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981911 GeneID:11443 MGI:87890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) transcript_id : NM_009601.3

name	Fgf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753843 GeneID:14166 MGI:109167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 11 transcript_id : NM_010198.1

name	Tmem102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360242 GeneID:380705 MGI:1921591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 102 transcript_id : NM_001033433.2

name	4933402P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30425069 GeneID:108803 MGI:1918293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933402P03 gene transcript_id : NM_175368.1

name	1700095G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227236 GeneID:74288 MGI:1921538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700095G12 gene transcript_id : NM_028855.1

name	Nlgn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699424 GeneID:216856 MGI:2681835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroligin 2 transcript_id : NM_198862.2

name	1810027O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625729 GeneID:69186 MGI:1916436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810027O10 gene transcript_id : NM_026982.1

name	Plscr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803011 GeneID:70310 MGI:1917560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipid scramblase 3 transcript_id : NM_023564.3

name	Tnk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560012 GeneID:83813 MGI:1930958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase, non-receptor, 1 transcript_id : NM_031880.2

name	Rcvrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677693 CCDS:CCDS24859.1 GeneID:19674 MGI:97883
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IMP] GO_process : GO:0007602 - phototransduction [Evidence IMP]; GO:0051924 - regulation of calcium ion transport [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : guanylate cyclase activator; cancer associated retinopathy protein product : recoverin protein_id : NP_033064.1

name	Glp2r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30023840 CCDS:CCDS24860.1 GeneID:93896 MGI:2136733
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GLP2R product : glucagon-like peptide 2 receptor protein_id : NP_783612.2

name	LOC544792 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261929 GeneID:544792
definition	codon_start : 1 product : similar to hCG1653800 protein_id : XP_618894.4

name	Dhrs7c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625741 GeneID:68460 MGI:1915710
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dehydrogenase/reductase (SDR family) member 7C protein_id : NP_001013031.1

name	Usp43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123314452 CCDS:CCDS24861.1 GeneID:216835 MGI:2444541
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 43 protein_id : NP_776115.2

name	Wdr16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053952 CCDS:CCDS24862.1 GeneID:71860 MGI:1919110
definition	codon_start : 1 note : WD40-repear protein upregulated in HCC product : WD40-repeat protein upregulated in HCC protein_id : NP_082239.2

name	Stx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055356 CCDS:CCDS24863.1 GeneID:55943 MGI:1890156
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : syntaxin-like protein 3I35 product : syntaxin 8 protein_id : NP_061238.1

name	Ntn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363094 CCDS:CCDS24864.1 GeneID:18208 MGI:105088
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007411 - axon guidance [Evidence IMP] [Evidence IDA]; GO:0007409 - axonogenesis [Evidence IDA]; GO:0040023 - establishment of nucleus localization [Evidence IDA]; GO:0030517 - negative regulation of axon extension [Evidence IDA]; GO:0001764 - neuron migration [Evidence IMP]; GO:0045773 - positive regulation of axon extension [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0030334 - regulation of cell migration [Evidence IMP] [Evidence IDA] codon_start : 1 product : netrin 1 protein_id : NP_032770.2

name	Pik3r5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262161 CCDS:CCDS24865.1 GeneID:320207 MGI:2443588
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : phosphoinositide-3-kinase, regulatory subunit 5, p101 protein_id : NP_796294.2

name	BB220380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362959 GeneID:104709 MGI:2144613
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; p87 phosphoinositide 3-kinase gamma (PI3Kg) adapter protein; phosphoinositide 3-kinase regulatory subunit 6 product : p87 phosphoinositide 3-kinase gamma adapter protein isoform 1 protein_id : NP_001075035.1

name	BB220380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138727 CCDS:CCDS24866.1 GeneID:104709 MGI:2144613
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; p87 phosphoinositide 3-kinase gamma (PI3Kg) adapter protein; phosphoinositide 3-kinase regulatory subunit 6 product : p87 phosphoinositide 3-kinase gamma adapter protein isoform 2 protein_id : NP_001004435.1

name	BC024997 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122467 CCDS:CCDS24867.1 GeneID:215723 MGI:2384904
definition	codon_start : 1 product : hypothetical protein LOC215723 protein_id : NP_666116.1

name	Ccdc42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244294 CCDS:CCDS24868.1 GeneID:276920 MGI:3045254
definition	codon_start : 1 product : coiled-coil domain containing 42 protein_id : NP_808447.1

name	Myh10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33598964 CCDS:CCDS24869.1 GeneID:77579 MGI:1930780
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0001725 - stress fiber [Evidence IMP] [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0001778 - plasma membrane repair [Evidence IMP]; GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0006930 - substrate-bound cell migration, cell extension [Evidence IMP] codon_start : 1 note : myosin IIB; myosin heavy chain, nonmuscular, type B; nonmuscle myosin heavy chain II-B product : myosin heavy chain 10, non-muscle protein_id : NP_780469.1

