MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-319M12
Chromosome	11 (Build37)
Map Location	120,050,411 - 120,051,231
singlet/doublet	singlet
Overlap gene	LOC100043384
Upstream gene	Tbc1d16, Ccdc40, Gaa, Eif4a3, Card14, Sgsh, Slc26a11, LOC672511, Rnf213, A730011L01Rik, Nptx1, 4932417H02Rik, Chmp6, Baiap2, Aatk, Azi1, 2410002I01Rik, 1810043H04Rik, 1810073N04Rik, 2810410L24Rik, LOC100042332
Downstream gene	LOC100043389, Bahcc1, Actg1, Fscn2, 2310003H01Rik, Nploc4, Tspan10, Pde6g, 1810049H13Rik, 3110023B02Rik, 2600005N12Rik, Hgs, Mrpl12, Slc25a10, LOC667716, Gcgr, BC003940, Dysfip1, P4hb, Arhgdia, LOC100042371, Thoc4, Anapc11, Npb, Pcyt2, Sirt7, Mafg, Pycr1, 1110012N22Rik, 5730593N15Rik, Aspscr1, Stra13, Lrrc45, Rac3, Dcxr, Cbr2, Hmga1-rs1, LOC667778, Rfng, Gps1, Dus1l, Fasn, Ccdc57, LOC100043454, Slc16a3, Csnk1d, Cd7, Sectm1b, Sectm1a, LOC637008, 4921530G04Rik, Tex19, Uts2r, 1110031I02Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tbc1d16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207592 MGI:2652878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207607 MGI:2443893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gaa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14387 MGI:95609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192170 MGI:1923731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170720 MGI:2386258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgsh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27029 MGI:1350341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268512 MGI:2444589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Rnf213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629974 MGI:1289196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730011L01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338371 MGI:2444688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nptx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18164 MGI:107811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932417H02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74370 MGI:1921620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208092 MGI:3583942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 196 ESTs, 4 Proteins

name	Baiap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108100 MGI:2137336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Aatk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11302 MGI:1197518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Azi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12009 MGI:107440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410002I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78777 MGI:1926027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810043H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208501 MGI:1913676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs

name	1810073N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72055 MGI:1919305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810410L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76377 MGI:1923627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC100042332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC100043384 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs

name	LOC100043389 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs

name	Bahcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268515 MGI:2679272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11465 MGI:87906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fscn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238021 MGI:2443337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310003H01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71885 MGI:1919135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nploc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217365 MGI:2679787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208634 MGI:2384781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde6g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18588 MGI:97526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810049H13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66431 MGI:1913681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110023B02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67291 MGI:1914541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2600005N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70317 MGI:1917567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15239 MGI:104681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56282 MGI:1926273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27376 MGI:1353497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gcgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14527 MGI:99572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC003940 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192173 MGI:2384752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dysfip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68701 MGI:1915951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P4hb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18453 MGI:97464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgdia (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192662 MGI:2178103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Thoc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21681 MGI:1341044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anapc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66156 MGI:1913406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Npb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208990 MGI:2387153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcyt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68671 MGI:1915921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209011 MGI:2385849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mafg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17134 MGI:96911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pycr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209027 MGI:2384795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110012N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68515 MGI:1915765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs, 5 Proteins

name	5730593N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77583 MGI:1924833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aspscr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68938 MGI:1916188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stra13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20892 MGI:894324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217366 MGI:2387183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170758 MGI:2180784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcxr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67880 MGI:1915130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12409 MGI:107200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmga1-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111241 MGI:96161
definition	gene_synonym : Hmgi-rs1 note : high mobility group AT-hook I, related sequence 1 pseudo : _no_value

name	LOC667778 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667778
definition	note : NADPH-dependent carbonyl reductase pseudogene pseudo : _no_value

name	Rfng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19719 MGI:894275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209318 MGI:2384801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dus1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68730 MGI:1915980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fasn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14104 MGI:95485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71276 MGI:1918526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs

name	Slc16a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80879 MGI:1933438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Csnk1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104318 MGI:1355272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12516 MGI:88344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sectm1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58210 MGI:1929083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sectm1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209588 MGI:2384805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637008 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 398 ESTs, 6 Proteins pseudo : _no_value

name	4921530G04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70956 MGI:1918206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73679 MGI:1920929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uts2r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217369 MGI:2183450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110031I02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66179 MGI:1913429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347142 GeneID:207592 MGI:2652878
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 16 transcript_id : NM_172443.2

name	Ccdc40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803137 GeneID:207607 MGI:2443893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 40 transcript_id : NM_175430.3

name	Gaa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982354 GeneID:14387 MGI:95609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, alpha, acid transcript_id : NM_008064.2

name	Eif4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149755 GeneID:192170 MGI:1923731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A, isoform 3 transcript_id : NM_138669.1

name	Card14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131044 GeneID:170720 MGI:2386258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase recruitment domain family, member 14 transcript_id : NM_130886.3

name	Sgsh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270982 GeneID:27029 MGI:1350341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-sulfoglucosamine sulfohydrolase (sulfamidase) transcript_id : NM_018822.3

name	Slc26a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85540462 GeneID:268512 MGI:2444589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 11 transcript_id : NM_178743.3

name	LOC672511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262525 GeneID:672511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical LOC672511 transcript_id : XM_001477846.1

name	Rnf213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375267 GeneID:629974 MGI:1289196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 213 transcript_id : NM_001040005.2

name	A730011L01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254316 GeneID:338371 MGI:2444688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730011L01 gene transcript_id : NM_177394.2

name	Nptx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672925 GeneID:18164 MGI:107811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin 1 transcript_id : NM_008730.2

