MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-326E04
Chromosome	11 (Build37)
Map Location	32,175,689 - 32,349,494
singlet/doublet	doublet
Overlap gene	Hba-x, Hba-a1, F830116E18Rik, Hbq1, Sh3pxd2b
Upstream gene	Stc2, 2310022M17Rik, Cpeb4, 4930524B15Rik, Nsg2, LOC669207, Il9r, 3300001G02Rik, Rhbdf1, Mpg, Mare
Downstream gene	Ubtd2, 1700007I06Rik, Stk10, Fbxw11, LOC666616, 1700008A04Rik, LOC666620, LOC670035, LOC432548, Fgf18, Npm1, LOC666646, Tlx3, Ranbp17, LOC666258, Anp32c, LOC669306, LOC666269
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20856 MGI:1316731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310022M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69556 MGI:1916806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpeb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67579 MGI:1914829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930524B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67592 MGI:1914842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18197 MGI:1202070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669207 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Il9r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16199 MGI:96564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3300001G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78372 MGI:1925622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13650 MGI:104328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268395 MGI:97073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mare (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17168 MGI:109258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hba-x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15126 MGI:96019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hba-a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15122 MGI:96015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F830116E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544763 MGI:3613460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216635 MGI:2685722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3pxd2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268396 MGI:2442062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubtd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327900 MGI:2444752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700007I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69306 MGI:1916556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20868 MGI:1099439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103583 MGI:2144023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	1700008A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69351 MGI:1916601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC666620 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666620
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC670035 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC432548 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 2332 ESTs, 13 Proteins

name	Fgf18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14172 MGI:1277980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18148 MGI:106184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666646 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 ESTs, 6 Proteins pseudo : _no_value

name	Tlx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27140 MGI:1351209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ranbp17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66011 MGI:1929706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Anp32c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:448829 MGI:3525200
definition	gene_synonym : Anp32cl note : acidic leucine-rich nuclear phosphoprotein 32 family member C pseudo : _no_value

name	LOC669306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 48 ESTs, 3 Proteins pseudo : _no_value

name	LOC666269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins pseudo : _no_value

name	Stc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982532 GeneID:20856 MGI:1316731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stanniocalcin 2 transcript_id : NM_011491.3

name	2310022M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906186 GeneID:69556 MGI:1916806
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310022M17 gene transcript_id : NM_001024919.1

name	Cpeb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129821 GeneID:67579 MGI:1914829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoplasmic polyadenylation element binding protein 4 transcript_id : NM_026252.3

name	4930524B15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385771 GeneID:67592 MGI:1914842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930524B15 gene transcript_id : NM_026262.1

name	Nsg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802730 GeneID:18197 MGI:1202070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron specific gene family member 2 transcript_id : NM_008741.2

name	Il9r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680438 GeneID:16199 MGI:96564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 9 receptor transcript_id : NM_008374.1

name	3300001G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801894 GeneID:78372 MGI:1925622
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3300001G02 gene transcript_id : NM_030093.2

name	Rhbdf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32306546 GeneID:13650 MGI:104328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid family 1 (Drosophila) transcript_id : NM_010117.1

name	Mpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560564 GeneID:268395 MGI:97073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-methylpurine-DNA glycosylase transcript_id : NM_010822.2

name	Mare (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363143 GeneID:17168 MGI:109258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha globin regulatory element containing gene transcript_id : NM_181569.2

name	Hba-x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350815 GeneID:15126 MGI:96019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin X, alpha-like embryonic chain in Hba complex transcript_id : NM_010405.3

name	Hba-a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680174 GeneID:15122 MGI:96015
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin alpha, adult chain 1 transcript_id : NM_008218.1

name	F830116E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385981 GeneID:544763 MGI:3613460
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F830116E18 gene transcript_id : NM_001033981.2

name	Hbq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803511 GeneID:216635 MGI:2685722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin, theta 1 transcript_id : NM_175000.2

name	Sh3pxd2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63055064 GeneID:268396 MGI:2442062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and PX domains 2B transcript_id : NM_177364.3

name	Ubtd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254262 GeneID:327900 MGI:2444752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin domain containing 2 transcript_id : NM_173784.3

name	1700007I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380128 GeneID:69306 MGI:1916556
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700007I06 gene transcript_id : NM_027031.2

name	Stk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362972 GeneID:20868 MGI:1099439
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 10 transcript_id : NM_009288.2