name	Ndel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963777 CCDS:CCDS24870.1 GeneID:83431 MGI:1932915
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005813 - centrosome [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001833 - inner cell mass cell proliferation [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001764 - neuron migration [Evidence IGI]; GO:0008090 - retrograde axon cargo transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0047496 - vesicle transport along microtubule [Evidence IGI] codon_start : 1 exception : mismatches in translation note : nuclear disribution gene E like; nuclear distribution gene E-like product : NudeL protein protein_id : NP_076157.1

name	9930039A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089300 CCDS:CCDS24871.1 GeneID:320040 MGI:2443227
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320040 protein_id : NP_796034.2

name	Rpl26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677777 GeneID:19941 MGI:106022
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L26 protein_id : NP_033106.1

name	Odf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21919408 CCDS:CCDS24872.1 GeneID:252868 MGI:2182079
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0001520 - outer dense fiber [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : oppo 1; Oppo1-pending (oppo 1) product : outer dense fiber of sperm tails 4 protein_id : NP_665689.1

name	Arhgef15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60279700 CCDS:CCDS24873.1 GeneID:442801 MGI:3045246
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 15 protein_id : NP_808234.2

name	Slc25a35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312550 CCDS:CCDS24874.1 GeneID:71998 MGI:1919248
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 35 protein_id : NP_082324.1

name	2400006H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946640 CCDS:CCDS24875.1 GeneID:57785 MGI:1889073
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0008536 - Ran GTPase binding [Evidence IDA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence TAS] codon_start : 1 product : RAN guanine nucleotide release factor protein_id : NP_067304.1

name	Pfas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63622229 GeneID:237823 MGI:2684864
definition	codon_start : 1 product : phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) protein_id : XP_111232.4

name	1500010J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742800 GeneID:68964 MGI:1916214
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC68964 isoform a protein_id : NP_081165.2

name	1500010J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742802 GeneID:68964 MGI:1916214
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC68964 isoform b protein_id : NP_001013274.1

name	Aurkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317394 CCDS:CCDS24877.1 GeneID:20877 MGI:107168
definition	EC_number : 2.7.11.1 GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : aurora-related kinase 2; serine/threonine kinase 5; serine/threonine kinase 12 product : aurora kinase B protein_id : NP_035626.1

name	2310047M10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952555 GeneID:71923 MGI:1919173
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC71923 protein_id : NP_082281.2

name	Tmem107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539609 CCDS:CCDS24879.1 GeneID:66910 MGI:1914160
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC66910 isoform 1 protein_id : NP_080114.1

name	Tmem107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539635 CCDS:CCDS24880.1 GeneID:66910 MGI:1914160
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC66910 isoform 2 protein_id : NP_082612.1

name	Vamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678551 CCDS:CCDS24881.1 GeneID:22318 MGI:1313277
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0030141 - secretory granule [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA]; GO:0030672 - synaptic vesicle membrane [Evidence IDA]; GO:0019717 - synaptosome [Evidence IEA]; GO:0042589 - zymogen granule membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0000149 - SNARE binding [Evidence IDA] GO_process : GO:0017156 - calcium ion-dependent exocytosis [Evidence IDA] [Evidence IMP]; GO:0006944 - membrane fusion [Evidence IMP]; GO:0017157 - regulation of exocytosis [Evidence IDA]; GO:0016079 - synaptic vesicle exocytosis [Evidence IMP]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : synaptobrevin II; vesicle-associated membrane 2 product : vesicle-associated membrane protein 2 protein_id : NP_033523.1

name	Per1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755032 CCDS:CCDS24882.1 GeneID:18626 MGI:1098283
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 exception : mismatches in translation product : period homolog 1 protein_id : NP_035195.1

name	Hes7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098129 CCDS:CCDS24883.1 GeneID:84653 MGI:2135679
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0007219 - Notch signaling pathway [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IMP] [Evidence IDA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0001756 - somitogenesis [Evidence IMP]; GO:0035121 - tail morphogenesis [Evidence IMP] codon_start : 1 note : bHLH factor Hes7 product : hairy and enhancer of split 7 protein_id : NP_149030.2

name	Aloxe3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753042 CCDS:CCDS24884.1 GeneID:23801 MGI:1345140
definition	GO_function : GO:0003824 - catalytic activity [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arachidonate lipoxygenase 3 protein_id : NP_035916.1

name	Alox12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753040 CCDS:CCDS24885.1 GeneID:11686 MGI:1274782
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : arachidonate 12-lipoxygenase, 12R type protein_id : NP_033789.1

name	Alox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363263 CCDS:CCDS24886.1 GeneID:11688 MGI:1098228
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0050473 - arachidonate 15-lipoxygenase activity [Evidence IEA] [Evidence ISS]; GO:0047677 - arachidonate 8-lipoxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence ISS]; GO:0030336 - negative regulation of cell migration [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0045926 - negative regulation of growth [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS]; GO:0030850 - prostate gland development [Evidence ISS]; GO:0030856 - regulation of epithelial cell differentiation [Evidence ISS] codon_start : 1 note : 8S-lipoxygenase product : arachidonate 15-lipoxygenase, second type protein_id : NP_033791.1