name	4932417H02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061324 GeneID:74370 MGI:1921620
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932417H02 gene transcript_id : NM_028898.1

name	Chmp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94391054 GeneID:208092 MGI:3583942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 196 ESTs, 4 Proteins product : chromatin modifying protein 6, transcript variant 1 transcript_id : XM_126613.6

name	Baiap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369752 GeneID:108100 MGI:2137336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1-associated protein 2 transcript_id : NM_001037755.2

name	Baiap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351289 GeneID:108100 MGI:2137336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1-associated protein 2 transcript_id : NM_130862.3

name	Baiap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802566 GeneID:108100 MGI:2137336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1-associated protein 2 transcript_id : NM_001037754.2

name	Aatk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130971 GeneID:11302 MGI:1197518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-associated tyrosine kinase transcript_id : NM_007377.3

name	Azi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753153 GeneID:12009 MGI:107440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-azacytidine induced gene 1 transcript_id : NM_009734.1

name	2410002I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130816 GeneID:78777 MGI:1926027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410002I01 gene transcript_id : NM_183137.2

name	1810043H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262528 GeneID:208501 MGI:1913676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs product : RIKEN cDNA 1810043H04 gene, transcript variant 2 transcript_id : XM_903145.3

name	1810073N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384420 GeneID:72055 MGI:1919305
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810073N04 gene transcript_id : NM_024249.4

name	LOC100042332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262529 GeneID:100042332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100042332 transcript_id : XM_001477964.1

name	LOC100043384 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262575 GeneID:100043384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs product : hypothetical protein LOC100043384 transcript_id : XM_001480749.1

name	LOC100043389 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262577 GeneID:100043389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs product : hypothetical protein LOC100043389 transcript_id : XM_001480755.1

name	Bahcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274629 GeneID:268515 MGI:2679272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BAH domain and coiled-coil containing 1 transcript_id : NM_198423.2

name	Actg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48762677 GeneID:11465 MGI:87906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, gamma, cytoplasmic 1 transcript_id : NM_009609.2

name	Fscn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366463 GeneID:238021 MGI:2443337
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) transcript_id : NM_172802.2

name	2310003H01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73476380 GeneID:71885 MGI:1919135
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310003H01 gene transcript_id : NM_027980.1

name	Nploc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054973 GeneID:217365 MGI:2679787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear protein localization 4 homolog (S. cerevisiae) transcript_id : NM_199469.1

name	Tspan10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703723 GeneID:208634 MGI:2384781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 10 transcript_id : NM_145363.1

name	Pde6g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982123 GeneID:18588 MGI:97526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 6G, cGMP-specific, rod, gamma transcript_id : NM_012065.2

name	1810049H13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352675 GeneID:66431 MGI:1913681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810049H13 gene transcript_id : NM_025560.2

name	3110023B02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350048 GeneID:67291 MGI:1914541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110023B02 gene transcript_id : NM_152807.2

name	2600005N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91199553 GeneID:70317 MGI:1917567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2600005N12 gene transcript_id : NM_197995.2

name	Hgs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982285 GeneID:15239 MGI:104681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HGF-regulated tyrosine kinase substrate transcript_id : NM_008244.2

name	Mrpl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164791 GeneID:56282 MGI:1926273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L12 transcript_id : NM_027204.2

name	Slc25a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305500 GeneID:27376 MGI:1353497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 transcript_id : NM_013770.1

name	LOC667716 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94391011 GeneID:667716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC667716 transcript_id : XM_992013.1

name	Gcgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679964 GeneID:14527 MGI:99572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucagon receptor transcript_id : NM_008101.1

name	BC003940 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378020 GeneID:192173 MGI:2384752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC003940 transcript_id : NM_001033231.2

name	Dysfip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377209 GeneID:68701 MGI:1915951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin interacting protein 1 transcript_id : NM_026814.3

name	P4hb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130201 GeneID:18453 MGI:97464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolyl 4-hydroxylase, beta polypeptide transcript_id : NM_011032.2

name	Arhgdia (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387650 GeneID:192662 MGI:2178103
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GDP dissociation inhibitor (GDI) alpha transcript_id : NM_133796.6

name	LOC100042371 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262531 GeneID:100042371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042371 transcript_id : XM_001478063.1

name	Thoc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755762 GeneID:21681 MGI:1341044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THO complex 4 transcript_id : NM_011568.1

name	Anapc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84039699 GeneID:66156 MGI:1913406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 11 homolog (yeast) transcript_id : NM_025389.3

name	Anapc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84039695 GeneID:66156 MGI:1913406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 11 homolog (yeast) transcript_id : NM_001038230.1

name	Npb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358993 GeneID:208990 MGI:2387153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuropeptide B transcript_id : NM_153288.3

name	Pcyt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980841 GeneID:68671 MGI:1915921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 2, ethanolamine transcript_id : NM_024229.2

name	Sirt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346442 GeneID:209011 MGI:2385849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 7 (silent mating type information regulation 2, homolog) 7 (S. cerevisiae) transcript_id : NM_153056.1

name	Mafg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328461 GeneID:17134 MGI:96911
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) transcript_id : NM_010756.3

name	Pycr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352287 GeneID:209027 MGI:2384795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrroline-5-carboxylate reductase 1 transcript_id : NM_144795.3

name	1110012N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94391058 GeneID:68515 MGI:1915765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs, 5 Proteins product : RIKEN cDNA 1110012N22 gene, transcript variant 1 transcript_id : XM_126634.6

name	5730593N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125858487 GeneID:77583 MGI:1924833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730593N15 gene transcript_id : NM_175263.3

name	Aspscr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794437 GeneID:68938 MGI:1916188
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alveolar soft part sarcoma chromosome region, candidate 1 (human) transcript_id : NM_026877.1