name	Fbxw11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129917 GeneID:103583 MGI:2144023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 11 transcript_id : NM_134015.2

name	1700008A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94389934 GeneID:69351 MGI:1916601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700008A04 gene, transcript variant 1 transcript_id : XM_126070.5

name	LOC670035 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261661 GeneID:670035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Mnn4p transcript_id : XM_001478417.1

name	LOC432548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261696 GeneID:432548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 2332 ESTs, 13 Proteins product : similar to 37kDa oncofetal antigen transcript_id : XM_484006.5

name	Fgf18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679780 GeneID:14172 MGI:1277980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 18 transcript_id : NM_008005.1

name	Npm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357495 GeneID:18148 MGI:106184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleophosmin 1 transcript_id : NM_008722.2

name	Tlx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910537 GeneID:27140 MGI:1351209
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia, homeobox 3 transcript_id : NM_019916.1

name	Ranbp17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13249348 GeneID:66011 MGI:1929706
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN binding protein 17 transcript_id : NM_023146.1

name	Stc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755676 CCDS:CCDS24512.1 GeneID:20856 MGI:1316731
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : stanniocalcin 2-like product : stanniocalcin 2 protein_id : NP_035621.1

name	2310022M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906187 CCDS:CCDS24513.1 GeneID:69556 MGI:1916806
definition	codon_start : 1 note : family with sequence similarity 44, member B product : hypothetical protein LOC69556 protein_id : NP_001020090.1

name	Cpeb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138749 CCDS:CCDS24514.1 GeneID:67579 MGI:1914829
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : cytoplasmic polyadenylation element binding protein 4 protein_id : NP_080528.2

name	4930524B15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385772 CCDS:CCDS24515.1 GeneID:67592 MGI:1914842
definition	codon_start : 1 product : hypothetical protein LOC67592 protein_id : NP_080538.1

name	Nsg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679142 CCDS:CCDS24516.1 GeneID:18197 MGI:1202070
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0050780 - dopamine receptor binding [Evidence IEA] GO_process : GO:0007212 - dopamine receptor signaling pathway [Evidence IEA] codon_start : 1 product : neuron specific gene family member 2 protein_id : NP_032767.1

name	Il9r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680439 CCDS:CCDS24517.1 GeneID:16199 MGI:96564
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 9 receptor protein_id : NP_032400.1

name	3300001G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313436 CCDS:CCDS24518.1 GeneID:78372 MGI:1925622
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 3300001G02 protein_id : NP_084369.1

name	Rhbdf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32306547 CCDS:CCDS24519.1 GeneID:13650 MGI:104328
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epidermal growth factor receptor related sequence product : rhomboid family 1 protein_id : NP_034247.1

name	Mpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106361 CCDS:CCDS24520.1 GeneID:268395 MGI:97073
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003905 - alkylbase DNA N-glycosylase activity [Evidence IMP] [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IMP]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alkylpurine-DNA-N-glycosylase; 3-methyladenine DNA glycosylase product : N-methylpurine-DNA glycosylase protein_id : NP_034952.1

name	Mare (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38194222 CCDS:CCDS24521.1 GeneID:17168 MGI:109258
definition	codon_start : 1 note : -14 product : alpha globin regulatory element containing protein_id : NP_853547.1

name	Hba-x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754162 CCDS:CCDS24522.1 GeneID:15126 MGI:96019
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : zeta globin; hemaglobin zeta product : hemoglobin X, alpha-like embryonic chain in Hba complex protein_id : NP_034535.1

name	Hba-a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680175 CCDS:CCDS24523.1 GeneID:15122 MGI:96015
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha 1 globin; alpha-globin; alpha globin 1; haemaglobin alpha 1; alpha globin 2; haemaglobin alpha 2 product : hemoglobin alpha 1 chain protein_id : NP_032244.1

name	F830116E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77020268 CCDS:CCDS24524.1 GeneID:544763 MGI:3613460
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to hemoglobin alpha product : similar to hemoglobin, theta 1 protein_id : NP_001029153.1

name	Hbq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239411 CCDS:CCDS24525.1 GeneID:216635 MGI:2685722
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to hemoglobin alpha product : hemoglobin, theta 1 protein_id : NP_778165.1

name	Sh3pxd2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63055065 CCDS:CCDS24526.1 GeneID:268396 MGI:2442062
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : SH3 and PX domains 2B protein_id : NP_796338.2