name	Gucy2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680135 CCDS:CCDS24887.1 GeneID:14919 MGI:105123
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IEA]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 exception : mismatches in translation note : guanylyl cyclase 2e product : guanylate cyclase 2e protein_id : NP_032218.1

name	Cntrob (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369792 CCDS:CCDS24888.1 GeneID:216846 MGI:2443290
definition	GO_component : GO:0005814 - centriole [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007099 - centriole replication [Evidence ISS]; GO:0051299 - centrosome separation [Evidence ISS]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : LYST-interacting protein LIP8 product : centrobin, centrosomal BRCA2 interacting protein protein_id : NP_766148.1

name	Trappc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66730565 CCDS:CCDS24889.1 GeneID:245828 MGI:1098727
definition	codon_start : 1 note : novel Sybindin-like family domain-containing protein product : trafficking protein particle complex 1 protein_id : NP_001019377.1

name	Kcnab3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330160 CCDS:CCDS24890.1 GeneID:16499 MGI:1336208
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium voltage-gated channel, shaker-related subfamily, beta member 3 protein_id : NP_034729.2

name	A030009H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181136 GeneID:80515 MGI:1915359
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC80515 protein_id : NP_065616.1

name	Chd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358950 GeneID:216848 MGI:1344395
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0016585 - chromatin remodeling complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016581 - NuRD complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004365 - glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IDA] [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Mi-2 alpha product : chromodomain helicase DNA binding protein 3 protein_id : NP_666131.2

name	Cyb5d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865881 CCDS:CCDS24892.1 GeneID:327951 MGI:2685586
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : cytochrome b5 domain containing 1 protein_id : NP_001038990.1

name	Lsmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037525 CCDS:CCDS24893.1 GeneID:78304 MGI:1925554
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA] codon_start : 1 note : novel LSM domain-containing protein product : MAK31-like protein protein_id : NP_084359.1

name	Tmem88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560207 CCDS:CCDS24894.1 GeneID:67020 MGI:1914270
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67020 protein_id : NP_080191.2

name	Jmjd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945394 CCDS:CCDS24895.1 GeneID:216850 MGI:2448492
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : jumonji domain containing 3 protein_id : NP_001017426.1

name	Dnahc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486773 GeneID:327954 MGI:107731
definition	codon_start : 1 note : dynein heavy chain domain 3; dynein, axon, heavy chain 2; region surrounding P-loop 1; axonemal dynein heavy chain product : dynein, axonemal, heavy chain 2 protein_id : NP_001074799.1

name	Efnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681281 CCDS:CCDS24896.1 GeneID:13643 MGI:109196
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007628 - adult walking behavior [Evidence IMP]; GO:0016198 - axon choice point recognition [Evidence IMP]; GO:0007411 - axon guidance [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : ephrin B3 protein_id : NP_031937.1

name	Wdr79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450205 CCDS:CCDS24897.1 GeneID:216853 MGI:2384933
definition	codon_start : 1 product : WD repeat domain 79 protein_id : NP_659073.1

name	LOC100043030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261975 GeneID:100043030
definition	codon_start : 1 product : similar to ribosomal protein S27 (metallopanstimulin 1) protein_id : XP_001479963.1

name	Trp53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755881 GeneID:22059 MGI:98834
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] [Evidence IGI]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030330 - DNA damage response, signal transduction by p53 class mediator [Evidence IDA] [Evidence IGI]; GO:0042771 - DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis [Evidence ISS] [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0009792 - embryonic development (sensu Metazoa) [Evidence IGI]; GO:0031571 - G1 DNA damage checkpoint [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008156 - negative regulation of DNA replication [Evidence IMP] [Evidence IDA]; GO:0048147 - negative regulation of fibroblast proliferation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IGI] [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0000060 - protein import into nucleus, translocation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] [Evidence IDA]; GO:0009411 - response to UV [Evidence IMP]; GO:0010165 - response to X-ray [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : p53 cellular tumor antigen; p53 tumor suppressor; tumor supressor p53 product : transformation related protein 53 protein_id : NP_035770.1

name	Atp1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242138 CCDS:CCDS24898.1 GeneID:11932 MGI:88109
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : snoRNA MBI-85 product : Na+/K+ -ATPase beta 2 subunit protein_id : NP_038201.1

name	Shbg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755506 CCDS:CCDS24899.1 GeneID:20415 MGI:98295
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 product : sex hormone binding globulin protein_id : NP_035497.1

name	Sat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249210 GeneID:69215 MGI:1916465
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004145 - diamine N-acetyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008216 - spermidine metabolism [Evidence ISS]; GO:0008215 - spermine metabolism [Evidence ISS] codon_start : 1 product : spermidine/spermine N1-acetyl transferase 2 protein_id : NP_081267.1

name	Fxr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921589 CCDS:CCDS24901.1 GeneID:23879 MGI:1346074
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : fragile X mental retardation gene 2, autosomal homolog product : fragile X mental retardation-related protein 2 protein_id : NP_035944.2