name	Aspscr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016199 GeneID:68938 MGI:1916188
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alveolar soft part sarcoma chromosome region, candidate 1 (human) transcript_id : NM_198223.1

name	Stra13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12025529 GeneID:20892 MGI:894324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stimulated by retinoic acid 13 transcript_id : NM_016665.1

name	Lrrc45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956319 GeneID:217366 MGI:2387183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 45 transcript_id : NM_153545.1

name	Rac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374409 GeneID:170758 MGI:2180784
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-related C3 botulinum substrate 3 transcript_id : NM_133223.3

name	Dcxr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385923 GeneID:67880 MGI:1915130
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dicarbonyl L-xylulose reductase transcript_id : NM_026428.1

name	Cbr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671687 GeneID:12409 MGI:107200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonyl reductase 2 transcript_id : NM_007621.1

name	Rfng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54262150 GeneID:19719 MGI:894275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : radical fringe gene homolog (Drosophila) transcript_id : NM_009053.2

name	Gps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703741 GeneID:209318 MGI:2384801
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein pathway suppressor 1 transcript_id : NM_145370.1

name	Dus1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360148 GeneID:68730 MGI:1915980
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydrouridine synthase 1-like (S. cerevisiae) transcript_id : NM_026824.3

name	Fasn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102408 GeneID:14104 MGI:95485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid synthase transcript_id : NM_007988.3

name	Ccdc57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037236 GeneID:71276 MGI:1918526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 57 transcript_id : NM_027745.1

name	LOC100043454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262579 GeneID:100043454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs product : hypothetical protein LOC100043454 transcript_id : XM_001480863.1

name	Slc16a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579883 GeneID:80879 MGI:1933438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 3 transcript_id : NM_030696.3

name	Slc16a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579884 GeneID:80879 MGI:1933438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 3 transcript_id : NM_001038653.1

name	Slc16a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84697027 GeneID:80879 MGI:1933438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 3 transcript_id : NM_001038654.1

name	Csnk1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76496489 GeneID:104318 MGI:1355272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, delta transcript_id : NM_139059.2

name	Csnk1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76496488 GeneID:104318 MGI:1355272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, delta transcript_id : NM_027874.2

name	Cd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6806904 GeneID:12516 MGI:88344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD7 antigen transcript_id : NM_009854.1

name	Sectm1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145547 GeneID:58210 MGI:1929083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted and transmembrane 1B transcript_id : NM_026907.3

name	Sectm1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205432 GeneID:209588 MGI:2384805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted and transmembrane 1A transcript_id : NM_145373.2

name	4921530G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352532 GeneID:70956 MGI:1918206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921530G04 gene transcript_id : NM_027622.2

name	Tex19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077022 GeneID:73679 MGI:1920929
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 19 transcript_id : NM_028602.2

name	Uts2r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703877 GeneID:217369 MGI:2183450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urotensin 2 receptor transcript_id : NM_145440.1

name	1110031I02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349173 GeneID:66179 MGI:1913429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110031I02 gene transcript_id : NM_025402.2

name	Tbc1d16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369589 CCDS:CCDS25711.1 GeneID:207592 MGI:2652878
definition	codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 16 protein_id : NP_766031.1

name	Ccdc40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425148 CCDS:CCDS25712.1 GeneID:207607 MGI:2443893
definition	codon_start : 1 product : coiled-coil domain containing 40 protein_id : NP_780639.1

name	Gaa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982355 CCDS:CCDS25713.1 GeneID:14387 MGI:95609
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IDA] [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005980 - glycogen catabolism [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acid alpha-glucosidase protein_id : NP_032090.2

name	Eif4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149756 CCDS:CCDS25714.1 GeneID:192170 MGI:1923731
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 protein_id : NP_619610.1

name	Card14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700028 CCDS:CCDS25715.1 GeneID:170720 MGI:2386258
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : caspase recruitment domain family, member 14 protein_id : NP_570956.1

name	Sgsh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543697 GeneID:27029 MGI:1350341
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016250 - N-sulfoglucosamine sulfohydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0030201 - heparan sulfate proteoglycan metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : sulphamidase product : N-sulfoglucosamine sulfohydrolase (sulfamidase) protein_id : NP_061292.2

name	Slc26a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85540463 CCDS:CCDS25717.1 GeneID:268512 MGI:2444589
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel sulfate transporter protein (Slc26a11) product : anion exchanger Slc26a11 protein_id : NP_848858.2

name	LOC672511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262526 GeneID:672511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477896.1

name	Rnf213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90855774 GeneID:629974 MGI:1289196
definition	codon_start : 1 product : ring finger protein 213 protein_id : NP_001035094.1

name	A730011L01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893575 CCDS:CCDS25718.1 GeneID:338371 MGI:2444688
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 product : hypothetical protein LOC338371 protein_id : NP_796368.1

name	Nptx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679120 CCDS:CCDS25719.1 GeneID:18164 MGI:107811
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : neuronal pentraxin 1 protein_id : NP_032756.1

name	4932417H02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061325 CCDS:CCDS25720.1 GeneID:74370 MGI:1921620
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : raptor protein_id : NP_083174.1

name	Chmp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935435 GeneID:208092 MGI:3583942
definition	codon_start : 1 product : similar to Charged multivesicular body protein 6 (Chromatin-modifying protein 6) isoform 1 protein_id : XP_126613.3

name	Baiap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649707 CCDS:CCDS25722.1 GeneID:108100 MGI:2137336
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007266 - Rho protein signal transduction [Evidence TAS] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; insulin receptor substrate p53 product : brain-specific angiogenesis inhibitor 1-associated protein 2 isoform a protein_id : NP_001032844.1