name	Ubtd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254263 CCDS:CCDS24527.1 GeneID:327900 MGI:2444752
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : dendritic cell-derived ubiquitin-like protein protein_id : NP_776145.2

name	1700007I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312262 CCDS:CCDS24528.1 GeneID:69306 MGI:1916556
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69306 protein_id : NP_081307.1

name	Stk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362973 CCDS:CCDS24529.1 GeneID:20868 MGI:1099439
definition	EC_number : 2.7.11.1 GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : germ cell kinase 1; lymphocyte-oriented kinase; serine/threonine-protein kinase 10 product : serine/threonine kinase 10 protein_id : NP_033314.2

name	Fbxw11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956270 GeneID:103583 MGI:2144023
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box and WD-40 domain protein 1B product : F-box and WD-40 domain protein 11 protein_id : NP_598776.1

name	1700008A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933803 GeneID:69351 MGI:1916601
definition	codon_start : 1 product : hypothetical protein LOC69351 isoform 1 protein_id : XP_126070.3

name	LOC670035 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261662 GeneID:670035
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478467.1

name	LOC432548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51766344 GeneID:432548
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484006.1

name	Fgf18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679781 CCDS:CCDS24531.1 GeneID:14172 MGI:1277980
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence TAS]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030324 - lung development [Evidence IMP]; GO:0001503 - ossification [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 function : stimulates hepatic and intestinal proliferation product : fibroblast growth factor 18 protein_id : NP_032031.1

name	Npm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679108 CCDS:CCDS24532.1 GeneID:18148 MGI:106184
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0051059 - NF-kappaB binding [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IDA]; GO:0051082 - unfolded protein binding [Evidence ISS] GO_process : GO:0007569 - cell aging [Evidence ISS]; GO:0007098 - centrosome cycle [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0006913 - nucleocytoplasmic transport [Evidence ISS]; GO:0008104 - protein localization [Evidence IMP]; GO:0043516 - regulation of DNA damage response, signal transduction by p53 class mediator [Evidence IGI] codon_start : 1 note : nucleolar protein NO38 product : nucleophosmin 1 protein_id : NP_032748.1

name	Tlx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910538 CCDS:CCDS24533.1 GeneID:27140 MGI:1351209
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001708 - cell fate specification [Evidence IMP] [Evidence IGI]; GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0045665 - negative regulation of neuron differentiation [Evidence IGI]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0048665 - neuron fate specification [Evidence IGI]; GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP] codon_start : 1 exception : mismatches in translation note : respiratory neuron homeobox; homeo box 11-like 2 product : T-cell leukemia, homeobox 3 protein_id : NP_064300.1

name	Ranbp17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13249349 CCDS:CCDS24534.1 GeneID:66011 MGI:1929706
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA]; GO:0008536 - Ran GTPase binding [Evidence TAS] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence TAS]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAN binding protein 17 protein_id : NP_075635.1

name	LOC666616 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666616
definition	number : 2 pseudo : _no_value

name	LOC666616 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666616
definition	number : 1 pseudo : _no_value

name	LOC666620 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666620
definition	number : 1 pseudo : _no_value

name	LOC666258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666258
definition	number : 1 pseudo : _no_value

name	LOC669207 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261657 GeneID:669207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to hCG2016250 pseudo : _no_value transcript_id : XR_033651.1

name	LOC666646 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261697 GeneID:666646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 ESTs, 6 Proteins product : similar to single-stranded DNA binding protein 1 pseudo : _no_value transcript_id : XR_034477.1

name	LOC669306 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261699 GeneID:669306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 48 ESTs, 3 Proteins product : similar to intersex-like pseudo : _no_value transcript_id : XR_034488.1

name	LOC666269 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261698 GeneID:666269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_034484.1