name	Sox15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094091 CCDS:CCDS24902.1 GeneID:20670 MGI:98363
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IGI] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IGI] [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IGI]; GO:0048627 - myoblast development [Evidence IMP]; GO:0045843 - negative regulation of striated muscle development [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0043403 - skeletal muscle regeneration [Evidence IMP] codon_start : 1 product : SRY-box 15 protein_id : NP_033261.1

name	Mpdu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981340 CCDS:CCDS24903.1 GeneID:24070 MGI:1346040
definition	codon_start : 1 note : suppressor of Lec15 homolog (C.griseus) product : mannose-P-dolichol utilization defect 1 protein_id : NP_036030.2

name	Cd68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753352 GeneID:12514 MGI:88342
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 note : macrosialin product : CD68 antigen protein_id : NP_033983.1

name	Eif4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450625 CCDS:CCDS24904.1 GeneID:13681 MGI:95303
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : initiation factor eIF-4A long form product : eukaryotic translation initiation factor 4A1 protein_id : NP_659207.1

name	Senp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981408 CCDS:CCDS24905.1 GeneID:80886 MGI:2158736
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0019538 - protein metabolism [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sentrin/SUMO-specific protease; SUMO/sentrin specific protease 3 product : smt3-specific isopeptidase 1 protein_id : NP_109627.2

name	Tnfsf12-tnfsf13 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:77628047 GeneID:619441
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : tumor necrosis factor (ligand) superfamily, member 12-member 13 isoform b protein_id : NP_001029270.1

name	Tnfsf12-tnfsf13 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:77539772 CCDS:CCDS24906.1 GeneID:619441
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : tumor necrosis factor (ligand) superfamily, member 12-member 13 isoform a protein_id : NP_001029269.1

name	Tnfsf13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77627743 GeneID:69583 MGI:1916833
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0048298 - positive regulation of isotype switching to IgA isotypes [Evidence ISS] [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP] codon_start : 1 note : tumor necrosis factor (ligand) superfamily, member 12 product : tumor necrosis factor (ligand) superfamily, member 13 protein_id : NP_076006.2

name	Tnfsf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33438584 CCDS:CCDS24907.1 GeneID:21944 MGI:1196259
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0008219 - cell death [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : tumor necrosis factor (ligand) superfamily, member 12 protein_id : NP_035744.1

name	Polr2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677795 GeneID:20020 MGI:98086
definition	GO_component : GO:0005665 - DNA-directed RNA polymerase II, core complex [Evidence IEA]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IEA] [Evidence ISS] codon_start : 1 note : RNA polymerase II 1 product : polymerase (RNA) II (DNA directed) polypeptide A protein_id : NP_033115.1

name	Amac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145473 CCDS:CCDS24908.1 GeneID:56293 MGI:1927128
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : testicular condensing enzyme product : acyl-malonyl condensing enzyme 1 protein_id : NP_063924.2

name	Zbtb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626060 GeneID:75580 MGI:1922830
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger and BTB domain containing 4 protein_id : NP_083624.1

name	Chrnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981912 CCDS:CCDS24910.1 GeneID:11443 MGI:87890
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : acetylcholine receptor beta product : cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) protein_id : NP_033731.2

name	Fgf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753844 CCDS:CCDS24911.1 GeneID:14166 MGI:109167
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : fibroblast growth factor 11 protein_id : NP_034328.1

name	Tmem102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701935 GeneID:380705 MGI:1921591
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC380705 protein_id : NP_001028605.1

name	4933402P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425070 CCDS:CCDS24912.1 GeneID:108803 MGI:1918293
definition	codon_start : 1 product : hypothetical protein LOC108803 protein_id : NP_780577.1

name	1700095G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144227237 GeneID:74288 MGI:1921538
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA] codon_start : 1 product : spermatid maturation 1 protein_id : NP_083131.1

name	Nlgn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699425 CCDS:CCDS24914.1 GeneID:216856 MGI:2681835
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence ISS] codon_start : 1 note : ortholog of human and rat neuroligin 2 NLGN2 product : neuroligin 2 protein_id : NP_942562.2

name	1810027O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625730 CCDS:CCDS24915.1 GeneID:69186 MGI:1916436
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 product : hypothetical protein LOC69186 protein_id : NP_081258.1

name	Plscr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963735 CCDS:CCDS24916.1 GeneID:70310 MGI:1917560
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP] codon_start : 1 product : phospholipid scramblase 3 protein_id : NP_076053.1

name	Tnk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560013 CCDS:CCDS24917.1 GeneID:83813 MGI:1930958
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IMP] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004715 - non-membrane spanning protein tyrosine kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence IMP]; GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : non-receptor tyrosine kinase product : tyrosine kinase, non-receptor, 1 protein_id : NP_114086.2

name	LOC100041899 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041899
definition	number : 1 pseudo : _no_value

name	LOC100041899 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041899
definition	number : 2 pseudo : _no_value

name	LOC100041899 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041899
definition	number : 3 pseudo : _no_value

name	LOC382532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382532
definition	number : 1 pseudo : _no_value

name	LOC100041994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041994
definition	number : 2 pseudo : _no_value

name	LOC100041994 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041994
definition	number : 1 pseudo : _no_value