name	Baiap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83642836 CCDS:CCDS25724.1 GeneID:108100 MGI:2137336
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007266 - Rho protein signal transduction [Evidence TAS] codon_start : 1 note : isoform b is encoded by transcript variant 2; insulin receptor substrate p53 product : brain-specific angiogenesis inhibitor 1-associated protein 2 isoform b protein_id : NP_570932.2

name	Baiap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649713 CCDS:CCDS25723.1 GeneID:108100 MGI:2137336
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007266 - Rho protein signal transduction [Evidence TAS] codon_start : 1 note : isoform c is encoded by transcript variant 3; insulin receptor substrate p53 product : brain-specific angiogenesis inhibitor 1-associated protein 2 isoform c protein_id : NP_001032843.1

name	Aatk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345411 CCDS:CCDS25725.1 GeneID:11302 MGI:1197518
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] codon_start : 1 product : apoptosis-associated tyrosine kinase protein_id : NP_031403.2

name	Azi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753154 GeneID:12009 MGI:107440
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence TAS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pre-acrosome localization protein 1 protein_id : NP_033864.1

name	2410002I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130817 GeneID:78777 MGI:1926027
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC78777 protein_id : NP_898960.2

name	1810043H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935441 GeneID:208501 MGI:1913676
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_908238.1

name	1810073N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541852 CCDS:CCDS25728.1 GeneID:72055 MGI:1919305
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72055 protein_id : NP_077211.3

name	LOC100042332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262530 GeneID:100042332
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478014.1

name	LOC100043384 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262576 GeneID:100043384
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480799.1

name	LOC100043389 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262578 GeneID:100043389
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480805.1

name	Bahcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49274630 GeneID:268515 MGI:2679272
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : BAH domain and coiled-coil containing 1 protein_id : NP_940815.2

name	Actg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752954 CCDS:CCDS25730.1 GeneID:11465 MGI:87906
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005884 - actin filament [Evidence IEA]; GO:0043034 - costamere [Evidence TAS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045214 - sarcomere organization [Evidence IDA] codon_start : 1 note : beta-actin FE-3 product : actin, gamma, cytoplasmic 1 protein_id : NP_033739.1

name	Fscn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370192 CCDS:CCDS25731.1 GeneID:238021 MGI:2443337
definition	GO_function : GO:0051015 - actin filament binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence IEA] codon_start : 1 exception : mismatches in translation product : fascin homolog 2, actin-bundling protein, retinal protein_id : NP_766390.1

name	2310003H01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73476381 GeneID:71885 MGI:1919135
definition	codon_start : 1 product : hypothetical protein LOC71885 protein_id : NP_082256.1

name	Nploc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054974 CCDS:CCDS25732.1 GeneID:217365 MGI:2679787
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0042175 - nuclear envelope-endoplasmic reticulum network [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0007030 - Golgi organization and biogenesis [Evidence ISS]; GO:0006944 - membrane fusion [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : novel protein containing zf-NPL4 and NPL4 domains product : nuclear protein localization 4 protein_id : NP_955763.1

name	Tspan10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703724 CCDS:CCDS25733.1 GeneID:208634 MGI:2384781
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : oculospanin product : tetraspanin 10 protein_id : NP_663338.1

name	Pde6g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549783 GeneID:18588 MGI:97526
definition	GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0030553 - cGMP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0045742 - positive regulation of epidermal growth factor receptor signaling pathway [Evidence IDA]; GO:0045745 - positive regulation of G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : cGMP phosphodiesterase gamma product : phosphodiesterase 6G, cGMP-specific, rod, gamma protein_id : NP_036197.1

name	1810049H13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384992 CCDS:CCDS25735.1 GeneID:66431 MGI:1913681
definition	codon_start : 1 product : hypothetical protein LOC66431 protein_id : NP_079836.1

name	3110023B02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779893 CCDS:CCDS25736.1 GeneID:67291 MGI:1914541
definition	codon_start : 1 product : hypothetical protein LOC67291 protein_id : NP_690020.1

name	2600005N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91199554 GeneID:70317 MGI:1917567
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70317 protein_id : NP_932112.2

name	Hgs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982286 GeneID:15239 MGI:104681
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HGF-regulated tyrosine kinase substrate protein_id : NP_032270.2

name	Mrpl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164792 CCDS:CCDS25737.1 GeneID:56282 MGI:1926273
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005761 - mitochondrial ribosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L12 protein_id : NP_081480.2

name	Slc25a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305501 CCDS:CCDS25738.1 GeneID:27376 MGI:1353497
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0015290 - electrochemical potential-driven transporter activity [Evidence IDA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : involved in translocation of malonate, malate and succinate in exchange for phosphate, sulfate, sulfite or thiosulfate across mitochondrial inner membrane note : dicarboxylate ion carrier; solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 10 product : solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 protein_id : NP_038798.1

name	LOC667716 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94391012 GeneID:667716
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997107.1

name	Gcgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679965 CCDS:CCDS25739.1 GeneID:14527 MGI:99572
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glucagon receptor protein_id : NP_032127.1

name	BC003940 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701732 GeneID:192173 MGI:2384752
definition	codon_start : 1 product : hypothetical protein LOC192173 protein_id : NP_001028403.1

name	Dysfip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115749411 GeneID:68701 MGI:1915951
definition	codon_start : 1 note : ortholog of human dysferlin interacting protein 1 (toonin) DYSFP1 product : dysferlin interacting protein 1 protein_id : NP_081090.1