clone name	MSMg01-306E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508J19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-424K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-326E04.b	B6Ng01-326E04.g
ACC	GA114114	GA114115
length	1,158	1,100
definition	B6Ng01-326E04.b	B6Ng01-326E04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(32,175,689 - 32,176,852)	(32,348,396 - 32,349,494)
sequence	gaattctactcttagatacagatgtatcaactgacacagatatagagaaa tagaattgtaagctcacacagaggtctctctgtgaatgtggacgaaggac aaactgctgcatattcataccacaaaataaaaagtagccaactactggtg aatacaaaagcagatggatctacaggatattatacaaggggaaagaaagc cagtcttaaaaaggtaaaatatggtatgattccagttacacacatttttg aaaaggatgaattaggttaggttaggagcaagaggaagatgagggctcca aatgggtggctgtggagttttaagatggtggagctacatagatctatata tgtgtcagtccaggacaatgagcaaaccaacctatctccatgttaagata aaaactaagagaactgtgcatttcattgtatattggttggtatggagggc tagctggagactggagatcttttgttgacccgttactcctcctagtgaga gcagacttccatgatcttccctcagtgctaagtgagaggaattactgctt ccttggagggaacccaagagtcactgacattaggtgacagggatggctca gacaatttgtgattctgaaatgagaaaggacagtgcaggtctggatacaa gaatgacctcctgacatggctgggcccctatctctcctggattctgtgtg ggactaaggccaacacccctcctaaggccatgggcagtgggcaagagcga tagcacttgcccttacagtcccaccaagccctaattcccattgttgctgg ctctgataacaggctccaccctgcaagccccctcccctctcctaaccagt ggccacagcctgacaggtccctgaccatgtgtatataaaggagacactgg ggacaagcaccatcaggccagtcttgagtgcactcaactccagcgcagcc tccaaccctcaccacaccaccaccatgtctctgatgagaatgagagagct tatcatcatgtcatgttgggagaagatggctgctcaggccgagcccattg gcactgagactctagagaggtaagttcaagcaaccattgctgagtagcag tccgaagaggattggtgagaagaatgtacaaagagcagttatggaggaaa gccactga	gaattcataagatacaaagaaagtgaaagtacaaacaaaacaacaaagga aaaagagaaagtaaagaaccggtgggggtggggggaacccagcagctcaa ataaaacaaaactgtggttctttgaatatcacaaaatagtctactagata attcgattttaaaagcatatgtgggtgggaaagaataaagcacaaataca tagaataggaaatgaccagggaagatgctgttactgctgaggaagccaga aagttgacgtcactgtacacaccaactctgtcttggtccatttggattct gtaacaaaatcctcaaacctggggaatttacagactcctagcctttatgg attcagagtagagtgggaccaatttctggttctcagatgacaccttgaac atgctctatagaccaagctggccttggattttcggatcctcttgtttctg cctcccagttacagtggttatgggcgtgtggcgtcacatcaggccatggg tcttttttgtaaggtcactagtgccatccaggaagccttagccctctgag cagactacctccccataggtctcattccctaatactgtcagcctgtacaa cacttatgaaaacatgctgaaataataaaagaaaaaccctggaaagaaaa agatataatgagatgagtgtcttaggaaaatgtagttgacaagacttgac ctcaccagagacggaaagttgaatccatttcaaaagagtgatgtttcatt cagtgtatcaaatagacagtatcagtactgagagactcctgtgccacaca cctcagtgccacactcacaggagagctgtaactagtcactgaaagattac tatataaagggtcctgggacagagcaaacgagggcattttccaaatcctc ctctttcccccagacaggttctaacttatgcagatctgtcttacaccaaa ttatttttatgaaccctggcaaacacttaacatctcaagctaataaaaaa tggtatagaaaatatgatagcatttctaagccattaccacttatatatca tcttcaaccccaaataaaataaatattattttactggaatgaaatattat
quality values	Open. Hide. 47 31 23 38 62 62 62 54 54 62 62 62 62 62 56 62 56 62 56 31 62 62 49 54 62 56 59 59 44 30 51 45 34 24 28 29 43 24 50 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 54 62 62 59 54 35 54 56 48 56 62 62 59 62 59 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 56 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 36 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 49 49 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 54 58 58 58 58 58 54 58 58 54 41 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 35 58 58 58 49 46 58 58 54 58 58 58 52 58 54 54 54 58 58 54 54 42 58 58 52 54 58 49 58 54 54 52 54 58 58 42 41 58 58 51 58 53 50 42 58 46 51 40 49 58 58 48 41 54 42 28 51 53 53 51 58 58 50 53 53 51 50 58 54 58 40 54 51 52 50 50 51 58 50 51 27 58 50 51 51 58 58 53 53 52 50 37 50 40 53 39 39 49 46 39 50 47 54 44 48 54 51 50 15 33 42 43 42 51 58 58 40 46 58 58 58 42 52 52 58 35 58 53 58 58 53 58 12 29 16 39 58 42 58 52 