clone name	MSMg01-383O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-065L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015J21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-310K22.b	B6Ng01-310K22.g
ACC	GA102595	GA102596
length	1,080	1,076
definition	B6Ng01-310K22.b	B6Ng01-310K22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(68,682,647 - 68,683,720)	(68,508,332 - 68,509,422)
sequence	gaattctcggtcctgctgcctggaggaggttgtcaacatactgaggcttc ccagggaggagggtgagacatcctggacttggaggagtcctttctcctca ggccccctttctctttatggtgaagtgacttagctgctctttccagttct tctctccttctcctgctgggctggggtgaggcaatgctttggtttgccta ctccctggactgtgaggtctgcgtctaaatgttctgtgaatgtaccacct tcaacacatcgtcttctctttagcccatgccatatggttgctgaagcaga tagaacctctatcccaggagcctttctggagttcagaggcacagcactct tgctttggctagcttctggccttcaggttcctctgtctgttgcatggcta ccacccttgcacatgcttttaggcttgtaatagtatatgcgtgtggacat cttttgtttgtttgtttgtttggtttttcgagagtttctctgtatagccc tggctgtcctggaactcactctgtagaccaggctggcctcgaactcagaa atccacctgcctctgcctcccgagtgctgggattaaaggcatgagccacc atgcccggcacttgtttgtttgttttatcaacgtatctatgtatccatgt ctgtctgtatatttttatctatctatctatctatctatctatctatctat ctatctatctatctatctatctgagacaagccctctctatgcggccctgg ctatctgccctggaattgtctatgtagacaaaggttaggcttgaactcac agagatctgcctgcctctggctctcaaatgccgagactagaagcatgtgc caccaccaagtagacatctccctgccagtgctctgctgtgttgtgctgtg ttctttgtaacatgtgttttgttgggaggaagcgatggtatgtgcactca tcctaggatggtagccagggtggttacagcatgtttttcactttggattt gagttgaggggagcaattctcttcttacatgggatgttatttacttgttt ttaattttggagatttccgataaaaaaaaa	gaattcttcatttgtaaaacagagttattaatggaagctatcttgtgccc ctcttgtgcagattaagaccttgatatacatgcatatatatagaacagtt tctggatgtaattagggatgtataacaagattatttgttttaaaaaaaac tgtggtattaccctttcagcaaggcaaaatatttgcaagtggtacatgtt aaataccattgtaaaatcagatctaataccaaatgtgcagtggagtgaaa aaatacaatgtacttggcaaacaagcagagaaactaaggaaaacatcttt actgaccttatgaactctatgaattaagcagctccaggagcacaacctac ctgctaagtaagccttgtggtgccctgctaggtaggtcgaggagttggcc agaagggcgggcagcaaggagagttaggagaaggaaggattgaattgcca gactgacctggaaagaaggcgtgaaagggtagcatttgggtcaggaggga aggcttttggttgtgggaagttgaagtgaattataaagatgggggccatt tatatcaggtaggtctggattctttgccctgtaccagggaccaggctaac tgaccaacaccacacagcgaggaacaggtaactgtccccatagggtttag tgcaaaaatgtggatgtattaaaaatacaaataatttgtaatctactact caactcttagacccaaagaattgactccatttaaaaaatagatgaagttg ggcatgggggcacacagctgccatcttagaatttgggaggtggaaataga aactttaggagttcaaaaccagcctcacctacacactgacttctaaggca gctgcctgggactcaaaagccaaaaaggtgtgtgtgtattatcttctccc acaaaactaggaacatgtgggtaattatgaatttcataattgatgagttt tttccacgtttatagtatttcagcatagtaaacatgtacaataaatttaa atgcccccattgataaataccttccctcaaacacatatgtacttactact tgctaataattcactctagttatagc
quality values	Open. Hide. 58 36 30 34 58 54 58 58 58 49 58 58 62 62 62 62 62 62 62 62 62 62 62 47 47 62 54 54 49 51 56 62 56 47 31 32 38 27 46 51 62 62 62 59 59 49 62 62 62 62 62 62 47 62 62 59 59 59 62 59 59 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 49 54 54 58 58 54 58 58 58 58 58 54 58 58 54 52 58 58 58 58 54 54 52 58 58 58 54 54 54 54 58 58 58 58 58 58 58 51 58 58 58 58 58 54 58 58 54 54 42 54 58 54 54 54 58 58 54 41 54 52 58 54 54 58 42 52 58 58 58 50 58 58 50 45 48 50 58 58 58 58 58 40 58 51 50 58 58 58 58 58 58 58 58 49 58 58 52 51 58 58 58 50 49 52 50 46 58 58 50 58 53 58 53 53 58 58 50 51 50 58 49 31 58 58 53 58 58 58 39 58 58 58 51 58 46 51 47 58 58 58 40 51 50 58 49 54 49 58 