name	P4hb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42415475 CCDS:CCDS25742.1 GeneID:18453 MGI:97464
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004656 - procollagen-proline 4-dioxygenase activity [Evidence ISS]; GO:0003756 - protein disulfide isomerase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0018401 - peptidyl-proline hydroxylation to 4-hydroxy-L-proline [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : protein disulfide isomerase product : prolyl 4-hydroxylase, beta polypeptide protein_id : NP_035162.1

name	Arhgdia (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982030 CCDS:CCDS25743.1 GeneID:192662 MGI:2178103
definition	GO_component : GO:0001772 - immunological synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005094 - Rho GDP-dissociation inhibitor activity [Evidence IDA] GO_process : GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 note : Rho GDI alpha product : Rho GDP dissociation inhibitor (GDI) alpha protein_id : NP_598557.3

name	LOC100042371 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262532 GeneID:100042371
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478113.1

name	Thoc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755763 CCDS:CCDS25744.1 GeneID:21681 MGI:1341044
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IDA]; GO:0003697 - single-stranded DNA binding [Evidence IDA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 function : transcriptional coactivator note : Tcra enhancer-binding factor interacting protein 1; RNA and export factor binding protein 1 product : THO complex 4 protein_id : NP_035698.1

name	Anapc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84039696 CCDS:CCDS25745.1 GeneID:66156 MGI:1913406
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : anaphase promoting complex subunit 11 homolog protein_id : NP_001033319.1

name	Anapc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384770 CCDS:CCDS25745.1 GeneID:66156 MGI:1913406
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : anaphase promoting complex subunit 11 homolog protein_id : NP_079665.1

name	Npb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23463265 CCDS:CCDS25746.1 GeneID:208990 MGI:2387153
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0001664 - G-protein-coupled receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence ISS]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : preproneuropeptide B product : neuropeptide B protein_id : NP_695020.1

name	Pcyt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980842 CCDS:CCDS25747.1 GeneID:68671 MGI:1915921
definition	GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : phosphate cytidylyltransferase 2, ethanolamine protein_id : NP_077191.2

name	Sirt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346443 GeneID:209011 MGI:2385849
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : sirtuin 7 (silent mating type information regulation 2, homolog) 7 protein_id : NP_694696.1

name	Mafg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754610 CCDS:CCDS25748.1 GeneID:17134 MGI:96911
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IPI] [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030534 - adult behavior [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0045604 - regulation of epidermal cell differentiation [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : avian musculoaponeurotic fibrosarcoma virus (v-maf) AS42 oncogene, protein G product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G protein_id : NP_034886.1

name	Pycr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450149 CCDS:CCDS25749.1 GeneID:209027 MGI:2384795
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004735 - pyrroline-5-carboxylate reductase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 product : pyrroline-5-carboxylate reductase 1 protein_id : NP_659044.1

name	1110012N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82935449 GeneID:68515 MGI:1915765
definition	codon_start : 1 product : hypothetical protein LOC68515 isoform 1 protein_id : XP_126634.3

name	5730593N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125858488 GeneID:77583 MGI:1924833
definition	codon_start : 1 product : hypothetical protein LOC77583 protein_id : NP_780472.2

name	Aspscr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794438 CCDS:CCDS25751.1 GeneID:68938 MGI:1916188
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0019898 - extrinsic to membrane [Evidence IDA]; GO:0009898 - internal side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0000300 - peripheral to membrane of membrane fraction [Evidence IDA]; GO:0012506 - vesicle membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042593 - glucose homeostasis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0046324 - regulation of glucose import [Evidence IDA] codon_start : 1 note : long isoform is encoded by transcript variant 1; tether, containing a UBX domain, for GLUT4 product : alveolar soft part sarcoma chromosome region, candidate 1 long isoform protein_id : NP_081153.1

name	Aspscr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016200 CCDS:CCDS25752.1 GeneID:68938 MGI:1916188
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0019898 - extrinsic to membrane [Evidence IDA]; GO:0009898 - internal side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0000300 - peripheral to membrane of membrane fraction [Evidence IDA]; GO:0012506 - vesicle membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042593 - glucose homeostasis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0046324 - regulation of glucose import [Evidence IDA] codon_start : 1 note : short isoform is encoded by transcript variant 2; tether, containing a UBX domain, for GLUT4 product : alveolar soft part sarcoma chromosome region, candidate 1 short isoform protein_id : NP_937866.1

name	Stra13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025530 GeneID:20892 MGI:894324
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : stimulated by retinoic acid 13 protein_id : NP_057874.1

name	Lrrc45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956320 CCDS:CCDS25753.1 GeneID:217366 MGI:2387183
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine rich repeat containing 45 protein_id : NP_705773.1

name	Rac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875380 CCDS:CCDS25754.1 GeneID:170758 MGI:2180784
definition	GO_component : GO:0012505 - endomembrane system [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0030031 - cell projection biogenesis [Evidence ISS]; GO:0050905 - neuromuscular physiological process [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP] codon_start : 1 product : RAS-related C3 botulinum substrate 3 protein_id : NP_573486.1

name	Dcxr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385924 CCDS:CCDS25755.1 GeneID:67880 MGI:1915130
definition	GO_component : GO:0005903 - brush border [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005902 - microvillus [Evidence IDA] GO_function : GO:0050038 - L-xylulose reductase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016614 - oxidoreductase activity, acting on CH-OH group of donors [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0042732 - D-xylose metabolism [Evidence IEA]; GO:0006006 - glucose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006739 - NADP metabolism [Evidence IDA]; GO:0005997 - xylulose metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : diacetyl/L-xylulose reductase protein_id : NP_080704.1

name	Cbr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671688 CCDS:CCDS25756.1 GeneID:12409 MGI:107200
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004090 - carbonyl reductase (NADPH) activity [Evidence TAS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006116 - NADH oxidation [Evidence TAS] codon_start : 1 note : lung carbonyl reductase product : carbonyl reductase 2 protein_id : NP_031647.1