52 53 54 58 43 37 28 42 42 51 21 44 33 40 32 32 50 31 43 58 58 53 53 53 54 32 40 53 32 49 18 50 36 45 51 54 42 40 39 39 26 33 27 27 34 26 53 40 54 25 51 32 37 36 43 39 52 38 53 41 35 40 45 54 41 39 45 24 37 28 42 45 52 54 52 32 46 45 17 33 39 53 54 47 37 25 40 37 25 21 54 31 34 22 19 33 28 39 33 31 40 45 37 19 41 27 32 30 30 24 34 33 34 21 19 54 28 53 41 24 16 32 52 40 27 32 35 31 31 32 23 40 51 53 32 32 25 53 53 32 34 29 32 31 28 34 25 12 14 27 27 30 19 41 32 32 34 29 33 30 31 26 30 28 30 27 26 18 12 43 30 27 51 30 31 28 41 20 33 31 39 36 31 31 22 21 31 26 31 23 32 18 18 31 30 11 36 21 20 30 26 31 48 48 30 30 18 15 31 30 31 12 20 44 21 37 35 18 27 20 27 26 9 17 25 31 33 26 31 31 22 31 31 17 21 24 21 27 16 37 29 38 30 32 18 31 29 32 32 32 23 18 19 31 31 25 11 27 26 46 33 27 30 20 25 29 18 46 13 16 28 35 35 31 24 24 28 21 30 38 33 32 32 27 36 27 38 24 19 44 11 21 22 17 19 19 11 31 14 21 13 21 19 7 8 20 28 14 10 9 18 33 32 23 36 17 23 14 7 18 11 48 21 26 9 33 17 5 4 4 18 23 9 18 29 14 19 10 5 7 12 19 21 10 32 7 21 34 33 12 33 32 17 22 7 10 23 23 20 22 11 13 12 22 21 10 9 8 14 5 12 7 19 7 15 37 13 13 10 28 11 6 22 6 8 10 28 27 9 11 10 10 8 20 16 13 10 27 29 8 10 10 17 7 10 5 6 25 18 8 21 12 12 4 9 14 18 7 13 7 7 6 5 3 3 6 5 3 6 7 21 16 8 30 11 7 21 5 8 6 7 27 4 5 5 3 4 5 7 17 17 12 22 5 17 11 5 8 15 8 2	Open. Hide. 62 47 35 47 62 44 39 62 59 62 30 59 38 28 50 31 27 28 28 24 38 46 59 59 62 54 59 59 62 62 59 62 56 56 56 59 59 62 62 56 62 59 56 59 59 59 62 59 62 59 62 62 62 62 62 62 62 62 59 56 62 59 56 59 59 59 62 62 62 62 59 62 46 59 62 62 62 62 50 62 62 62 54 62 62 59 62 59 49 49 54 62 62 62 62 62 42 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 59 59 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 47 62 56 62 62 62 62 54 54 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 47 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 54 62 38 52 62 62 62 62 62 62 62 62 62 54 48 62 62 62 62 62 62 62 62 52 54 58 58 58 58 52 54 58 58 58 58 58 58 58 46 58 58 40 54 54 54 54 54 58 58 58 58 49 49 52 54 46 54 58 58 54 54 52 52 54 54 58 58 58 54 52 58 54 54 58 58 58 54 58 52 54 58 58 54 58 36 54 54 39 58 54 54 52 58 58 52 58 58 58 58 58 58 58 52 54 58 54 58 58 58 49 47 46 52 51 52 53 58 58 58 39 58 58 58 58 50 52 58 58 53 58 58 58 58 54 50 58 58 58 58 48 50 45 28 39 51 50 54 49 58 58 49 51 29 58 51 40 53 58 46 51 53 53 53 16 41 43 58 58 33 39 51 39 39 50 36 32 48 51 32 29 50 50 38 40 40 58 50 40 43 54 50 53 39 49 40 37 39 51 18 26 36 52 51 49 50 43 40 40 40 43 46 25 33 50 51 32 51 58 49 51 35 41 44 39 37 52 29 24 38 42 40 54 31 54 54 41 28 54 52 52 30 32 28 54 41 31 40 43 35 54 50 52 42 42 52 37 32 39 34 42 31 36 32 15 15 16 29 33 45 51 33 44 40 28 12 47 37 51 37 47 32 41 13 23 22 32 31 45 37 45 46 52 32 31 26 20 52 32 47 16 31 31 31 53 32 14 29 27 36 40 40 24 51 16 21 31 31 26 12 46 30 31 24 30 30 31 26 30 30 33 19 40 32 33 12 9 19 34 33 28 31 27 21 30 27 41 24 30 46 32 20 32 46 24 31 42 29 14 18 25 30 33 10 43 31 42 31 28 24 41 8 41 32 20 11 24 46 46 31 31 39 21 41 27 20 10 21 11 23 34 31 31 20 46 23 31 48 48 48 31 23 19 39 16 24 33 34 16 31 26 14 10 17 24 17 10 14 31 31 31 17 10 13 17 21 33 37 19 33 22 14 23 24 16 30 10 19 32 31 18 23 21 20 43 37 43 25 7 6 15 18 34 11 37 8 7 20 31 22 26 33 23 17 18 29 8 31 17 21 22 17 34 33 25 21 18 14 21 18 11 25 24 28 12 30 30 28 20 17 4 20 21 4 10 8 8 18 14 31 21 16 6 11 5 13 23 9 7 7 28 24 20 32 12 24 17 9 7 16 7 5 8 6 4 11 10 21 6 3 3 17 16 7 21 13 19 23 23 9 25 22 15 3 1 7 14 12 26 25 14 3 12 11 6 9 23 21 7 9 14 17 6 9 4 19 20 16 6 17 16 14 7 12 1 5 4 16 17 3 1 14 28 18 7 5 16 5 5 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_32175689_32176852
seq2: B6Ng01-326E04.b_48_1205