35 58 49 58 48 58 54 58 50 58 50 58 33 54 52 54 41 58 43 54 35 58 51 58 42 54 49 58 40 58 40 58 50 58 50 58 52 58 49 58 39 58 52 58 40 58 50 54 51 52 48 10 32 24 38 39 39 49 50 51 49 51 52 49 30 42 41 42 39 39 31 13 35 29 46 47 54 52 39 42 52 45 53 53 34 54 54 40 40 42 53 42 40 53 53 33 37 42 40 34 54 45 44 25 21 21 6 54 15 33 39 32 36 45 30 46 32 20 20 35 53 41 37 53 34 22 52 37 31 37 27 28 30 40 32 34 31 51 32 27 9 38 42 29 32 23 20 17 32 27 31 32 36 46 33 31 15 12 51 31 41 22 22 18 32 37 20 33 31 18 31 21 31 30 28 29 30 45 24 26 40 31 30 33 18 14 27 32 35 24 33 25 23 31 31 34 34 51 41 30 32 25 24 29 32 32 31 23 32 33 25 31 31 33 36 32 31 32 24 32 26 31 32 33 36 21 41 34 31 43 30 37 31 31 18 30 25 31 23 31 27 19 29 28 41 39 32 32 31 33 35 46 26 25 11 29 28 33 13 30 18 38 35 35 39 16 19 23 30 23 31 32 31 34 27 30 24 21 21 31 21 9 13 13 31 21 36 34 19 31 24 26 24 21 33 42 37 18 18 23 13 16 19 12 8 15 24 31 28 29 6 43 30 44 31 27 13 17 7 38 33 22 20 31 25 41 13 18 30 27 33 17 8 16 5 34 31 17 22 15 30 13 32 22 10 14 17 21 34 11 27 9 30 7 7 8 15 24 36 9 23 22 17 13 33 6 9 32 32 23 19 21 14 11 7 39 33 34 9 20 8 5 21 32 17 10 5 6 6 19 7 28 8 28 24 13 28 5 3 5 32 9 15 10 29 29 7	Open. Hide. 62 59 59 44 62 62 62 62 59 43 62 62 62 62 33 48 56 56 62 56 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 54 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 54 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 45 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 54 46 58 54 41 46 46 58 58 42 58 54 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 52 54 58 58 58 58 54 58 58 58 54 45 58 54 54 54 58 58 58 42 42 58 58 58 58 58 41 58 52 58 58 58 54 54 52 58 54 54 45 58 51 53 46 58 50 51 58 58 58 45 49 58 53 58 58 54 58 50 58 58 58 58 49 42 46 48 52 42 58 58 26 28 44 46 51 58 53 58 53 54 44 58 58 51 43 41 49 54 54 50 58 58 52 58 52 58 51 54 54 58 47 51 58 58 46 40 41 39 58 52 52 41 39 58 58 51 50 41 44 44 33 51 53 49 58 51 39 58 40 41 52 58 44 43 42 49 41 49 44 50 54 49 54 40 38 28 51 49 52 42 37 37 54 54 54 51 42 41 49 42 54 49 52 49 49 50 54 54 51 45 41 39 47 52 52 41 34 36 52 53 54 34 22 53 53 54 51 49 40 40 37 34 25 28 35 37 54 47 22 36 34 32 54 41 47 39 47 42 51 27 49 54 40 28 53 53 52 51 45 45 39 37 39 31 32 51 32 31 40 38 41 51 52 32 31 32 45 49 49 51 53 37 32 34 32 41 30 31 45 31 31 27 18 25 36 37 31 31 30 24 51 30 30 51 34 45 46 31 42 30 46 23 43 31 31 51 31 30 29 31 41 46 33 31 31 48 36 25 7 24 43 20 35 22 29 31 48 42 31 30 26 20 31 31 46 31 31 27 26 31 36 32 30 25 35 31 31 26 30 27 30 31 41 27 21 27 27 27 27 14 31 31 34 31 30 24 31 32 31 44 30 17 13 32 35 27 46 46 37 30 22 24 22 41 44 41 24 15 16 18 36 27 38 29 36 26 35 28 31 31 31 30 30 30 35 21 16 30 26 38 22 23 29 25 44 44 32 25 38 27 12 24 8 33 30 23 29 32 18 16 43 17 20 32 22 26 30 25 32 21 29 30 18 39 37 22 21 22 16 25 17 10 34 32 21 27 16 31 15 37 37 39 43 21 29 24 11 5 9 8 28 5 34 8 17 22 14 27 16 34 20 11 19 14 25 16 16 19 8 28 25 40 11 9 13 21 19 10 7 34 8 11 15 8 34 21 19 34 21 10 19 13 12 22 14 27 28 21 27 14 16 30 7 9 9 18 21 28 6 10 23 7 3 4 16 29 12 12 13 3 17 18 10 5 8 5 12 22 4 19 9 16 12 16 17 9 20 10 15 18 12 10 23 20 12 22 23 14 14 24 6 8 6 5 4 6 10 9 10 3 5 6 7 4 12 16 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_68682647_68683720
seq2: B6Ng01-310K22.b_43_1122 (reverse)