name	Rfng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677725 CCDS:CCDS25757.1 GeneID:19719 MGI:894275
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : radical fringe gene homolog protein_id : NP_033079.1

name	Gps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703742 CCDS:CCDS25758.1 GeneID:209318 MGI:2384801
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : G protein pathway suppressor 1 protein_id : NP_663345.1

name	Dus1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980834 GeneID:68730 MGI:1915980
definition	GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : PP3111 protein protein_id : NP_081100.2

name	Fasn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93102409 CCDS:CCDS25759.1 GeneID:14104 MGI:95485
definition	GO_component : GO:0042587 - glycogen granule [Evidence IDA] GO_function : GO:0004317 - 3-hydroxypalmitoyl-[acyl-carrier protein] dehydratase activity [Evidence IEA]; GO:0004316 - 3-oxoacyl-[acyl-carrier protein] reductase activity [Evidence IEA]; GO:0004315 - 3-oxoacyl-[acyl-carrier protein] synthase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0048037 - cofactor binding [Evidence IEA]; GO:0004319 - enoyl-[acyl-carrier protein] reductase (NADPH, B-specific) activity [Evidence IEA]; GO:0004312 - fatty-acid synthase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004320 - oleoyl-[acyl-carrier protein] hydrolase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0031177 - phosphopantetheine binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004313 - [acyl-carrier protein] S-acetyltransferase activity [Evidence IEA]; GO:0004314 - [acyl-carrier protein] S-malonyltransferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : fatty acid synthase protein_id : NP_032014.3

name	Ccdc57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037237 CCDS:CCDS25760.1 GeneID:71276 MGI:1918526
definition	codon_start : 1 product : coiled-coil domain containing 57 protein_id : NP_082021.1

name	LOC100043454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262580 GeneID:100043454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480913.1

name	Slc16a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579885 CCDS:CCDS25761.1 GeneID:80879 MGI:1933438
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015355 - monocarboxylate porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : monocarboxylate transporter 4 product : solute carrier family 16, member 3 protein_id : NP_001033742.1

name	Slc16a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84697028 CCDS:CCDS25761.1 GeneID:80879 MGI:1933438
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015355 - monocarboxylate porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : monocarboxylate transporter 4 product : solute carrier family 16, member 3 protein_id : NP_001033743.1

name	Slc16a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507630 CCDS:CCDS25761.1 GeneID:80879 MGI:1933438
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015355 - monocarboxylate porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : monocarboxylate transporter 4 product : solute carrier family 16, member 3 protein_id : NP_109621.1

name	Csnk1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20544149 CCDS:CCDS25762.1 GeneID:104318 MGI:1355272
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : casein kinase 1, delta isoform 1 protein_id : NP_620690.1

name	Csnk1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20544147 CCDS:CCDS25763.1 GeneID:104318 MGI:1355272
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : casein kinase 1, delta isoform 2 protein_id : NP_082150.1

name	Cd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6806905 CCDS:CCDS25764.1 GeneID:12516 MGI:88344
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : CD7 antigen protein_id : NP_033984.1

name	Sectm1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145548 CCDS:CCDS25765.1 GeneID:58210 MGI:1929083
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : secreted and transmembrane 1B protein_id : NP_081183.3

name	Sectm1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205433 CCDS:CCDS25766.1 GeneID:209588 MGI:2384805
definition	codon_start : 1 product : secreted and transmembrane 1A protein_id : NP_663348.2

name	4921530G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937371 CCDS:CCDS25767.1 GeneID:70956 MGI:1918206
definition	codon_start : 1 note : novel protein similar to testis expressed protein 19 Tex19 product : hypothetical protein LOC70956 protein_id : NP_081898.1

name	Tex19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077023 CCDS:CCDS25768.1 GeneID:73679 MGI:1920929
definition	codon_start : 1 product : hypothetical protein LOC73679 protein_id : NP_082878.2

name	Uts2r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703878 CCDS:CCDS25769.1 GeneID:217369 MGI:2183450
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0001604 - urotensin II receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : urotensin II receptor; G protein-coupled receptor 14 product : urotensin 2 receptor protein_id : NP_663415.1

name	1110031I02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384786 CCDS:CCDS25770.1 GeneID:66179 MGI:1913429
definition	codon_start : 1 product : hypothetical protein LOC66179 protein_id : NP_079678.1

name	2810410L24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262574 GeneID:76377 MGI:1923627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2810410L24 gene transcript_id : XR_035443.1

name	LOC637008 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262581 GeneID:637008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 398 ESTs, 6 Proteins product : similar to Hnrpf protein pseudo : _no_value transcript_id : XR_002079.2