seq1  GAATTCTACTCTTAGATACAGATGTATCAACTGACACAGATATAGAGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACTCTTAGATACAGATGTATCAACTGACACAGATATAGAGAAA  50

seq1  TAGAATTGTAAGCTCACACAGAGGTCTCTCTGTGAATGTGGACGAAGGAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATTGTAAGCTCACACAGAGGTCTCTCTGTGAATGTGGACGAAGGAC  100

seq1  AAACTGCTGCATATTCATACCACAAAATAAAAAGTAGCCAACTACTGGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGCTGCATATTCATACCACAAAATAAAAAGTAGCCAACTACTGGTG  150

seq1  AATACAAAAGCAGATGGATCTACAGGATATTATACAAGGGGAAAGAAAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACAAAAGCAGATGGATCTACAGGATATTATACAAGGGGAAAGAAAGC  200

seq1  CAGTCTTAAAAAGGTAAAATATGGTATGATTCCAGTTACACACATTTTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTTAAAAAGGTAAAATATGGTATGATTCCAGTTACACACATTTTTG  250

seq1  AAAAGGATGAATTAGGTTAGGTTAGGAGCAAGAGGAAGATGAGGGCTCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGATGAATTAGGTTAGGTTAGGAGCAAGAGGAAGATGAGGGCTCCA  300

seq1  AATGGGTGGCTGTGGAGTTTTAAGATGGTGGAGCTACATAGATCTATATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGTGGCTGTGGAGTTTTAAGATGGTGGAGCTACATAGATCTATATA  350

seq1  TGTGTCAGTCCAGGACAATGAGCAAACCAACCTATCTCCATGTTAAGATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCAGTCCAGGACAATGAGCAAACCAACCTATCTCCATGTTAAGATA  400

seq1  AAAACTAAGAGAACTGTGCATTTCATTGTATATTGGTTGGTATGGAGGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTAAGAGAACTGTGCATTTCATTGTATATTGGTTGGTATGGAGGGC  450

seq1  TAGCTGGAGACTGGAGATCTTTTGTTGACCCGTTACTCCTCCTAGTGAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTGGAGACTGGAGATCTTTTGTTGACCCGTTACTCCTCCTAGTGAGA  500

seq1  GCAGACTTCCATGATCTTCCCTCAGTGCTAAGTGAGAGGAATTACTGCTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGACTTCCATGATCTTCCCTCAGTGCTAAGTGAGAGGAATTACTGCTT  550

seq1  CCTTGGAGGGAACCCAAGAGTCACTGACATTAGGTGACAGGGATGGCTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGGAGGGAACCCAAGAGTCACTGACATTAGGTGACAGGGATGGCTCA  600