seq1  TTTTTTTTTATCGG-AATCT-CAAATTTTAAAACAAGT-AATAACATCCA  47
      |||||||||||||| ||||| |||| || ||||||||| |||||||||| 
seq2  TTTTTTTTTATCGGAAATCTCCAAAATTAAAAACAAGTAAATAACATCCC  50

seq1  TTGTAAGAAGAG-ATTGCTCCCCTTCAACTCAAATCC-AAGTG-AAAACA  94
       ||||||||||| |||||||||| ||||||||||||| ||||| ||||||
seq2  ATGTAAGAAGAGAATTGCTCCCC-TCAACTCAAATCCAAAGTGAAAAACA  99

seq1  TGCTGTAACCACCCTGGCTACCATCCTAGGATGAGTGCACATACCATCGC  144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTAACCACCCTGGCTACCATCCTAGGATGAGTGCACATACCATCGC  149

seq1  TTCCTCCCAACAAAACACATGTTACAAAGAACACAGCACAACACAGCAGA  194
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCCCAACAAAACACATGTTACAAAGAACACAGCACAACACAGCAGA  199

seq1  GCACTGGCAGGGAGATGTCTACTTGGTGGTGGCACATGCTTCTAGTCTCG  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGGCAGGGAGATGTCTACTTGGTGGTGGCACATGCTTCTAGTCTCG  249

seq1  GCATTTGAGAGCCAGAGGCAGGCAGATCTCTGTGAGTTCAAGCCTAACC-  293
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GCATTTGAGAGCCAGAGGCAGGCAGATCTCTGTGAGTTCAAGCCTAACCT  299

seq1  TTGTCTACATAGACAATTCCAGGGCAGATAGCCAGGGCCGCATAGAGAGG  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCTACATAGACAATTCCAGGGCAGATAGCCAGGGCCGCATAGAGAGG  349

seq1  GCTTGTCTCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGTCTCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA  399

seq1  GATAGATAGATAGATAAAAATATACAGACAGACATGGATACATAGATACG  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGATAGATAGATAAAAATATACAGACAGACATGGATACATAGATACG  449

seq1  TTGATAAAACAAACAAACAAGTGCCGGGCATGGTGGCTCATGCCTTTAAT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATAAAACAAACAAACAAGTGCCGGGCATGGTGGCTCATGCCTTTAAT  499

seq1  CCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGC  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGC  549

seq1  CTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACTC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACTC  599

seq1  TCGAAAAACCAAACAAACAAACAAACAAAAGATGTCCACACGCATATACT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAAAAACCAAACAAACAAACAAACAAAAGATGTCCACACGCATATACT  649

seq1  ATTACAAGCCTAAAAGCATGTGCAAGGGTGGTAGCCATGCAACAGACAGA  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACAAGCCTAAAAGCATGTGCAAGGGTGGTAGCCATGCAACAGACAGA  699

seq1  GGAACCTGAAGGCCAGAAGCTAGCCAAAGCAAGAGTGCTGTGCCTCTGAA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACCTGAAGGCCAGAAGCTAGCCAAAGCAAGAGTGCTGTGCCTCTGAA  749

seq1  CTCCAGAAAGGCTCCTGGGATAGAGGTTCTATCTGCTTCAGCAACCATAT  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGAAAGGCTCCTGGGATAGAGGTTCTATCTGCTTCAGCAACCATAT  799

seq1  GGCATGGGCTAAAGAGAAGACGATGTGTTGAAGGTGGTACATTCACAGAA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGGGCTAAAGAGAAGACGATGTGTTGAAGGTGGTACATTCACAGAA  849

seq1  CATTTAGACGCAGACCTCACAGTCCAGGGAGTAGGCAAACCAAAGCATTG  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTAGACGCAGACCTCACAGTCCAGGGAGTAGGCAAACCAAAGCATTG  899

seq1  CCTCACCCCAGCCCAGCAGGAGAAGGAGAGAAGAACTGGAAAGAGCAGCT  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACCCCAGCCCAGCAGGAGAAGGAGAGAAGAACTGGAAAGAGCAGCT  949

seq1  AAGTCACTTCACCATAAAGAGAAAGGGGGCCTGAGGAGAAAGGACTCCTC  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCACTTCACCATAAAGAGAAAGGGGGCCTGAGGAGAAAGGACTCCTC  999

seq1  CAAGTCCAGGATGTCTCACCCTCCTCCCTGGGAAGCCTCAGTATGTTGAC  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTCCAGGATGTCTCACCCTCCTCCCTGGGAAGCCTCAGTATGTTGAC  1049

seq1  AACCTCCTCCAGGCAGCAGGACCGAGAATTC  1074
      |||||||||||||||||||||||||||||||
seq2  AACCTCCTCCAGGCAGCAGGACCGAGAATTC  1080

seq1: chr11_68508332_68509422
seq2: B6Ng01-310K22.g_67_1142

seq1  GAATTCTTCATTTGTAAAACAGAGTTATTAATGGAAGCTATCTTGTGCCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCATTTGTAAAACAGAGTTATTAATGGAAGCTATCTTGTGCCC  50