clone name	MSMg01-534I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-505M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-156N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129P15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-319M12.b	B6Ng01-319M12.g
ACC	GA109327	GA109328
length	1,079	822
definition	B6Ng01-319M12.b	B6Ng01-319M12.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttcatctgcttcagagctactaagagctggctccccgagcccat ccagcgatgagcacaggctccttttcctagagacctccgctaattgatct ttcttcttttccctttttcctctttttcttctaatctctctccaggtatt cctacctaaccttaacttttcctcgggttcaagacccttggaaaggcctg tatacttattttgtgtaccatattttctctttgctcctactctctctccc cgctttacttctgatagattgccctgaatttcatctagaatccgccctgc cttaaccacttgataacatgtgaaaaggaacaaaagggcttctaacatta gaaaaaattcaaggccaaacattttccactttacttctgatagactgtct tgaatttccttagaaagttcaaggccaggcttacctcgtaaagctatact cactggtactctcgttccccagctgaaaagttctgaattcatgcagttga atccttctcaacagtctgtgttgtgggaacacttcataaccgtgacccgc agttctggttccggaatgagggatcttccttgcaccggtgatggtaaact ctcgtcccgagttttttctcgtcccggaattcggcaccaattcttattaa acgcgttctcacgcccggccaggaagaacacagcaaaccagaatcttctg cggcaaaactttattgcttacatcttcaggagcaagagtgtaagaagcaa gagagcgagaaaacgaaaccccgtccctcttaaggagaattatccttcgc ctaggacgtgtcactccctgattggctgcagcccatcggccgagttgacg tcacggggaaaggcagagcacatggagtggagaaccaccctcggcacatg cgcagattatttgtttaccacttagaacacagctgtcagcgccatcttgt aacggcgatgtggcgcggctcctaccagaggaacatgccaatgatgtata gtgcataaaccaatccagggtgtgagacgtgcctttgctaaggccttaat tagtcgacatcatatactgagactgcgag	gaattctaggtttccgggttgggggataactgtatgaaccacttcgaaac agagccatcttgctgtagtacccatggagtcctggatgaatttcgtgggc ctctgaagaaagtgacgcgcatttccacaggaactggctccaagcccgtc ttacgggtggtggagagcccagtagggattccagaatacagctcaggagg ctaccccgagttcggctaccgtcccaggacccctcagaaagacacgtttg gtgcgaaaatctcctacacaccagctgggtttttattccttccctcccca gagtgtgctctgggcgcgcgggaaacaaggaaaaagcacgtacctggcgg cgctctgagggcagcctcaccggccctccgtaggcaagggagctcccaga agctactccctatccggctggtcgaccctaggcctgtccctccatccctc cctccctacccggctggtcgacctccgccgagctaattctccaggaggca ggagcgggatacccggcccgcctttctggaaatgggatccgttttttagc gccagggcccgcgccaacgtccaggccaccgtcggcgcgcagggtttccc tagtcctttggatcagcagagagtggggcggcctggacgctgggctgcgg ctcgcgcaccagctccctgttcccgcgcgcccttctgcatccaggctccg gcgtgtccacgttcccaatcgcgaaaaggggacgaactctgagccctccg ggaagagaaggctgcagccgcagtccaggaaagagccctagggcgggagg ggtgcaggggcggaggggcggg
quality values	Open. Hide. 58 22 19 16 58 58 58 58 41 36 54 58 58 49 62 62 62 41 33 62 62 62 62 62 56 47 54 62 62 56 49 62 62 62 62 62 56 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 49 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 54 54 54 58 58 58 58 54 58 58 58 58 58 58 58 58 48 46 58 58 58 58 58 52 58 58 54 58 58 58 58 58 54 58 54 58 58 54 53 58 58 42 58 58 42 41 58 58 58 52 58 58 58 58 54 42 45 58 58 58 54 58 36 35 58 33 47 58 58 58 54 58 58 58 58 54 58 51 58 58 51 53 50 49 58 58 58 58 51 49 52 50 51 49 48 58 58 51 58 58 37 39 51 52 49 51 51 41 38 49 46 51 50 58 52 50 52 46 35 37 50 58 44 50 51 54 53 58 53 53 53 53 39 37 43 58 58 58 32 51 27 49 46 46 58 49 49 37 58 39 32 52 51 53 42 53 53 53 53 39 47 49 39 58 28 41 52 50 43 50 50 51 40 40 58 32 50 58 58 22 37 49 39 50 37 50 42 46 39 58 50 37 40 32 53 39 41 39 34 31 30 54 54 24 50 32 49 40 51 23 37 54 35 54 52 38 54 51 37 49 32 33 41 54 27 49 25 44 40 51 31 36 54 54 40 37 34 53 53 34 32 39 35 44 30 23 28 53 49 34 35 34 35 33 31 32 52 42 32 51 42 23 42 32 32 34 42 35 32 31 32 34 45 31 32 10 45 31 18 31 33 33 29 31 33 29 41 26 46 33 30 45 33 19 31 42 29 24 31 35 31 26 28 35 45 32 32 36 33 30 45 31 45 26 33 13 33 23 27 27 21 29 31 33 25 30 27 46 46 46 16 46 12 29 25 12 38 31 32 16 30 25 31 30 30 25 25 22 20 25 20 16 28 17 31 29 17 32 26 25 40 28 27 25 31 43 34 30 31 16 33 37 27 9 26 31 13 30 23 18 29 24 46 28 38 27 41 16 10 16 22 27 31 25 30 26 21 44 32 32 26 29 31 31 31 34 30 25 32 32 27 37 22 17 22 25 34 19 17 18 29 20 19 21 17 20 22 31 17 41 7 27 12 17 12 18 18 27 12 24 13 23 10 22 4 6 4 8 4 6 22 10 17 19 15 19 12 23 21 7 5 17 7 32 22 29 11 37 8 6 6 4 12 31 34 14 10 9 10 7 8 28 15 31 9 9 5 6 6 17 30 11 6 6 12 9 9 5 23 11 10 6 4 6 8 6 6 5 3 11 6 3 3 3 5 8 18 16 16 7 14 11 4 5 6 5 7 24 10 16 17 8 22 6 11 11 11 5 6 9 9 6 15 7 5 9 6 22 9 4 6	Open. Hide. 49 44 44 44 62 62 62 59 59 62 59 59 56 56 59 54 54 62 62 62 62 62 62 49 54 59 39 62 62 59 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 59 62 62 62 59 62 62 62 62 54 59 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 38 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 39 62 62 62 62 62 62 62 62 58 58 58 54 40 58 58 58 58 58 58 58 49 54 54 54 41 58 54 54 54 58 54 54 58 58 58 58 45 41 58 58 58 58 58 58 54 58 58 54 54 58 58 58 58 58 58 58 43 58 58 52 48 58 47 58 46 54 58 58 58 58 58 58 58 58 51 53 53 58 51 47 54 52 51 58 58 58 58 58 58 58 58 58 49 48 48 49 51 58 51 51 49 52 58 54 58 52 46 58 58 51 51 41 58 46 54 58 51 58 38 21 58 58 52 58 49 41 50 43 51 54 53 54 47 41 49 58 51 58 49 47 41 53 46 41 54 58 39 58 18 49 50 52 58 58 58 58 50 58 58 24 58 50 58 50 46 39 53 54 49 50 54 54 53 51 54 53 35 39 49 54 37 49 51 51 52 52 42 53 40 40 54 54 31 51 50 37 54 54 49 52 54 54 46 52 45 54 51 46 42 44 40 54 40 47 47 41 28 53 40 46 40 49 54 47 47 46 40 21 54 41 47 39 53 37 34 53 40 41 40 40 47 29 52 33 26 51 52 32 47 41 34 53 53 51 41 31 32 18 40 27 21 31 51 52 34 53 36 47 40 31 23 45 40 40 33 20 41 31 51 32 33 41 32 35 21 46 42 13 30 19 37 42 31 31 31 51 46 31 42 30 31 25 26 29 31 18 38 43 48 42 30 46 20 25 46 46 34 32 23 47 43 31 31 47 30 31 21 46 25 37 27 31 19 9 5 29 46 44 32 31 30 25 18 41 37 31 28 17 23 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_120050411_120051231
seq2: B6Ng01-319M12.g_65_886