seq1  GACAATTTGTGATTCTGAAATGAGAAAGGACAGTGCAGGTCTGGATACAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAATTTGTGATTCTGAAATGAGAAAGGACAGTGCAGGTCTGGATACAA  650

seq1  GAATGACCTCCTGACATGGCTGGGCCCCTATCTCTCCTGGATTCTGTGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGACCTCCTGACATGGCTGGGCCCCTATCTCTCCTGGATTCTGTGTG  700

seq1  GGACTAAGGCCAACACCCCTCCTAAGGCCATGGGCAGTGGGCAAGAGCGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTAAGGCCAACACCCCTCCTAAGGCCATGGGCAGTGGGCAAGAGCGA  750

seq1  TAGCACTTGCCCTTACAGTCCCACCAAGCCCTAATTCCCATTGTTGCTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCACTTGCCCTTACAGTCCCACCAAGCCCTAATTCCCATTGTTGCTGG  800

seq1  CTCTGATAACAGGCTCCACCCTGCAAGCCCCCTCCCCTCTCCTAACCAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGATAACAGGCTCCACCCTGCAAGCCCCCTCCCCTCTCCTAACCAGT  850

seq1  GGCCACAGCCTGACAGGTCCCTGACCATGTGTATATAAAGGAGACACTGG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCACAGCCTGACAGGTCCCTGACCATGTGTATATAAAGGAGACACTGG  900

seq1  GGACAAGCACCATCAGGCCAGTCTTGAGTGCACTCAACTCCAGCGCAGCC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAAGCACCATCAGGCCAGTCTTGAGTGCACTCAACTCCAGCGCAGCC  950

seq1  TCCAACCCTCACCACCACCACCACCATGTCTCTGATGAAGAATGAGAGAG  1000
      |||||||||||||| |||||||||||||||||||||| ||||||||||||
seq2  TCCAACCCTCACCA-CACCACCACCATGTCTCTGATG-AGAATGAGAGAG  998

seq1  C-TATCATCATGTCCATG-TGGGAGAAGATGGCTGCTCAGGCCGAGCCCA  1048
      | ||||||||||| |||| |||||||||||||||||||||||||||||||
seq2  CTTATCATCATGT-CATGTTGGGAGAAGATGGCTGCTCAGGCCGAGCCCA  1047

seq1  TTGGCACTGAGACTCTAGAGAGGTAAGTCCAGGC-ACCATGGCTTGAGTA  1097
      |||||||||||||||||||||||||||| || || ||||| || ||||| 
seq2  TTGGCACTGAGACTCTAGAGAGGTAAGTTCAAGCAACCATTGC-TGAGT-  1095

seq1  AGCAGGTCAGAAGAGGGATTGGTGAGACAGAAGTGACAAAGAGCAGTTAG  1147
      |||| ||| ||||| |||||||||||| ||||   |||||||||||||| 
seq2  AGCA-GTCCGAAGA-GGATTGGTGAGA-AGAATGTACAAAGAGCAGTTAT  1142

seq1  TGAGGAGAAGCCACTGA  1164
       ||||| ||||||||||
seq2  GGAGGA-AAGCCACTGA  1158

seq1: chr11_32348396_32349494
seq2: B6Ng01-326E04.g_64_1163 (reverse)

seq1  ATAATATTTTATTTCTGGTAAAATAATATTTTATTTTATTTGGGGTTTAA  50
      ||||||||| | |||  ||||||||||| |||||||||||||||| || |
seq2  ATAATATTTCA-TTCCAGTAAAATAATA-TTTATTTTATTTGGGG-TTGA  47

seq1  AGATGATATTATAAATGGTATTGGCCTAG-AATGCTATCTTATTTTCTAT  99
      |||||||| ||||| ||||| |||| ||| ||||||||| ||||||||||
seq2  AGATGATA-TATAAGTGGTAATGGCTTAGAAATGCTATCATATTTTCTAT  96

seq1  ACCA-TTTTTATTAGCTTGAGATGTTAAGTGTTTGCCA-GGTTCATAAAA  147
      |||| ||||||||||||||||||||||||||||||||| |||||||||||
seq2  ACCATTTTTTATTAGCTTGAGATGTTAAGTGTTTGCCAGGGTTCATAAAA  146

seq1  ATAATTTGGTGTAAGACAGATCTGCAT-AGTTAGAACCTGTCTGGGGGAA  196
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  ATAATTTGGTGTAAGACAGATCTGCATAAGTTAGAACCTGTCTGGGGGAA  196