seq1  CTCTTGTGCAGATTAAGACCTTGATATACATGCATATATATAGAACAGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGTGCAGATTAAGACCTTGATATACATGCATATATATAGAACAGTT  100

seq1  TCTGGATGTAATTAGGGATGTATAACAAGATTATTTGTTTTAAAAAAAAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGATGTAATTAGGGATGTATAACAAGATTATTTGTTTTAAAAAAAAC  150

seq1  TGTGGTATTACCCTTTCAGCAAGGCAAAATATTTGCAAGTGGTACATGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTATTACCCTTTCAGCAAGGCAAAATATTTGCAAGTGGTACATGTT  200

seq1  AAATACCATTGTAAAATCAGATCTAATACCAAATGTGCAGTGGAGTGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACCATTGTAAAATCAGATCTAATACCAAATGTGCAGTGGAGTGAAA  250

seq1  AAATACAATGTACTTGGCAAACAAGCAGAGAAACTAAGGAAAACATCTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACAATGTACTTGGCAAACAAGCAGAGAAACTAAGGAAAACATCTTT  300

seq1  ACTGACCTTATGAACTCTATGAATTAAGCAGCTCCAGGAGCACAACCTAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACCTTATGAACTCTATGAATTAAGCAGCTCCAGGAGCACAACCTAC  350

seq1  CTGCTAAGTAAGCCTTGTGGTGCCCTGCTAGGTAGGTCGAGGAGTTGGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTAAGTAAGCCTTGTGGTGCCCTGCTAGGTAGGTCGAGGAGTTGGCC  400

seq1  AGAAGGGCGGGCAGCAAGGAGAGTTAGGAGAAGGAAGGATTGAATTGCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGGGCGGGCAGCAAGGAGAGTTAGGAGAAGGAAGGATTGAATTGCCA  450

seq1  GACTGACCTGGAAAGAAGGCGTGAAAGGGTAGCATTTGGGTCAGGAGGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGACCTGGAAAGAAGGCGTGAAAGGGTAGCATTTGGGTCAGGAGGGA  500

seq1  AGGCTTTTGGTTGTGGGAAGTTGAAGTGAATTATAAAGATGGGGGCCATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTTTTGGTTGTGGGAAGTTGAAGTGAATTATAAAGATGGGGGCCATT  550

seq1  TATATCAGGTAGGTCTGGATTCTTTGCCCTGTACCAGGGACCAGGCTAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATCAGGTAGGTCTGGATTCTTTGCCCTGTACCAGGGACCAGGCTAAC  600

seq1  TGACCAACACCACACAGCGAGGAACAGGTAACTGTCCCCATAGGGTTTAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCAACACCACACAGCGAGGAACAGGTAACTGTCCCCATAGGGTTTAG  650

seq1  TGCAAAAATGTGGATGTATTAAAAATACAAATAATTTGTAATCTACTACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAAAATGTGGATGTATTAAAAATACAAATAATTTGTAATCTACTACT  700

seq1  CAACTCTTAGACCCAAAGAATTGACTCCATTTAAAAAATAGATGAAGTTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTCTTAGACCCAAAGAATTGACTCCATTTAAAAAATAGATGAAGTTG  750

seq1  GGCATGGGGGCACACAGCTGCCATCTTAGAATTTGGGAGGTGGAAATAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGGGGGCACACAGCTGCCATCTTAGAATTTGGGAGGTGGAAATAGA  800

seq1  AACTTTAGGAGTTCAAAACCAGCCTCACCTACACACTGACTTCTAAGGCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTAGGAGTTCAAAACCAGCCTCACCTACACACTGACTTCTAAGGCA  850

seq1  GCTGCCTGGGACTCAAAAGCCAAAAAGGTGTGTGTGTATTATCTTTCTCC  900
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GCTGCCTGGGACTCAAAAGCCAAAAAGGTGTGTGTGTATTATC-TTCTCC  899

seq1  CACAAAACTAGGAACATGT-GGTAATTATGAAATTTCATAATTGATGAGG  949
      ||||||||||||||||||| |||||||||| ||||||||||||||||| |
seq2  CACAAAACTAGGAACATGTGGGTAATTATG-AATTTCATAATTGATGA-G  947

seq1  TTTTTTCCACGTTAATAGTATTTCAGCATAGTAAACATGTACCAATAAAT  999
      ||||||||||||| ||||||||||||||||||||||||||| ||||||| 
seq2  TTTTTTCCACGTTTATAGTATTTCAGCATAGTAAACATGTA-CAATAAA-  995

seq1  TTTAAATGCCCCCATTTGATAAAATACCCTTCCCTCCAAAACACCATAAT  1049
      |||||||||||||| ||||| ||||| |||||||||  ||||| ||| ||
seq2  TTTAAATGCCCCCA-TTGAT-AAATA-CCTTCCCTC--AAACA-CAT-AT  1038

seq1  GTACTTTACCTACTTGCTAAATAAATCACTCTAGTTTATAGC  1091
      ||||||   ||||||||| ||||| ||||||||| |||||||
seq2  GTACTT--ACTACTTGCT-AATAATTCACTCTAG-TTATAGC  1076

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information