seq1  GAATTCTAGGTTTCCGGGTTGGGGGATAACTGTATGAACCACTTCGAAAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAGGTTTCCGGGTTGGGGGATAACTGTATGAACCACTTCGAAAC  50

seq1  AGAGCCATCTTGCTGTAGTACCCATGGAGTCCTGGATGAATTTCGTGGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCATCTTGCTGTAGTACCCATGGAGTCCTGGATGAATTTCGTGGGC  100

seq1  CTCTGAAGAAAGTGACGCGCATTTCCACAGGAACTGGCTCCAAGCCCGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGAAGAAAGTGACGCGCATTTCCACAGGAACTGGCTCCAAGCCCGTC  150

seq1  TTACGGGTGGTGGAGAGCCCAGTAGGGATTCCAGAATACAGCTCAGGAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACGGGTGGTGGAGAGCCCAGTAGGGATTCCAGAATACAGCTCAGGAGG  200

seq1  CTACCCCGAGTTCGGCTACCGTCCCAGGACCCCTCAGAAAGACACGTTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCCCGAGTTCGGCTACCGTCCCAGGACCCCTCAGAAAGACACGTTTG  250

seq1  GTGCGAAAATCTCCTACACACCAGCTGGGTTTTTATTCCTTCCCTCCCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCGAAAATCTCCTACACACCAGCTGGGTTTTTATTCCTTCCCTCCCCA  300

seq1  GAGTGTGCTCTGGGCGCGCGGGAAACAAGGAAAAAGCACGTACCTGGCGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGTGCTCTGGGCGCGCGGGAAACAAGGAAAAAGCACGTACCTGGCGG  350

seq1  CGCTCTGAGGGCAGCCTCACCGGCCCTCCGTAGGCAAGGGAGCTCCCAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTCTGAGGGCAGCCTCACCGGCCCTCCGTAGGCAAGGGAGCTCCCAGA  400

seq1  AGCTACTCCCTATCCGGCTGGTCGACCCTAGGCCTGTCCCTCCATCCCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTACTCCCTATCCGGCTGGTCGACCCTAGGCCTGTCCCTCCATCCCTC  450

seq1  CCTCCCTACCCGGCTGGTCGACCTCCGCCGAGCTAATTCTCCAGGAGGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCTACCCGGCTGGTCGACCTCCGCCGAGCTAATTCTCCAGGAGGCA  500

seq1  GGAGCGGGATACCCGGCCCGCCTTTCTGGAAATGGGATCCGTTTTTTAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCGGGATACCCGGCCCGCCTTTCTGGAAATGGGATCCGTTTTTTAGC  550

seq1  GCCAGGGCCCGCGCCAACGTCCAGGCCACCGTCGGCGCGCAGGGTTTCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGGCCCGCGCCAACGTCCAGGCCACCGTCGGCGCGCAGGGTTTCCC  600

seq1  TAGTCCTTTGGATCAGCAGAGAGTGGGGCGGCCTGGACGCTGGGCTGCGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTCCTTTGGATCAGCAGAGAGTGGGGCGGCCTGGACGCTGGGCTGCGG  650

seq1  CTCGCGCACCAGCTCCCTGTTCCCGCGCGCCCTTCTGCATCCAGGCTCCG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGCGCACCAGCTCCCTGTTCCCGCGCGCCCTTCTGCATCCAGGCTCCG  700

seq1  GCGTGTCCACGTTCCCAATCGCGAAAAGGGGACGAACTCTGAGCCCTCCG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGTGTCCACGTTCCCAATCGCGAAAAGGGGACGAACTCTGAGCCCTCCG  750

seq1  GGAAGAGAAGGCTGCAGCCGCAGTCCAGGAAAGAGCCCTAGGGCGGGAGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAGAAGGCTGCAGCCGCAGTCCAGGAAAGAGCCCTAGGGCGGGAGG  800

seq1  GGTGCA-GGGCGGAGGGGCGGG  821
      |||||| |||||||||||||||
seq2  GGTGCAGGGGCGGAGGGGCGGG  822

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information