seq1  AGAGGAGGATTTGG-AAATGCCCTCGTTTGCTCTGTCCCAGGACCCTTTA  245
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AGAGGAGGATTTGGAAAATGCCCTCGTTTGCTCTGTCCCAGGACCCTTTA  246

seq1  TATAGTAATCTTTCAGTGACTAGTTACAGCTCTCCTGTGAGTGTGGCACT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGTAATCTTTCAGTGACTAGTTACAGCTCTCCTGTGAGTGTGGCACT  296

seq1  GAGGTGTGTGGCACAGGAGTCTCTCAGTACTGATACTGTCTATTTGATAC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTGTGTGGCACAGGAGTCTCTCAGTACTGATACTGTCTATTTGATAC  346

seq1  ACTGAATGAAACATCACTCTTTTGAAATGGATTCAACTTTCCGTCTCTGG  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAATGAAACATCACTCTTTTGAAATGGATTCAACTTTCCGTCTCTGG  396

seq1  TGAGGTCAAGTCTTGTCAACTACATTTTCCTAAGACACTCATCTCATTAT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGTCAAGTCTTGTCAACTACATTTTCCTAAGACACTCATCTCATTAT  446

seq1  ATCTTTTTCTTTCCAGGGTTTTTCTTTTATTATTTCAGCATGTTTTCATA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTTTCTTTCCAGGGTTTTTCTTTTATTATTTCAGCATGTTTTCATA  496

seq1  AGTGTTGTACAGGCTGACAGTATTAGGGAATGAGACCTATGGGGAGGTAG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTTGTACAGGCTGACAGTATTAGGGAATGAGACCTATGGGGAGGTAG  546

seq1  TCTGCTCAGAGGGCTAAGGCTTCCTGGATGGCACTAGTGACCTTACAAAA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCTCAGAGGGCTAAGGCTTCCTGGATGGCACTAGTGACCTTACAAAA  596

seq1  AAGACCCATGGCCTGATGTGACGCCACACGCCCATAACCACTGTAACTGG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACCCATGGCCTGATGTGACGCCACACGCCCATAACCACTGTAACTGG  646

seq1  GAGGCAGAAACAAGAGGATCCGAAAATCCAAGGCCAGCTTGGTCTATAGA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCAGAAACAAGAGGATCCGAAAATCCAAGGCCAGCTTGGTCTATAGA  696

seq1  GCATGTTCAAGGTGTCATCTGAGAACCAGAAATTGGTCCCACTCTACTCT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGTTCAAGGTGTCATCTGAGAACCAGAAATTGGTCCCACTCTACTCT  746

seq1  GAATCCATAAAGGCTAGGAGTCTGTAAATTCCCCAGGTTTGAGGATTTTG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCCATAAAGGCTAGGAGTCTGTAAATTCCCCAGGTTTGAGGATTTTG  796

seq1  TTACAGAATCCAAATGGACCAAGACAGAGTTGGTGTGTACAGTGACGTCA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAGAATCCAAATGGACCAAGACAGAGTTGGTGTGTACAGTGACGTCA  846

seq1  ACTTTCTGGCTTCCTCAGCAGTAACAGCATCTTCCCTGGTCATTTCCTAT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTCTGGCTTCCTCAGCAGTAACAGCATCTTCCCTGGTCATTTCCTAT  896

seq1  TCTATGTATTTGTGCTTTATTCTTTCCCACCCACATATGCTTTTAAAATC  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATGTATTTGTGCTTTATTCTTTCCCACCCACATATGCTTTTAAAATC  946

seq1  GAATTATCTAGTAGACTATTTTGTGATATTCAAAGAACCACAGTTTTGTT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTATCTAGTAGACTATTTTGTGATATTCAAAGAACCACAGTTTTGTT  996

seq1  TTATTTGAGCTGCTGGGTTCCCCCCACCCCCACCGGTTCTTTACTTTCTC  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTGAGCTGCTGGGTTCCCCCCACCCCCACCGGTTCTTTACTTTCTC  1046

seq1  TTTTTCCTTTGTTGTTTTGTTTGTACTTTCACTTTCTTTGTATCTTATGA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTCCTTTGTTGTTTTGTTTGTACTTTCACTTTCTTTGTATCTTATGA  1096

seq1  ATTC  1099
      ||||
seq2  ATTC  1100

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information